CN114561497B - Primer and probe for identifying novel coronavirus Omicron strain BA.1 subline and application thereof - Google Patents
Primer and probe for identifying novel coronavirus Omicron strain BA.1 subline and application thereof Download PDFInfo
- Publication number
- CN114561497B CN114561497B CN202210463416.1A CN202210463416A CN114561497B CN 114561497 B CN114561497 B CN 114561497B CN 202210463416 A CN202210463416 A CN 202210463416A CN 114561497 B CN114561497 B CN 114561497B
- Authority
- CN
- China
- Prior art keywords
- probe
- subline
- strain
- omicron
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer and a probe for identifying a novel coronavirus Omicron strain BA.1 subline and application thereof. The primer of the invention comprises a primer with a sequence shown as SEQ ID NO.1 and a primer with a sequence shown as SEQ ID NO. 2. The probe of the invention comprises a probe with a sequence shown in SEQ ID NO. 3. By using the primer and the probe, the novel coronavirus Omicron strain BA.1 subline can be distinguished from other strains by a PCR method.
Description
Technical Field
The invention relates to a primer and a probe for identifying a BA.1 subline of a novel coronavirus Omicron strain and application thereof, in particular to a primer, a probe, a kit and a detection method aiming at N211-and L212I mutation sites of an S gene of the BA.1 subline of the novel coronavirus Omicron strain, belonging to the technical field of molecular biology detection.
Background
Infection with the novel coronavirus (SARS-CoV-2) causes respiratory symptoms, fever, cough, shortness of breath, dyspnea, etc., and severe cases may cause the novel coronavirus to pneumonia (COVID-19). With the spread of new coronaviruses in the human population, many mutations occur in the viral genome, wherein the mutations occur at the key amino acid sites of the protective antigen S protein, which may result in the enhancement of the spreading capability and pathogenicity of the virus and the reduction of the protective effect of the existing vaccines. Compared with other novel coronary strains, the infectivity and the transmission capability of the Omicron variant strain are obviously enhanced. There are three sublines of the Omicron strain, BA.1, BA.2 and BA.3, wherein BA.1 is a more prevalent subline and BA.2 and BA.3 are relatively rare. The rapid and accurate identification of the novel coronavirus Omicron strain BA.1 subline is of great significance.
Disclosure of Invention
An object of the present invention is to provide a primer for identifying a novel coronavirus Omicron strain BA.1 subline.
Another object of the present invention is to provide a probe for identifying a BA.1 subline of the Omicron strain of the novel coronavirus.
Another object of the present invention is to provide a kit for identifying a novel coronavirus, Omicron strain BA.1 subline.
Another object of the present invention is to provide the related use of said primer, probe or kit for identifying the BA.1 subline of the novel coronavirus Omicron strain.
In one aspect, the invention provides a primer for identifying a BA.1 subline of a novel coronavirus Omicron strain, which comprises a primer with a sequence shown as SEQ ID NO.1 and a primer with a sequence shown as SEQ ID NO. 2:
SEQ ID NO.1：5’-TAAAATATATTCTAAGCACACGCC-3’；
SEQ ID NO.2：5’-CTACCAATGGTTCTAAAGCC-3’。
the primer for identifying the BA.1 subline of the novel coronavirus Omicron strain is designed aiming at the BA.1 subline S protein of the novel coronavirus Omicron strain. Compared with the prototype strain, the novel coronavirus Omicron strain BA.1 subline has mutation sites: A67V, delta 69-70, T95I, delta 142-144, Y145D, N211-, L212I, G339D, S371L, S373P, S375F, K417N, N440K, G446S, S447N, T478K, E484A, Q493R, G496S, Q498R, N501Y, Y505H, T547K, D614G, H655Y, N679K, P681H, N764K, D796Y, N856K, Q954H, N969K, L981F. Specifically, the primers for identifying the novel coronavirus Omicron strain BA.1 subline of the present invention were designed based on the N211-and L212I mutation sites.
In another aspect, the present invention also provides a probe for identifying a ba.1 subline of a novel coronavirus Omicron strain, said probe comprising:
a probe having a sequence shown in SEQ ID NO. 3:
SEQ ID NO.3：5’-GCGTGAGCCAGAAGATCTCC-3’。
according to a particular embodiment of the invention, the probe further comprises:
a probe having a sequence shown in SEQ ID NO. 4:
SEQ ID NO.4：5’-GTGCGTGATCTCCCTCAG-3’。
the probe having the sequence shown in SEQ ID NO.3 is a probe designed based on the N211-and L212I mutation sites of the S gene of the BA.1 subline of the novel coronavirus strain. The probe with the sequence shown in SEQ ID NO.4 is designed for other novel coronaviruses except the BA.1 subline.
