CN113817872A

CN113817872A - 2019 novel coronavirus lambda variant nucleic acid detection reagent, kit and detection method

Info

Publication number: CN113817872A
Application number: CN202111101773.5A
Authority: CN
Inventors: 蒋小琴; 杨仲钦
Original assignee: Beijing Eric Yang Medical Technology Co ltd
Current assignee: Beijing Eric Yang Medical Technology Co ltd
Priority date: 2021-09-18
Filing date: 2021-09-18
Publication date: 2021-12-21

Abstract

The invention provides a 2019 novel coronavirus (SARS-CoV-2) Lambda (Lambda) variant nucleic acid detection reagent, a kit and a detection method, belonging to the technical field of in-vitro diagnostic reagents. The detection reagent comprises specific primers and probes respectively designed aiming at the mutation sites of the spinous process protein coding genes G75V, T76I, delta 246-252, D253N, L452Q and F490S of the Lambda variant, and also comprises a one-step RT-PCR reaction solution, a positive control and a negative control. Based on the detection reagent, the invention fully utilizes the advantages of high detection speed, high sensitivity and low cost of a fluorescent quantitative PCR platform, develops a novel nucleic acid detection method for 2019 novel coronavirus Lambda variant strains, which is simple, quick, accurate and low in cost, overcomes the defects of long time consumption, high cost and complex operation process in the aspect of typing detection of Lambda variant strains in the prior art (NGS), meets the detection requirements of a large number of samples in clinic, and provides powerful technical support for epidemic situation prevention and control.

Description

2019 novel coronavirus lambda variant nucleic acid detection reagent, kit and detection method

Technical Field

The invention belongs to the technical field of in-vitro diagnostic reagents, and particularly relates to a 2019 novel coronavirus (SARS-CoV-2) Lambda (Lambda) variant nucleic acid detection reagent, a kit and a detection method.

Background

The Lambda (Lambda) variant is one of important variants of the 2019 novel coronavirus (SARS-CoV-2), is spread to multiple countries at present, has remarkably enhanced transmission capability and further increased severity, and is upgraded to be a variant virus needing attention.

As a result of analysis of the nucleic acid sequence diversity of SARS-CoV-2, the most important change of Lambda variant compared with wild-type SARS-CoV-2 was the occurrence of multiple base mutations in the nucleotide sequence of the gene encoding the spinous process protein (Spike protein), and typical mutation sites thereof were: G75V, T76I, Delta 246-252, D253N, L452Q, F490S and the like. Lambda variants can be specifically identified by analyzing the sequence diversity of SARS-CoV-2 in the GISAID EpiCoV database, and finding that the mutation sites G75V, T76I, Δ 246-252, D253N, L452Q and F490S occur simultaneously. Therefore, an accurate and rapid gene mutation typing detection reagent and a detection method thereof are developed for identifying G75V, T76I, delta 246-252, D253N, L452Q and F490S mutations in the SARS-CoV-2 spinous process protein coding gene, so that rapid screening of Lambda variant strains can be realized, and the urgent need of epidemic prevention and control is met.

The existing nucleic acid detection aiming at SARS-CoV-2 is mainly based on a fluorescence quantitative PCR detection platform, the detection is convenient and rapid, the cost is low, and the detection result is accurate and reliable; however, since the Lambda variant is caused by gene mutation of wild SARS-CoV-2, and the mutation type has point mutation of single base sequence, it is difficult to develop such a detection reagent on the fluorescent quantitative PCR detection platform, and no such detection product is available on the market. The typing detection of the Lambda variant strain by the existing gene detection method is mainly second generation sequencing (NGS), the detection period is long, the cost is high, the operation is complicated, and the rapid screening requirement of a large number of clinical samples cannot be met.

Disclosure of Invention

The invention aims to provide a 2019 novel coronavirus Lambda variant nucleic acid detection reagent, a kit and a detection method aiming at the defects of the prior art, and the reagent, the kit and the detection method are beneficial to making up the defects of the prior art, realize the rapid detection of a Lambda variant with rapidness, accuracy and low cost, and provide powerful technical support for epidemic situation prevention and control.