According to a particular embodiment of the invention, the probe may be modified with a fluorophore, the modification comprising:
the base at the 5 'end of the probe sequence is modified by a fluorescent reporter group, and the base at the 3' end of the probe sequence is modified by a fluorescent quenching group.
According to a particular embodiment of the invention, the fluorescent reporter of the probe having the sequence shown in SEQ ID NO.4 is different from the fluorescent reporter of the probe having the sequence shown in SEQ ID NO. 3.
According to the specific embodiment of the invention, the 5 'end base of the sequence of the novel coronavirus Omicron strain BA.1 subline probe (the probe with the sequence shown as SEQ ID NO. 3) is modified by a fluorescent reporter group CY5, and the 3' end base of the probe sequence is modified by a fluorescent quenching group; the 5 'end base of the sequence of other novel coronavirus probes (such as the probe with the sequence shown in SEQ ID NO. 4) except the BA.1 subline is modified by a fluorescence reporter group FAM, and the 3' end base of the probe sequence is modified by a fluorescence quenching group.
In another aspect, the present invention provides a kit for identifying a ba.1 subline of a novel coronavirus Omicron strain, comprising: the primer of the invention and/or the probe of the invention.
According to a particular embodiment of the invention, the kit of the invention further comprises PCR reaction reagents and/or reaction buffers.
According to a specific embodiment of the present invention, the kit of the present invention further comprises a positive quality control material and a negative quality control material; preferably, the positive quality control substance comprises a standard plasmid template of a BA.1 subline S gene of the novel coronavirus Omicron strain, and the negative quality control substance comprises standard plasmid templates of other novel coronavirus S genes except the BA.1 subline.
On the other hand, the invention also provides the application of the primer or the probe or the kit in identifying whether the novel coronavirus Omicron strain BA.1 subline exists in a sample in vitro. Namely, the invention also provides a method for identifying whether the novel coronavirus Omicron strain BA.1 subline exists in a sample in vitro.
According to a specific embodiment of the present invention, in the use of the present invention, the presence or absence of the novel coronavirus Omicron strain BA.1 subline in a sample is identified by PCR reaction, the final concentration of the primer in the PCR reaction system is 0.1-10. mu.M, and the final concentration of the probe in the PCR reaction system is 0.1-10. mu.M.
According to a specific embodiment of the present invention, in the application of the present invention, the PCR may be a single PCR, a multiplex PCR, a digital PCR or an RT-PCR.
In some embodiments of the invention, in the use of the invention, the PCR is a dual probe qPCR, wherein the amplification curve of the probe having the sequence shown in SEQ ID NO.3 is an S-type curve, and can be identified as positive for the novel coronavirus Omicron strain.
In some embodiments of the invention, the method of authenticating applications of the present invention comprises the steps of:
s1: extracting RNA of a sample to be detected, and reversely transcribing the RNA into cDNA;
s2: preparing a reaction system: add the upstream primer, downstream primer and probe at any concentration ranging from 0.1-10. mu.M to the system, add the sample cDNA at any concentration ranging from 1pg to 1. mu.g, add commercial qPCR premix enzyme, and finally add ddH 2 O adjusting the total volume of the reaction system to any volume within the range of 10-20 mul;
s3: setting reaction conditions: setting reaction conditions according to the used qPCR premixed enzyme;
s4: and (4) analyzing results: according to the Omicron strain BA.1 subline amplification channel and other novel coronavirus amplification channels except the BA.1 subline amplification channel, analysis is carried out and the result is recorded.
The invention designs different probes aiming at sites N211-and L212I of S protein of an Omicron strain BA.1 subline and corresponding regions of other novel coronaviruses outside the Omicron strain BA.1 subline, different fluorophores such as CY5 and FAM fluorophores are respectively selected for modification of the Omicron strain BA.1 subline probe and the probes of other novel coronaviruses outside the BA.1 subline, and the amplification results of the Omicron strain BA.1 subline and other novel coronaviruses outside the BA.1 subline can be observed through different fluorescence channels in one reaction. The amplification curve in the amplification result is a typical S-shaped curve, and the amplification result is a positive result; the amplification curve in the amplification result is not a typical "S-shaped" curve, and is a negative result.
In some specific embodiments of the invention, one section of gene sequence synthetic plasmids in the Omicron strain BA.1 subline and other novel coronavirus S proteins except the BA.1 subline are respectively selected as a standard substance, and the linearity, the detection limit and the specificity (specificity) of the dual-probe qPCR method are verified. As can be seen from the specificity verification experiment of the double-probe qPCR method, the identification method provided by the invention has better linearity, the detection limit is 0.03 pg/mu l, and the identification method can effectively identify the Omicron strain BA.1 subline and other novel coronaviruses.
The technical scheme of the invention has the following beneficial effects:
the invention has the advantages of low cost, simple operation, low requirement on instruments and equipment, short detection period, accurate and reliable result and the like. The identification applications described herein may be for non-diagnostic purposes or for diagnostic purposes. Applications for non-diagnostic purposes may include, for example, rapid identification of virus species in the production of novel inactivated coronavirus vaccines, as well as identification of inactivated novel coronavirus stocks. In addition, the invention can be applied to the identification of the Omicron strain BA.1 subline and other novel coronavirus strains in the novel coronavirus nucleic acid screening process, and the sample to be identified can be an isolated sample from human or animals or an environmental sample from a non-host. The invention can rapidly and accurately distinguish the novel coronavirus Omicron strain BA.1 subline from other novel coronavirus identification. The popularization and the application of the invention can save a great deal of time and cost for detection personnel, scientific research workers and medical workers in the vaccine production process.
Drawings
FIG. 1 is a schematic diagram of the experimental design scheme of the primers and probes of the present invention.
FIG. 2 is a standard curve of the Omicron strain BA.1 subline amplification channel for PCR reactions using primers and probes of the present invention.
FIG. 3 is a standard curve of the amplification pathway of other novel coronaviruses than the BA.1 subline using the primers and probes of the present invention for PCR reaction.
FIG. 4 shows the results of specificity verification experiments for the dual probe qPCR method using the primers and probes of the invention.
FIG. 5 shows the detection of inactivated Omicron strain BA.1 sublines virus stock solution by dual probe qPCR using primers and probes of the invention.
Detailed Description
The technical solutions of the present invention will be described in detail below in order to clearly understand the technical features, objects, and advantages of the present invention, but the present invention is not limited to the practical scope of the present invention. The present invention has been described generally and/or specifically with respect to materials used in the experiments and the methods of testing. The method operations, not specified in detail, are carried out according to the conventional operations of the prior art in the field or as suggested by the manufacturer's specifications.
Example 1
This example provides a method for identifying novel coronaviruses other than SARS-CoV-2 BA.1 subline and the Omicron strain BA.1 subline. The design scheme of the primer, the probe and the fluorescent label is shown in figure 1.
Experimental sample: the sample cDNA to be tested, the Omicron strain BA.1 subline S gene standard plasmid template (SEQ ID NO. 5) and the S gene standard plasmid template (SEQ ID NO. 6) of other novel coronaviruses (prototype strain samples in the embodiment) outside the BA.1 subline.
Obtaining of cDNA of a sample to be tested: respectively taking 200 mul of cell culture of a novel coronavirus prototype strain, an Omicron BA.1 subline strain, a Delta strain and a Beta strain, extracting RNA by using a commercial RNA kit, reversely transcribing the RNA into cDNA by using the commercial reverse transcription kit, storing the extracted RNA and cDNA in a refrigerator at the temperature of 60 ℃ below zero, and avoiding repeated freeze thawing before use.
Acquisition of standard plasmids: omicron strain BA.1 subline S gene standard plasmid (SEQ ID NO. 5) and other novel coronavirus S gene standard plasmids (SEQ ID NO. 6) outside the BA.1 subline are directly biosynthesized by Scirridae. The sequence of the standard plasmid is as follows:
SEQ ID NO.5：