In order to achieve the above purpose, the invention provides a 2019 novel coronavirus Lambda variant nucleic acid detection reagent, which comprises specific primers and probes respectively designed for mutation sites of spinous process protein coding genes G75V, T76I, delta 246-252, D253N, L452Q and F490S of a Lambda variant:

in the present invention, the reporter fluorescent dye group labeled at both ends of the probe may be selected from conventional group species. Preferably, the 5 'end of the probe P1 is labeled with a reporter fluorescent dye FAM, and the 3' end is labeled with a reporter fluorescent dye BHQ; the 5 'end of the probe P2 is marked with a reporter fluorescent dye VIC, and the 3' end is marked with a reporter fluorescent dye BHQ; the 5 'end of the probe P3 is labeled with a reporter fluorescent dye CY5, and the 3' end is labeled with a reporter fluorescent dye BHQ.

Preferably, the detection reagent further comprises a one-step RT-PCR reaction solution, a positive control substance and a negative control substance;

wherein the one-step RT-PCR reaction solution comprises 10x buffer solution and Mg²⁺DTT, dNTPs, DNA polymerase, RNase inhibitor, UNG enzyme, RT enzyme;

the positive control is an RNA pseudovirus standard carrying mutation sites of G75V, T76I, delta 246-252, D253N, L452Q and F490S of the spike protein coding genes of the Lambda variant, and the negative control is DEPC water.

Preferably, the one-step RT-PCR reaction solution comprises 2x 10x buffer solution and 200 mu M Mg²⁺0.5nM DTT, 10. mu.M dNTPs, 2U DNA polymerase, 0.5U RNase inhibitor, 0.1U UNG enzyme, 0.2U RT enzyme.

The invention also provides a kit which comprises the 2019 novel coronavirus lambda variant nucleic acid detection reagent in any technical scheme.

The invention also provides a 2019 novel coronavirus lambda variant nucleic acid detection method, which adopts the detection reagent of any technical scheme for detection and comprises the following steps:

taking the extracted nucleic acid sample to be detected as a template, and simultaneously performing multiplex fluorescence quantitative PCR detection by using a positive control, a negative control and specific primers and probes respectively designed for spinous process protein coding genes G75V, T76I, delta 246-252, D253N, L452Q and F490S of the Lambda variant;

after the detection is finished, respectively adjusting the Start value and the End value of the baseline of FAM, VIC and CY5 channels and the value of a threshold line according to actual conditions, and obtaining Ct values of FAM, VIC and CY5 channels based on analysis results;

and carrying out effectiveness interpretation and result interpretation according to the Ct value of each channel.

Preferably, the total volume of the reaction system for performing multiplex fluorescent quantitative PCR detection is 25 μ l, and the method specifically comprises the following steps:

one-step PCR reaction solution 12.5. mu.l, 1. mu.M primer and probe mixture 5. mu.l, template/positive control/negative control 5. mu.l and DEPC water 2.5. mu.l.

Preferably, the reaction conditions for performing multiplex fluorescent quantitative PCR detection are:

reverse transcription is carried out for 25min at 50 ℃; pre-denaturation at 95 ℃ for 2 min; denaturation at 95 ℃ for 10s, annealing and extension at 60 ℃ for 40s and fluorescence collection for 40 cycles.

Preferably, the Start value is set to 5 to 10, the End value is set to 10 to 15, and the amplification curve of the negative control is adjusted to be flat or lower than the threshold line.

Preferably, when the validity judgment is performed, the criteria judged to be valid are:

detection site	Fluorescent channel	Negative control	Positive control
				G75V and T76I	FAM channel	Ct value free	Ct≤35
Δ 246-	VIC channel	Ct value free	Ct≤35
				L452Q and F490S	CY5 channel	Ct value free	Ct≤35

。

Preferably, when the result is judged, the criteria for judging as positive or negative are:

positive interpretation: FAM channel CT ≤ 39 is positive for G75V and T76I mutations; the VIC channel CT less than or equal to 39 is positive for delta 246-252 and D253N mutations; the CY5 channel CT is less than or equal to 39, and is positive to the L452Q and F490S mutations; if the channels FAM, VIC and CY5 simultaneously satisfy CT less than or equal to 39, determining the strain as a Lambda variant;

negative interpretation: results other than the positive interpretation were all judged to be negative.

Preferably, the method further comprises a step of extracting a sample of nucleic acid to be detected using a nucleic acid extraction reagent before performing the multiplex quantitative PCR assay.

Preferably, the detection method has a sensitivity of 2 copies/. mu.l for the spinous process protein coding genes G75V, T76I,. DELTA.246-252, D253N, L452Q and F490S of the Lambda variant.

Compared with the prior art, the invention has the advantages and positive effects that:

the invention fully utilizes the advantages of high detection speed, high sensitivity and low cost of a fluorescent quantitative PCR platform, develops a novel nucleic acid detection method for 2019 novel coronavirus Lambda variant strains, which is simple, quick, accurate and low in cost, overcomes the defects of long time consumption, high cost and complex operation process in the aspect of Lambda variant strain typing detection in the prior art (NGS), meets the detection requirement of clinical samples, and provides powerful technical support for epidemic prevention and control.

In the specific implementation, the invention firstly and uniquely designs specific amplification primers and probes based on mutation sites of spinous process protein coding genes G75V, T76I, delta 246-252, D253N, L452Q and F490S of the Lambda variant strain, the primers and the probes have good specificity and high sensitivity, and the 2019 novel coronavirus Lambda variant strain can be efficiently and accurately identified; the formula combines the one-step RT-PCR reaction solution and the reaction system formula, and can effectively improve the detection sensitivity of the target sequence because the formula can directly use RNA as a template and has high PCR amplification efficiency.

Drawings

FIG. 1 shows the specific detection results of RNA pseudovirus mock samples carrying mutation sites of G75V, T76I, delta 246-252, D253N, L452Q and F490S of the spinous process protein coding genes of Lambda variant by the multiplex fluorescent RT-PCR method established in accordance with the present invention;

FIG. 2 is RNA quantitative analysis of G75V and T76I in RNA pseudovirus mock samples carrying six mutation sites by the multiplex fluorescent RT-PCR method established according to the present invention; wherein, the amplification curve of A, B, C, D sequentially represents the results of amplification detection of 2000, 20, 2 and 0 copies/. mu.l RNA pseudovirus simulated samples by adopting the amplification system;

FIG. 3 is the RNA quantitative analysis of Δ 246-252 and D253N in the RNA pseudovirus mimic sample carrying six mutation sites by the multiplex fluorescent RT-PCR method established according to the present invention; wherein, the amplification curve of A, B, C, D sequentially represents the results of amplification detection of 2000, 20, 2 and 0 copies/. mu.l RNA pseudovirus simulated samples by adopting the amplification system;

FIG. 4 is RNA quantitative analysis of L452Q and F490S in RNA pseudovirus mock samples carrying six mutation sites by multiplex fluorescent RT-PCR method established according to the present invention; wherein, the amplification curve of A, B, C, D sequentially shows the results of amplification detection of RNA pseudovirus simulant samples of 2000, 20, 2 and 0 copies/. mu.l by using the amplification system.

Detailed Description

Based on a fluorescent quantitative PCR detection platform, the invention designs specific primers and probes aiming at G75V, T76I, delta 246-252, D253N, L452Q and F490S mutation sites of the spinous process protein coding gene of a Lambda variant of SARS-CoV-2 on the basis of an ARMS primer design method, and is used for identifying the mutation sites, thereby judging whether the Lambda variant is available.