ttaccctgacaaagttttcagatcctcagttttacattcaactcaggacttgttcttacctttcttttccaatgttacttggttccatgttatctctgggaccaatggtactaagaggtttgataaccctgtcctaccatttaatgatggtgtttattttgcttccattgagaagtctaacataataagaggctggatttttggtactactttagattcgaagacccagtccctacttattgttaataacgctactaatgttgttattaaagtctgtgaatttcaattttgtaatgatccatttttggaccacaaaaacaacaaaagttggatggaaagtgagttcagagtttattctagtgcgaataattgcacttttgaatatgtctctcagccttttcttatggaccttgaaggaaaacagggtaatttcaaaaatcttagggaatttgtgtttaagaatattgatggttattttaaaatatattctaagcacacgcctattatagtgcgtgagccagaagatctccctcagggtttttcggctttagaaccattggtagatttgccaataggtattaacatcactaggtttcaaactttacttgctttacatagaagttatttgactcctggtgattcttcttcaggttggacagctggtgctgcagcttattatgtgggttatcttcaacctaggacttttctattaaaatataatgaaaatggaaccattacagatgctgtagactgtgcacttgaccctctctcagaaacaaagtgtacgttgaaatccttcactgtagaaaaaggaatctatcaaacttctaactttagagtccaaccaacagaatctattgttagatttcctaatattacaaacttgtgcccttttgatgaagtttttaacgccaccagatttgcatctgtttatgcttggaacaggaagagaatcagcaactgtgttgctgattattctgtcctatataatctcgcaccatttttcacttttaagtgttatggagtgtctcctactaaattaaatgatctctgctttactaatgtctatgcagattcatttgtaattagaggtgatgaagtcagacaaatcgctccagggcaaactggaaatattgctgattataattataaattaccagatgattttacaggctgcgttatagcttggaattctaacaagcttgattctaaggttagtggtaattataattacctgtatagattgtttaggaagtctaatctcaaaccttttgagagagatatttcaactgaaatctatcaggccggtaacaaaccttgtaatggtgttgcaggttttaattgttactttcctttacgatcatatagtttccgacccacttatggtgttggtcaccaaccatacagagtagtagtactttcttttgaacttctacatgcaccagcaactgtttgtggacctaaaaagtctactaatttggttaaaaacaaatgtgtcaatttcaacttcaatggtttaaaaggcacaggtgttcttactgagtctaacaaaaagtttctgcctttccaacaatttggcagagacattgctgacactactgatgctgtccgtgatccacagacacttgagattcttgacattacaccatgttcttttggtggtgtcagtgttataacaccaggaacaaatacttctaaccaggttgctgttctttatcagggtgttaactgcacagaagtccctgttgctattcatgcagatcaacttactcctacttggcgtgtttattctacaggttctaatgtttttcaaacacgtgcaggctgtttaataggggctgaatatgtcaacaactcatatgagtgtgacatacccattggtgcaggtatatgcgctagttatcagactcagactaagtctcatcggcgggcacgtagtgtagctagtcaatccatcattgcctacactatgtcacttggtgcagaaaattcagttgctt；
SEQ ID NO.6：
TTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATAATGAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGTGTACGTTGAAATCCTTCACTGTAGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATTGTTAGATTTCCTAATATTACAAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTCAATTTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTACTGATGCTGTCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCAGGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGCTGAACATGTCAACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCTCCTCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGTGCAGAAAATT。
qPCR amplification: the reaction system and reaction conditions are shown in Table 1, wherein the amount of the forward primer, the reverse primer and the probe added to the reaction system may be any one concentration in the range of 0.1 to 10. mu.M, the total reaction system may be any one volume in the range of 10 to 20. mu.l, and the amount of the sample cDNA added may be any one concentration in the range of 1pg to 1. mu.g. The qPCR premixed enzyme used this time was Perfect Start II Probe qPCR SuperMix (Cat No.: AQ 711) from all-gold Bio Inc., wherein the annealing temperature was selected from any one of the temperatures in the range of 52-60 ℃.
The sequence of the upstream primer 211/212-F is shown as SEQ ID NO. 1; the sequence of the downstream primer 211/212-R is shown as SEQ ID NO. 2; the sequence of the Omicron strain BA.1 subline probe (211/212-P-Omicron strain BA.1 subline) is shown as SEQ ID NO. 3; the sequences of other novel coronavirus probes (211/212-P-other novel coronaviruses) except the BA.1 subline are shown in SEQ ID NO. 4.
SEQ ID NO.1（211/212-F）：TAAAATATATTCTAAGCACACGCC；
SEQ ID NO.2（211/212-R）：CTACCAATGGTTCTAAAGCC；
SEQ ID NO.3 (211/212-P-Omicron strain BA.1 subline): GCGTGAGCCAGAAGATCTCC, respectively;
SEQ ID NO.4 (211/212-P-other novel coronaviruses): GTGCGTGATCTCCCTCAG is added.
TABLE 1 reaction System and reaction conditions
And (4) analyzing results: taking the Roche480 instrument as an example, after the experiment is finished, the sample type (sample to be detected, standard substance, negative control or positive control) of each detection hole is set, wherein the concentration of the standard substance needs to be set. Opening an analysis interface, selecting a fluorescence channel used by the probe, and adjusting a Noise band value according to an amplification image to ensure the amplification efficiency and R of the generated standard curve 2 Both the value and the slope are within the acceptable range. The invention relates to a dual probe qPCR method, which analyzes and records the results of an Omicron strain BA.1 subline amplification channel and other novel coronavirus amplification channels except the BA.1 subline in one reaction.
And (4) judging a result: the amplification curve in the amplification result is a typical S-shaped curve, and the amplification result is a positive result; the amplification curve in the amplification result is not a typical "S-shaped" curve, and is a negative result. The specific result interpretation method is shown in Table 2.