In a specific embodiment, the reagent for detecting 2019 novel coronavirus Lambda variant by real-time fluorescent PCR provided by the invention comprises specific primers and probes designed for mutation sites of spinous process protein coding genes G75V, T76I, delta 246-252, D253N, L452Q and F490S of the Lambda variant, a one-step RT-PCR reaction solution, a positive control and a negative control. Wherein: (1) the one-step RT-PCR reaction solution comprises 2x 10x buffer solution and 200 mu M Mg²⁺0.5nM DTT, 10. mu.M dNTPs, 2U DNA polymerase, 0.5U RNase inhibitor, 0.1U UNG enzyme, 0.2U RT enzyme; (2) positive control: RNA pseudovirus standards carrying mutations in the spinous process protein-encoding genes G75V, T76I, Δ 246-252, D253N, L452Q and F490S of the Lambda variant; (3) negative control: DEPC water.

In a preferred embodiment, the primer and probe sequences are shown in Table 1, and the one-step RT-PCR reaction solution is shown in Table 2.

TABLE 1 primer and Probe List

TABLE 2 one-step RT-PCR reaction solution formula

Name of reagent	Concentration of
		10x buffer	2x buffer
Mg²⁺	200μM
		DTT	0.5nM
dNTPs	10μM
		DNA polymerase	2U
RNase inhibitors	0.5U
		UNG enzyme	0.1U
RT enzymes	0.2U

In another preferred embodiment, the nucleic acid detection method of the 2019 novel coronavirus lambda variant provided by the invention comprises the following steps:

(1) viral nucleic acid samples were extracted using commercial nucleic acid extraction reagents and then used directly for PCR detection.

(2) The extracted nucleic acid sample is used as a template, a positive control and a negative control are used at the same time, primers and probes specific to the mutation sites G75V, T76I, delta 246-252, D253N, L452Q and F490S of the spinous process protein coding gene of the Lambda variant are used for carrying out multiplex fluorescence quantitative PCR detection, the reaction system and the program are shown in tables 3-4, and the detection instrument uses ABI 7500.

TABLE 3 reaction System

Name (R)	Volume of
		One-step PCR reaction solution	12.5μl
Primer and probe mixture (1. mu.M)^*1	5μl
		Template/positive control/negative control	5μl
DEPC water	2.5μl

*1: the primers and probes were diluted to the original concentrations to make one tube of mixture, where the final concentrations of each primer and probe were 1 μ M. For example, a primer or probe at an initial concentration of 100. mu.M is prepared in a primer-probe mixture having a volume of 1mL, wherein 10. mu.L of each of the primer and probe is added.

TABLE 4 reaction procedure

(3) Data processing: after the reaction is finished, the Start Value and the End Value of Baseline of FAM, VIC and CY5 channels and the Value of Threshold are respectively adjusted according to actual conditions (the Start Value is suggested to be set at 5-10, the End Value is suggested to be set at 10-15, meanwhile, the amplification curve of negative control is adjusted to be straight or lower than a Threshold line), and Analysis results are obtained by clicking Analysis to obtain Ct values of FAM, VIC and CY5 channels.

(4) And (3) judging the effectiveness: the detection results of the negative and positive control substances need to meet the requirements of the table 4, otherwise, the test result is invalid.

TABLE 5 negative and positive controls

(5) And (4) interpretation of results:

positive interpretation: FAM channel CT is less than or equal to 39, G75V and T76I are positive in mutation; VIC channel CT is less than or equal to 39, and the mutations of delta 246-252 and D253N are positive; CY5 channel CT ≤ 39, and mutations of L452Q and F490S are positive; if FAM, VIC and CY5 channels simultaneously satisfy CT ≤ 39, they are determined to be Lambda variants.

Firstly, amplification primers and probes specific to mutation sites of the spinous process protein coding genes G75V, T76I, delta 246-252, D253N, L452Q and F490S of the Lambda variant are adopted, the sequences of the primers and the probes are initiated and uniquely designed, the specificity is good, the sensitivity is high, and the efficient and accurate identification of the 2019 novel coronavirus Lambda variant can be realized. Secondly, the invention adopts a one-step RT-PCR reaction solution and a reaction system formula, the formula can directly use RNA as a template, the PCR amplification efficiency is high, and the detection sensitivity of the target sequence is effectively improved.