TABLE 2 determination of results
Adding a sample to be detected into a reaction system for computer detection, and if positive amplification occurs in a CY5 channel and positive amplification does not occur in an FAM channel in a detection result, displaying that the sample is an Omicron strain BA.1 subline but not other novel coronaviruses; if the FAM channel is positively amplified but the CY5 channel is not positively amplified, the sample is not an Omicron strain BA.1 subline. The method can quickly and accurately identify the Omicron strain BA.1 sublines in one reaction.
This example demonstrates the method validation of the dual probe method qPCR of the present invention. The results are shown in FIGS. 2 to 4. FIG. 2 is a standard curve of amplification channel of the Omicron strain BA.1 subline, R 2 At 0.98, the amplification efficiency was 0.918, and the slope was-3.535. FIG. 3 is a standard curve of the amplification pathway of other novel coronaviruses, R 2 It was 0.98, the amplification efficiency was 0.967, and the slope was-3.404. From FIGS. 2 and 3, it can be seen that the detection limit of the present invention is 0.03pg/μ l and has good linearity. FIG. 4 is specificity (specificity) verification of the dual probe qPCR method, and the result shows that the Omicron strain BA.1 subline sample has positive amplification in the Omicron strain BA.subline amplification channel and has negative amplification in other novel coronavirus amplification channels; the prototype strain sample, the Delta strain sample and the Beta strain sample have negative amplification in an Omicron strain BA.1 subline amplification channel and have positive amplification in other novel coronavirus amplification channels, which shows that the invention has good specificity and can accurately identify the Omicron strain BA.1 subline. The primer and the probe are used for detecting the inactivated Omicron strain BA.1 subline virus stock solution by a dual probe qPCR method, and the result is shown in figure 5, so that the method is suitable for identifying the inactivated Omicron strain BA.1 subline vaccine stock solution.
Sequence listing
<110> limited liability company of Beijing Biotechnology institute
<120> primers and probes for identifying novel coronavirus Omicron strain BA.1 subline and application thereof
<130> GAI22CN0633
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 1
taaaatatat tctaagcaca cgcc 24
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> primer
<400> 2
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> Probe
<400> 3
<210> 4
<211> 18
<212> DNA
<213> Artificial sequence
<220>
<223> Probe
<400> 4
<210> 5
<211> 2000
<212> DNA
<213> Artificial sequence
<220>
<223> Omicron strain BA.1 subline S gene standard plasmid
<400> 5
ttaccctgac aaagttttca gatcctcagt tttacattca actcaggact tgttcttacc 60
tttcttttcc aatgttactt ggttccatgt tatctctggg accaatggta ctaagaggtt 120
tgataaccct gtcctaccat ttaatgatgg tgtttatttt gcttccattg agaagtctaa 180
cataataaga ggctggattt ttggtactac tttagattcg aagacccagt ccctacttat 240
tgttaataac gctactaatg ttgttattaa agtctgtgaa tttcaatttt gtaatgatcc 300
atttttggac cacaaaaaca acaaaagttg gatggaaagt gagttcagag tttattctag 360
tgcgaataat tgcacttttg aatatgtctc tcagcctttt cttatggacc ttgaaggaaa 420
acagggtaat ttcaaaaatc ttagggaatt tgtgtttaag aatattgatg gttattttaa 480
aatatattct aagcacacgc ctattatagt gcgtgagcca gaagatctcc ctcagggttt 540
ttcggcttta gaaccattgg tagatttgcc aataggtatt aacatcacta ggtttcaaac 600
tttacttgct ttacatagaa gttatttgac tcctggtgat tcttcttcag gttggacagc 660
tggtgctgca gcttattatg tgggttatct tcaacctagg acttttctat taaaatataa 720
tgaaaatgga accattacag atgctgtaga ctgtgcactt gaccctctct cagaaacaaa 780
gtgtacgttg aaatccttca ctgtagaaaa aggaatctat caaacttcta actttagagt 840
ccaaccaaca gaatctattg ttagatttcc taatattaca aacttgtgcc cttttgatga 900
agtttttaac gccaccagat ttgcatctgt ttatgcttgg aacaggaaga gaatcagcaa 960
ctgtgttgct gattattctg tcctatataa tctcgcacca tttttcactt ttaagtgtta 1020