The technical solutions in the embodiments of the present invention will be clearly and completely described below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention. The reagents and biomaterials used below are all commercially available products unless otherwise specified.

Example 1: design of primers and probes

Specific primers and probes are respectively designed according to mutation sites of the spinous process protein coding gene of the 2019 novel coronavirus Lambda variant, and are respectively designed aiming at G75V, T76I, delta 246-252, D253N, L452Q and F490-490S mutation sites and can distinguish the unmutated 2019 novel coronavirus from other virus strains. Wherein, the specific primers and the probes are as follows:

primer F1(SEQ ID NO. 1): TGTCTCTGGGACCAATGTTATTAA

Primer R1(SEQ ID NO. 2): TGTTTTTGTGGTAATAAACACCCAA

Probe P1(FAM-SEQ ID NO. 3-BHQ):

FAM-CTAACATAATAAGAGGCTGGATT-BHQ

primer F2(SEQ ID NO. 4): TACTTGCTTTACATAATTCTTCT

Primer R2(SEQ ID NO. 5): AACAATAGATTCTGTTGGTTGGACT

Probe P2(VIC-SEQ ID NO. 6-BHQ):

VIC-AACTGGAACCATTACAGATGCTGTA-BHQ

primer F3(SEQ ID NO. 7): TGGTGGTAACTATAATTACCAGT

Primer R3(SEQ ID NO. 8): GACCATATGATTGTAAAGGAGAGT

Probe P3(CY5-SEQ ID NO. 9-BHQ):

CY5-CAACTGAAATCTATCAGGCCGT-BHQ

example 2: 2019 detection of novel coronavirus lambda variant nucleic acid

(1) Materials, reagents, instruments: the extraction reagent uses a magnetic bead method virus nucleic acid extraction reagent of Fengpo biological corporation, primers and probes (designed according to example 1) are synthesized by Shanghai Czeri bioengineering Inc., RNA pseudovirus is customized and synthesized by Weitusheng bioengineering (Shanghai) corporation, and the fluorescent quantitative PCR instrument adopts American Saimei ABI 7500.

(2) Preparation of a specimen: a positive specimen is an inactivated virus throat swab sample after a human is infected with the 2019 novel coronavirus Lambda variant strain; the negative control specimen is a pharyngeal swab sample of a healthy person. All the above samples are from a certain clinical unit.

(3) Nucleic acid extraction: and (3) respectively extracting nucleic acids of a negative/positive sample, a positive control substance and a negative control substance by using a commercial magnetic bead method virus nucleic acid extraction kit, and then using the nucleic acids for PCR detection.

(4) And (3) PCR amplification:

a. primers and probes: the design and synthesis were performed as in example 1.

b. Positive control:

the positive control in the method is RNA pseudovirus carrying mutations of G75V, T76I, delta 246-252, D253N, L452Q and F490S of the spinous process protein coding gene of the Lambda variant, and 10 percent of the RNA pseudovirus is carried out by DEPC water⁶And (4) diluting by times, and taking the diluted RNA pseudovirus as a positive control in the method.

c. One-step RT-PCR reaction platform:

the PCR reaction system (total volume 25. mu.l) included: one-step PCR reaction solution 12.5. mu.l, 1. mu.M primer and probe mixture 5. mu.l, template/positive control/negative control 5. mu.l and DEPC water 2.5. mu.l.