tggagtgtct cctactaaat taaatgatct ctgctttact aatgtctatg cagattcatt 1080
tgtaattaga ggtgatgaag tcagacaaat cgctccaggg caaactggaa atattgctga 1140
ttataattat aaattaccag atgattttac aggctgcgtt atagcttgga attctaacaa 1200
gcttgattct aaggttagtg gtaattataa ttacctgtat agattgttta ggaagtctaa 1260
tctcaaacct tttgagagag atatttcaac tgaaatctat caggccggta acaaaccttg 1320
taatggtgtt gcaggtttta attgttactt tcctttacga tcatatagtt tccgacccac 1380
ttatggtgtt ggtcaccaac catacagagt agtagtactt tcttttgaac ttctacatgc 1440
accagcaact gtttgtggac ctaaaaagtc tactaatttg gttaaaaaca aatgtgtcaa 1500
tttcaacttc aatggtttaa aaggcacagg tgttcttact gagtctaaca aaaagtttct 1560
gcctttccaa caatttggca gagacattgc tgacactact gatgctgtcc gtgatccaca 1620
gacacttgag attcttgaca ttacaccatg ttcttttggt ggtgtcagtg ttataacacc 1680
aggaacaaat acttctaacc aggttgctgt tctttatcag ggtgttaact gcacagaagt 1740
ccctgttgct attcatgcag atcaacttac tcctacttgg cgtgtttatt ctacaggttc 1800
taatgttttt caaacacgtg caggctgttt aataggggct gaatatgtca acaactcata 1860
tgagtgtgac atacccattg gtgcaggtat atgcgctagt tatcagactc agactaagtc 1920
tcatcggcgg gcacgtagtg tagctagtca atccatcatt gcctacacta tgtcacttgg 1980
tgcagaaaat tcagttgctt 2000
<210> 6
<211> 2000
<212> DNA
<213> Artificial sequence
<220>
<223> standard plasmid of S gene of other novel coronavirus except BA.1 subline
<400> 6
ttaccctgac aaagttttca gatcctcagt tttacattca actcaggact tgttcttacc 60
tttcttttcc aatgttactt ggttccatgc tatacatgtc tctgggacca atggtactaa 120
gaggtttgat aaccctgtcc taccatttaa tgatggtgtt tattttgctt ccactgagaa 180
gtctaacata ataagaggct ggatttttgg tactacttta gattcgaaga cccagtccct 240
acttattgtt aataacgcta ctaatgttgt tattaaagtc tgtgaatttc aattttgtaa 300
tgatccattt ttgggtgttt attaccacaa aaacaacaaa agttggatgg aaagtgagtt 360
cagagtttat tctagtgcga ataattgcac ttttgaatat gtctctcagc cttttcttat 420
ggaccttgaa ggaaaacagg gtaatttcaa aaatcttagg gaatttgtgt ttaagaatat 480
tgatggttat tttaaaatat attctaagca cacgcctatt aatttagtgc gtgatctccc 540
tcagggtttt tcggctttag aaccattggt agatttgcca ataggtatta acatcactag 600
gtttcaaact ttacttgctt tacatagaag ttatttgact cctggtgatt cttcttcagg 660
ttggacagct ggtgctgcag cttattatgt gggttatctt caacctagga cttttctatt 720
aaaatataat gaaaatggaa ccattacaga tgctgtagac tgtgcacttg accctctctc 780
agaaacaaag tgtacgttga aatccttcac tgtagaaaaa ggaatctatc aaacttctaa 840
ctttagagtc caaccaacag aatctattgt tagatttcct aatattacaa acttgtgccc 900
ttttggtgaa gtttttaacg ccaccagatt tgcatctgtt tatgcttgga acaggaagag 960
aatcagcaac tgtgttgctg attattctgt cctatataat tccgcatcat tttccacttt 1020
taagtgttat ggagtgtctc ctactaaatt aaatgatctc tgctttacta atgtctatgc 1080
agattcattt gtaattagag gtgatgaagt cagacaaatc gctccagggc aaactggaaa 1140
gattgctgat tataattata aattaccaga tgattttaca ggctgcgtta tagcttggaa 1200
ttctaacaat cttgattcta aggttggtgg taattataat tacctgtata gattgtttag 1260
gaagtctaat ctcaaacctt ttgagagaga tatttcaact gaaatctatc aggccggtag 1320
cacaccttgt aatggtgttg aaggttttaa ttgttacttt cctttacaat catatggttt 1380
ccaacccact aatggtgttg gttaccaacc atacagagta gtagtacttt cttttgaact 1440
tctacatgca ccagcaactg tttgtggacc taaaaagtct actaatttgg ttaaaaacaa 1500
atgtgtcaat ttcaacttca atggtttaac aggcacaggt gttcttactg agtctaacaa 1560
aaagtttctg cctttccaac aatttggcag agacattgct gacactactg atgctgtccg 1620
tgatccacag acacttgaga ttcttgacat tacaccatgt tcttttggtg gtgtcagtgt 1680
tataacacca ggaacaaata cttctaacca ggttgctgtt ctttatcagg atgttaactg 1740
cacagaagtc cctgttgcta ttcatgcaga tcaacttact cctacttggc gtgtttattc 1800
tacaggttct aatgtttttc aaacacgtgc aggctgttta ataggggctg aacatgtcaa 1860
caactcatat gagtgtgaca tacccattgg tgcaggtata tgcgctagtt atcagactca 1920
gactaattct cctcggcggg cacgtagtgt agctagtcaa tccatcattg cctacactat 1980
gtcacttggt gcagaaaatt 2000
Claims (7)
1. A composition of primers and probes for identifying a novel coronavirus Omicron strain BA.1 subline by a dual probe qPCR method is characterized in that the primers comprise a primer with a sequence shown as SEQ ID NO.1 and a primer with a sequence shown as SEQ ID NO. 2:
SEQ ID NO.1：5’-TAAAATATATTCTAAGCACACGCC-3’；
SEQ ID NO.2：5’-CTACCAATGGTTCTAAAGCC-3’；