PCR amplification reaction conditions: reverse transcription is carried out for 25min at 50 ℃; pre-denaturation at 95 ℃ for 2 min; denaturation at 95 ℃ for 10s, annealing and extension at 60 ℃ for 40s (fluorescence collection), 40 cycles.

d. One-step RT-PCR reaction: and (3) performing multiplex fluorescent quantitative PCR detection by using the extracted nucleic acid sample as a template, and using specific primers and probes of the spinous process protein coding gene mutation sites G75V, T76I, delta 246-252, D253N, L452Q and F490S of the Lambda variant by using a positive control and a negative control.

e. Data processing: after the reaction is finished, the Start Value and the End Value of Baseline of FAM, VIC and CY5 channels and the Value of Threshold are respectively adjusted according to actual conditions (the Start Value is suggested to be set at 5-10, the End Value is suggested to be set at 10-15, meanwhile, the amplification curve of negative control is adjusted to be straight or lower than a Threshold line), and Analysis results are obtained by clicking Analysis to obtain Ct values of FAM, VIC and CY5 channels.

f. And (3) judging the effectiveness: the detection results of the negative and positive control substances need to meet the requirements of the table 4, otherwise, the test result is invalid.

g. And (4) interpretation of results:

positive interpretation: FAM channel CT is less than or equal to 39, G75V and T76I are positive in mutation; VIC channel CT is less than or equal to 39, and the mutations of delta 246-252 and D253N are positive; CY5 channel CT ≤ 39, and mutations of L452Q and F490S are positive; if the channels FAM, VIC and CY5 simultaneously satisfy CT less than or equal to 39, determining the strain as a Lambda variant;

(5) Results of specificity and sensitivity detection assays:

a. and (3) specific detection results:

RNA pseudovirus mock samples carrying G75V, T76I, delta 246-252, D253N, L452Q and F490S mutations, RNA pseudovirus mock samples of influenza A virus, RNA pseudovirus mock samples of influenza B virus, mycoplasma, human genome (293T cell line origin) and negative samples (DEPC water) were tested by the above test method, and the results of the specific tests are shown in FIG. 1.

As shown in FIG. 1, the multiplex fluorescence RT-PCR method established according to the invention has better specificity to the mutation sites of G75V, T76I, delta 246-252, D253N, L452Q and F490S of the spinous process protein coding genes of the Lambda variant, shows positive detection results of RNA pseudovirus simulation samples carrying the six mutation sites, and has no cross reaction to other pathogens, human genomes, blank controls (samples obtained by extracting nucleic acid by taking DEPC water as a sample) and the like.

b. Sensitivity test results:

RNA pseudovirus simulation samples carrying the mutation sites are subjected to nucleic acid extraction by using a virus nucleic acid rapid extraction reagent, then a Qubit 4.0 instrument is used for measuring RNA concentration, the copy number of the samples is calculated according to a conversion formula in a customized RNA pseudovirus product specification, RNA quantitative analysis is carried out, then the RNA pseudovirus simulation samples are respectively diluted to 2000 copies/mul, 20 copies/mul, 2 copies/mul and 0 copies/mul, and the fluorescence RT-PCR method established by the invention is used for detection. The results of the sensitivity measurements are shown in FIGS. 2A-2C. As shown in FIG. 2(G75V and T76I), FIG. 3 (delta 246-252 and D253N) and FIG. 4(L452Q and F490S), the results show that the sensitivity of the mutation sites of the spinous process protein coding genes G75V, T76I, delta 246-252, D253-253N, L452Q and F490S of the Lambda variant detected by the fluorescence RT-PCR method reaches 2 copies/. mu.l.

Example 3: validation of clinical samples

(1) Materials, reagents, instruments: refer to example 2.

(2) Preparation of a specimen: inactivated virus throat swab samples of 10 suspected patients for clinical nucleic acid detection are collected as samples to be detected, meanwhile, inactivated virus throat swab samples of 1 new coronavirus Lambda variant strain which is diagnosed to infect 2019 are collected as positive reference products, and throat swab samples of 5 healthy people are collected as negative reference products. All the above samples are from a certain clinical unit.

(3) Nucleic acid extraction: and respectively extracting nucleic acids of the sample to be detected, the positive reference substance and the negative reference substance by using a magnetic bead method virus nucleic acid extraction kit, and then using the nucleic acids for PCR detection.

(4) And (3) PCR amplification: refer to example 2.

(5) Comparison reagent: the detection results of the clinical samples are verified by using a commercially available 2019 novel coronavirus nucleic acid detection reagent (Shanghai river Biotechnology GmbH, novel coronavirus 2019-nCoV nucleic acid detection kit (fluorescent PCR method), 25 persons/box and national institutes of record 20203400057) as a contrast reagent, and the detection results are further verified by a second-generation sequencing method (a new coronavirus sequencing project which is entrusted to a third-party medical inspection unit).

(6) And (3) detection results: as shown in Table 6, the test results of the test reagent developed by the present invention on clinical specimens completely coincided with the results of the commercially available contrast reagent and the second-generation sequencing. Wherein, the detection period of the second generation sequencing method is about two weeks, and the detection cost is 3000-4000 yuan/case; the detection period required by the detection method used by the invention is within one day, and the detection cost is lower than 50 Yuan/example.

Therefore, the nucleic acid detection reagent and the method for the 2019 novel coronavirus (SARS-CoV-2) Lambda (Lambda) variant strain, which are developed by the invention, have accurate and reliable detection effects, not only make up the defect that the commercially available 2019 novel coronavirus contrast reagent cannot identify the Lambda variant strain, but also avoid the defects of long detection period, high cost and complex operation of second-generation sequencing.

TABLE 6 clinical specimen test results

Sample numbering	Test results of the invention	Test results of contrast agent	Second generation sequencing test results
				Sample 1 to be tested	Negative of	Negative of	Negative of
Sample 2 to be tested	Negative of	Negative of	Negative of
				Sample to be tested 3	Negative of	Negative of	Negative of
Sample to be tested 4	Negative of	Negative of	Negative of
				Sample to be tested 5	Negative of	Negative of	Negative of
Sample to be tested 6	Negative of	Negative of	Negative of
				Sample to be tested 7	Negative of	Negative of	Negative of
Sample 8 to be tested	Negative of	Negative of	Negative of
				Sample to be tested 9	Negative of	Negative of	Negative of
Sample to be tested 10	Negative of	Negative of	Negative of
				Positive reference	New coronaviruses lambda positive	Positive for new coronavirus	New coronaviruses lambda positive
Negative reference 1	Negative of	Negative of	Negative of
				Negative reference substance 2	Negative of	Negative of	Negative of
Negative reference 3	Negative of	Negative of	Negative of
				Negative reference substance 4	Negative of	Negative of	Negative of
Negative reference 5	Negative of	Negative of	Negative of

Sequence listing

<110> Beijing Elelix medical science and technology Co., Ltd

<120> 2019 novel coronavirus lambda variant nucleic acid detection reagent, kit and detection method

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 24

<212> RNA

<213> G75V/T76I Forward primer (Artificial sequence)

<400> 1

<210> 2

<211> 25

<212> RNA

<213> G75V/T76I reverse primer (Artificial sequence)

<400> 2

<210> 3

<211> 23

<212> RNA

<213> G75V/T76I Probe P1 (Artificial sequence)

<400> 3

<210> 4

<211> 23

<212> RNA

<213> Δ 246-252/D253N Forward primer (Artificial sequence)

<400> 4

<210> 5

<211> 25

<212> RNA

<213> Δ 246-252/D253N reverse primer (artificial sequence)

<400> 5

<210> 6

<211> 25

<212> RNA

<213> Δ 246-252/D253N Probe P2 (Artificial sequence)

<400> 6

<210> 7

<211> 23

<212> RNA

<213> L452Q/F490S Forward primer (Artificial sequence)

<400> 7

<210> 8

<211> 24

<212> RNA

<213> L452Q/F490S reverse primer (Artificial sequence)

<400> 8

<210> 9

<211> 22

<212> RNA

<213> L452Q/F490S Probe P3 (Artificial sequence)

<400> 9

Claims

1. A2019 novel coronavirus lambda variant nucleic acid detection reagent is characterized by comprising the following specific primers and probes which are respectively designed aiming at mutation sites of spinous process protein coding genes G75V, T76I, delta 246-252, D253N, L452Q and F490S of a lambda variant:

2. the detection reagent according to claim 1, wherein the probe P1 is labeled with a reporter fluorescent dye FAM at the 5 'end and a reporter fluorescent dye BHQ at the 3' end; the 5 'end of the probe P2 is marked with a reporter fluorescent dye VIC, and the 3' end is marked with a reporter fluorescent dye BHQ; the 5 'end of the probe P3 is marked with a reporter fluorescent dye CY5, and the 3' end is marked with a reporter fluorescent dye BHQ.

3. The detection reagent according to claim 1 or 2, further comprising a one-step RT-PCR reaction solution, a positive control and a negative control;

the positive control is an RNA pseudovirus standard carrying mutation sites of spinous process protein coding genes G75V, T76I, delta 246-252, D253N, L452Q and F490S of the lambda variant, and the negative control is DEPC water.

4. The detection reagent of claim 3, wherein the one-step RT-PCR reaction solution comprises 2 X10 Xbuffer solution and 200 μ M Mg²⁺0.5nM DTT, 10. mu.M dNTPs, 2U DNA polymerase, 0.5U RNase inhibitor, 0.1U UNG enzyme, 0.2U RT enzyme.

5. A kit comprising the 2019 novel coronavirus lambda variant nucleic acid detection reagent of any one of claims 1-4.

6. A2019 novel coronavirus lambda variant nucleic acid detection method, which is characterized in that the detection is carried out by using the detection reagent of any one of claims 1-4, and comprises the following steps:

taking the extracted nucleic acid sample to be detected as a template, and simultaneously carrying out multiple fluorescent quantitative PCR detection by using a positive control, a negative control and specific primers and probes respectively designed for spinous process protein coding genes G75V, T76I, delta 246-252, D253N, L452Q and F490S of the lambda variant;

7. The detection method according to claim 6, wherein the total volume of the reaction system for performing the multiplex quantitative PCR detection is 25. mu.l, and specifically comprises: one-step PCR reaction solution 12.5. mu.l, 1. mu.M primer and probe mixed solution 5. mu.l, template/positive control/negative control 5. mu.l and DEPC water 2.5. mu.l;

the reaction conditions for performing multiplex fluorescent quantitative PCR detection are as follows: reverse transcription is carried out for 25min at 50 ℃; pre-denaturation at 95 ℃ for 2 min; denaturation at 95 ℃ for 10s, annealing and extension at 60 ℃ for 40s and fluorescence collection for 40 cycles.

8. The detection method according to claim 6, wherein the Start value is set to 5 to 10, the End value is set to 10 to 15, and the amplification curve of the negative control is adjusted to be flat or lower than a threshold line;

when effectiveness judgment is carried out, the effective standard is as follows:

detection site Fluorescent channel Negative control Positive control G75V and T761 FAM channel Ct value free Ct≤35 Δ 246- VIC channel Ct value free Ct≤35 L452Q and F490S CY5 channel Ct value free Ct≤35

；

When result judgment is carried out, the criteria of judging as positive or negative are as follows:

positive interpretation: FAM channel CT ≤ 39 is positive for G75V and T76I mutations; the VIC channel CT less than or equal to 39 is positive for delta 246-252 and D253N mutations; the CY5 channel CT is less than or equal to 39, and is positive to the L452Q and F490S mutations; if the channels FAM, VIC and CY5 simultaneously meet the condition that CT is less than or equal to 39, judging the strain as a lambda variant;

9. The method of claim 6, further comprising the step of extracting the sample of nucleic acid to be tested using a nucleic acid extraction reagent before performing the multiplex quantitative fluorescence PCR assay.

10. The method as claimed in claim 6, wherein the sensitivity of the method to the spinous process protein-encoding genes G75V, T76I, Δ 246-252, D253N, L452Q and F490S of the lambda variant is 2 copies/. mu.l.