the probe comprises a probe with a sequence shown as SEQ ID NO.3 and a probe with a sequence shown as SEQ ID NO. 4:
SEQ ID NO.3：5’-GCGTGAGCCAGAAGATCTCC-3’；
SEQ ID NO.4：5’-GTGCGTGATCTCCCTCAG-3’。
2. the composition of primers and probes for dual probe qPCR method for the identification of novel coronavirus Omicron strain ba.1 sublines according to claim 1 wherein said probes are fluorophore modified comprising:
modifying the base at the 5 'end of the probe sequence by adopting a fluorescent reporter group, and modifying the base at the 3' end of the probe sequence by adopting a fluorescent quenching group; wherein, the base at the 5 'end of the probe with the sequence shown in SEQ ID NO.3 is modified by a fluorescent reporter group CY5, and the base at the 5' end of the probe with the sequence shown in SEQ ID NO.4 is modified by a fluorescent reporter group FAM.
3. A kit for identifying a novel coronavirus Omicron strain ba.1 subline by a dual probe qPCR method, comprising: a combination of the primer and probe of claim 1 or 2.
4. The kit of claim 3, further comprising a positive quality control and a negative quality control; the positive quality control product comprises a standard plasmid template of a BA.1 subline S gene of a novel coronavirus Omicron strain, and the negative quality control product comprises standard plasmid templates of other novel coronavirus S genes except the BA.1 subline.
5. Use of a combination of primers and probes according to claim 1 or 2 or of a kit according to claim 3 or 4 for non-diagnostic purposes in the in vitro dual probe qPCR method for the identification of the presence of the novel coronavirus Omicron strain ba.1 subline in a sample.
6. The use according to claim 5, wherein the presence or absence of the novel coronavirus Omicron strain BA.1 subline in the sample is identified by PCR reaction, the final concentration of the primer in the PCR reaction system is 0.1-10 μ M, and the final concentration of the probe in the PCR reaction system is 0.1-10 μ M.
7. The use according to claim 6, wherein the amplification curve of the probe having the sequence shown in SEQ ID No.3 is an S-type curve, and is identified as positive for the BA.1 subline of the novel coronavirus Omicron strain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210463416.1A CN114561497B (en) | 2022-04-29 | 2022-04-29 | Primer and probe for identifying novel coronavirus Omicron strain BA.1 subline and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210463416.1A CN114561497B (en) | 2022-04-29 | 2022-04-29 | Primer and probe for identifying novel coronavirus Omicron strain BA.1 subline and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114561497A CN114561497A (en) | 2022-05-31 |
| CN114561497B true CN114561497B (en) | 2022-08-19 |
Family
ID=81721075
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210463416.1A Active CN114561497B (en) | 2022-04-29 | 2022-04-29 | Primer and probe for identifying novel coronavirus Omicron strain BA.1 subline and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114561497B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113846189A (en) * | 2021-11-03 | 2021-12-28 | 安徽医科大学第二附属医院 | GISAID typing-based novel coronavirus genotype reference sequence, design primer, kit and application |
| CN114369688A (en) * | 2022-03-22 | 2022-04-19 | 深圳联合医学科技有限公司 | Compositions, kits, methods and uses for detecting a variant of SARS-CoV-2 Oncuronte |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20210311054A1 (en) * | 2020-04-01 | 2021-10-07 | Institut Pasteur | Severe acute respiratory syndrome (sars) - associated coronavirus diagnostics |
| CN114085928B (en) * | 2022-01-19 | 2022-04-26 | 广东和信健康科技有限公司 | Rapid detection system for typing of novel coronavirus Omicron mutant strain |
| CN114592097B (en) * | 2022-05-07 | 2022-07-29 | 北京生物制品研究所有限责任公司 | Primer and probe for identifying novel coronavirus Omicron strain BA.1 and/or BA.3 sublines and application thereof |
-
2022
- 2022-04-29 CN CN202210463416.1A patent/CN114561497B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113846189A (en) * | 2021-11-03 | 2021-12-28 | 安徽医科大学第二附属医院 | GISAID typing-based novel coronavirus genotype reference sequence, design primer, kit and application |
| CN114369688A (en) * | 2022-03-22 | 2022-04-19 | 深圳联合医学科技有限公司 | Compositions, kits, methods and uses for detecting a variant of SARS-CoV-2 Oncuronte |
Non-Patent Citations (4)
| Title |
|---|
| "Development and evaluation of an RT-qPCR for the identification of the SARS-CoV-2 Omicron variant";Mamdouh Sibai等;《J Clin Virol》;20220205;第148卷;第1页第1段，表1 * |
| "Genetic analysis of a SARS-CoV-2 Omicron variant from a Chinese traveller returning from overseas";Hongling Jia等;《Emerging Microbes & Infections》;20220204;第11卷;第306-309页 * |
| "Monitoring of the SARS-CoV-2 Omicron BA.1/BA.2 variant transition in the Swedish population reveals higher viral quantity in BA.2 cases";Antonio Lentini等;《MedRxiv》;20220327;第1-5页 * |
| "新型冠状病毒(SARS-CoV-2)的检测技术";王雪宁等;《生命的化学》;20200815;第40卷(第8期);第1258-1269页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114561497A (en) | 2022-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110982943B (en) | Novel coronavirus RT-PCR detection method and kit | |
| CN109576352B (en) | Method, probe and kit for detecting multiple target nucleic acid sequences to be detected through single tube | |
| CN111187856A (en) | Cpf1 kit for rapid detection of new coronavirus nucleic acid and preparation method and application thereof | |
| CN114592097B (en) | Primer and probe for identifying novel coronavirus Omicron strain BA.1 and/or BA.3 sublines and application thereof | |
| CN107988326A (en) | Prawn Acute Hepatic pancreatic necrosis（AHPND）RAA constant temperature fluorescence detection method and reagent | |
| WO2022257663A1 (en) | Method and kit for detecting and screening n501y mutation in covid-19 | |
| CN114574557B (en) | General type preclinical biodistribution detection kit for NK cell therapy products | |
| CN113308519B (en) | Primer and probe for detecting single base mutation site and detection method | |
| CN113980957A (en) | Single-stranded DNA probe based on CRISPR/Cas12a and method for detecting target nucleic acid | |
| CN113718045A (en) | DNA fragment, primer, probe and kit for detecting 4 kinds of Bordetella pertussis and specifically detecting Bordetella pertussis and application | |
| CN114107567A (en) | Virus nucleic acid mutation detection method and application | |
| CN112725539B (en) | RPA/Cas12a/IF kit for respiratory syncytial virus and detection method thereof | |
| CN113481325B (en) | Method and kit for detecting novel coronavirus B.1.1.7 mutant strain | |
| CN113528686A (en) | Reagent and kit for detecting nucleic acid of brucella | |
| CN114561497B (en) | Primer and probe for identifying novel coronavirus Omicron strain BA.1 subline and application thereof | |
| CN111363842A (en) | Sequence, kit, method and application for rapidly detecting aspergillus fumigatus | |
| CN116219040A (en) | Molecular marker, primer probe group and detection method for detecting lactobacillus plantarum S58 | |
| CN115896316A (en) | Tuberculosis detection method | |
| CN114134218B (en) | Fluorescent detection method based on CRISPR-Cas12a | |
| CN114561496B (en) | Primer and probe for identifying novel coronavirus Delta strain and application of primer and probe | |
| CN106521038B (en) | A kind of real-time fluorescence quantitative PCR detection methods of highly sensitive BHV 2 and kit | |
| CN116479093A (en) | Rhinoceros nucleic acid rapid detection method and detection kit based on CRISPR fluorescence method | |
| KR102366553B1 (en) | Method for detecting SARS-CoV-2 using CRISPR-Cas system and RT-LAMP primer set | |
| CN113388689A (en) | Primer combination, probe, kit and use method thereof | |
| CN112899385A (en) | Primer group and probe for identifying Brucella S2 vaccine strain and wild strain and application of primer group and probe |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |