CN113981152A

CN113981152A - Composition, kit and method for detecting SARS-CoV-2 variant strain and its use

Info

Publication number: CN113981152A
Application number: CN202111618758.8A
Authority: CN
Inventors: 谭爱女; 郭永超
Original assignee: Shenzhen Uni Medica Technology Co ltd
Current assignee: Shenzhen Uni Medica Technology Co ltd
Priority date: 2021-12-28
Filing date: 2021-12-28
Publication date: 2022-01-28
Anticipated expiration: 2041-12-28
Also published as: CN113981152B

Abstract

The invention belongs to the field of molecular biology detection; relates to the detection of a variant of SARS-CoV-2 Onckrron (Omicron). The invention provides a kit comprising the composition, application of the composition, and a method for detecting and typing SARS-CoV-2 variant strains. Typing the Onckrojon variant strain by detecting 4 different characteristic functional variant sites on the S gene of the SARS-CoV-2 variant strain, thereby realizing the typing detection of the SARS-CoV-2 virus and the Oncojon variant strain in a single tube reaction system. The composition of the invention, combined with a fluorescence probe melting curve method, has low cost and high flux. And the operation is simple, and the result reading process can be judged according to the Tm value of the melting peak. The whole detection process is carried out under the condition of single tube sealing, so that false positive and environmental pollution caused by cross among samples are avoided.

Description

Composition, kit and method for detecting SARS-CoV-2 variant strain and its use

Technical Field

The invention belongs to the field of molecular biology detection; in particular, it relates to the detection of SARS-CoV-2; more particularly, it relates to the detection of a variant of SARS-CoV-2 Onckrron (Omicron).

Background

A novel coronavirus (2019-nCoV, SARS-CoV-2) was named SARS-CoV-2 by the International Committee for Classification of viruses at 11/2/2020. Coronaviruses are a large family of viruses, previously known to infect humans, such as those causing the common cold and Middle East Respiratory Syndrome (MERS) and Severe Acute Respiratory Syndrome (SARS), while SARS-CoV-2 is a new strain of Coronavirus that has never been previously found in humans, a beta-type Coronavirus of the genus coronaviruses (Coronaviridae) in the family Coronaviridae (Coronavirus), an RNA ((+) ssRNA) virus with a capsule and spike cytological signature genome of a linear single positive strand.

The common signs of the new coronary pneumonia include respiratory symptoms such as fever, cough, shortness of breath and dyspnea. In more severe cases, the infection can lead to pneumonia, severe acute respiratory syndrome, renal failure, and further death. There is no specific treatment for 2019 novel coronavirus-caused diseases at present, but many symptoms can be treated symptomatically with auxiliary care and supportive treatment.

With the increasingly severe transmission, more and more variant strains emerge, the virulence and transmission capacity of the variant strains are greatly different, and hundreds of new variants of coronavirus have been discovered all over the world according to the world health organization official network, so far, the most recent Onconk variant strain has some important amino acid mutation sites of the first 4 variants which need attention, including sites with enhanced cell receptor affinity, virus replication capacity and immune escape capacity. Superposition of mutations may reduce the protective efficacy of some antibody drugs against the ormikosn variant. However, no reagent for detecting the mutant strain of Ormcken is available in the prior art.

Therefore, there is a need in the art for reagents that can accurately detect the variant strains of Ormcken in order to specifically take epidemic prevention and treatment measures to make the response more efficient. Meanwhile, the detection time is short, and the sensitivity is high.

Disclosure of Invention

In view of the above, in a first aspect, the present invention provides a composition capable of detecting and typing a SARS-CoV-2 variant strain, the composition comprising:

a first nucleic acid composition:

the primer upstream of the mutation E484A shown as SEQ ID NO. 1, the primer downstream of the mutation E484A shown as SEQ ID NO. 2, and the mutation E484A probe shown as SEQ ID NO. 3;

a second nucleic acid composition:

the upstream primer of mutation Q498R shown in SEQ ID NO. 4, the downstream primer of mutation Q498R shown in SEQ ID NO. 5, and the mutation Q498R probe shown in SEQ ID NO. 6; and

the upstream primer of mutation N679K shown as SEQ ID NO. 7, the downstream primer of mutation N679K shown as SEQ ID NO. 8, and the mutation N679K probe shown as SEQ ID NO. 9; and

a third nucleic acid composition:

the upstream primer of mutation S477N shown in SEQ ID NO. 10, the downstream primer of mutation S477N shown in SEQ ID NO. 11, and the mutation S477N probe shown in SEQ ID NO. 12.

The kit for detecting and typing SARS-CoV-2 variant strain provided by the invention mainly utilizes a multiple fluorescence PCR melting curve analysis method to type the Onckrojon variant strain by detecting 4 different characteristic function variant sites on the S gene of the SARS-CoV-2 variant strain, thereby simultaneously realizing the detection of the typing of SARS-CoV-2 virus and the Oncojon variant strain in a single-tube reaction system. So that different strains can be treated differently, thereby making treatment and prevention more efficient. The composition of the invention, combined with a fluorescence probe melting curve method, has low cost and high flux. And the operation is simple, and the result reading process can be judged according to the Tm value of the melting peak. The whole detection process is carried out under the condition of single tube sealing, so that false positive and environmental pollution caused by cross among samples are avoided.

Further, in some embodiments, the compositions of the invention may include one or more of the above-described primer and probe pairs simultaneously. In the present invention, "pair" refers to the matched upstream and downstream primers and probes for detecting a mutation.

For example, only the first nucleic acid composition may be included; may include only the second nucleic acid composition; the third nucleic acid composition may be included only.

For example, it is also possible to include only some primer and probe pairs of different nucleic acid compositions, for example, including the mutation E484A upstream primer shown in SEQ ID NO. 1, the mutation E484A downstream primer shown in SEQ ID NO. 2, and the mutation E484A probe shown in SEQ ID NO. 3; the upstream primer of mutation N679K shown as SEQ ID NO. 7, the downstream primer of mutation N679K shown as SEQ ID NO. 8, and the mutation N679K probe shown as SEQ ID NO. 9; and a mutation S477N upstream primer shown as SEQ ID NO. 10, a mutation S477N downstream primer shown as SEQ ID NO. 11, and a mutation S477N probe shown as SEQ ID NO. 12.

Further, the fluorophores of the probes in the first, second and third nucleic acid compositions are different from each other and do not interfere with each other.

As used herein, "different from each other and non-interfering" means that the fluorophores used in each probe in the composition are different and do not interfere with each other's detection, i.e., detection can be performed using different channels. For example, FAM, HEX, ROX and CY5 can be used, which do not have close absorbance values and can select different channels and thus do not interfere with each other.

Further, the composition comprises: a fourth nucleic acid composition.

In some specific embodiments, the fourth nucleic acid composition is used to detect at least one of the SARS-CoV-2N gene, SARS-CoV-2 ORF1ab gene, a reference gene of human origin.

The human reference gene is housekeeping gene ACTB.

In some specific embodiments, the fourth nucleic acid composition for detecting SARS-CoV-2N gene is an N gene upstream primer shown in SEQ ID NO:13, an N gene downstream primer shown in SEQ ID NO:14, and an N gene probe shown in SEQ ID NO: 15.

In some specific embodiments, the fourth nucleic acid composition for detecting the human reference gene is an internal reference upstream primer shown as SEQ ID NO. 16, an internal reference downstream primer shown as SEQ ID NO. 17, and an internal reference probe shown as SEQ ID NO. 18.

Further, the fluorophores of the probes between the first, second, third and fourth nucleic acid compositions are different from each other and do not interfere with each other.

In some specific embodiments, the first nucleic acid composition further comprises a primer-probe pair for detecting the SARS-CoV-2S gene.

In a specific embodiment, the first nucleic acid composition comprises an S gene upstream primer shown as SEQ ID NO. 19, an S gene downstream primer shown as SEQ ID NO. 20, and an S gene probe shown as SEQ ID NO. 21.

Further, the composition includes a universal primer.

In a particular embodiment, the composition further comprises: a universal upstream primer shown as SEQ ID NO. 22 and a universal downstream primer shown as SEQ ID NO. 23.

"including a universal primer" means that a universal primer is attached to the 5' end of each primer fragment, e.g., SEQ ID NO:1 connecting the universal primer sequences becomes:

TCCGCAACTAACGCTGCTTTCCACCTCGTCAACCCTTCTGCACACCTTGTAATGGTGTTGC。

the sequence of the SEQ ID NO 2 ligation universal primer is changed into:

CCGTTCGACAATGCCTTCATGCTGGTGCATGTAGAAGTTCA。

by introducing the universal primer sequence fragments, different targets can be amplified by using the same universal primer pairs and a large number of target sequences are enriched, the occurrence of primer dimers can be reduced, and the competitive relationship between multiple specific amplification primer pairs is balanced, so that the amplification efficiency of the multiple PCR is obviously improved.

In some specific embodiments, the compositions of the invention are used in fluorescence PCR.

In the present invention, the fluorescent reporter group may be selected from FAM, HEX, ROX, VIC, CY5, 5-TAMRA, TET, CY3 and JOE, but is not limited thereto.

In a specific embodiment, the fluorescent reporter of the first nucleic acid composition probe is HEX; the fluorescent reporter group of the second nucleic acid composition probe is ROX; the fluorescent reporter of the third nucleic acid composition probe is CY 5; and the fluorescent reporter group of the fourth nucleic acid composition probe is FAM.

Further, the 3' -end of the probe also has a quencher group, such as BHQ1 or BHQ 2.

In a specific embodiment, the 3' end of the probe is BHQ 1.

Further, the dosage of the primer in the composition is 0.1-0.3 mu M; the dosage of the probe in the composition is 0.1-0.3 mu M.

Furthermore, the dosage of the universal upstream primer in the composition is 0.5-0.8 mu M, and the dosage of the universal downstream primer is 4-8 mu M.

In a specific embodiment, each nucleic acid composition of the compositions of the invention is present in a separate package.

In a specific embodiment, each nucleic acid composition of the compositions of the invention is present in the same package.

Further, the components of each nucleic acid composition of the present invention are present in a mixed form.

In a second aspect, the present invention provides the use of the above-described composition of the present invention in the preparation of a kit for detecting and typing a SARS-CoV-2 variant.

In a third aspect, the present invention provides a kit for detecting and typing a SARS-CoV-2 variant, which comprises the composition of the present invention as described above.

Further, the kit also comprises a negative quality control product and a positive quality control product.

In a specific embodiment, the negative quality control product is at least one of DEPC H2O, physiological saline and reference gene pseudovirus. The positive quality control product contains at least one of novel coronavirus S target gene, novel coronavirus N target gene, various mutation sites of the novel coronavirus, target fragment plasmid of reference gene, fragment RNA and pseudovirus.

Further, the kit also comprises dNTP, PCR buffer solution and Mg²⁺At leastOne kind of the medicine.

Still further, the kit further comprises: at least one of a nucleic acid releasing agent, a nucleic acid extraction reagent, a reverse transcriptase, a uracil glycosylase, and a DNA polymerase.

Furthermore, the kit also comprises a nucleic acid release reagent, a nucleic acid extraction reagent, dNTP, reverse transcriptase, uracil glycosylase, DNA polymerase, PCR buffer solution and Mg²⁺At least one of (1).

Further, the concentration of the reverse transcriptase is 5U/reaction-15U/reaction, for example, the reverse transcriptase can be murine leukemia reverse transcriptase (MMLV) or Tth enzyme; the concentration of the DNA polymerase is 3U/reaction-15U/reaction, for example, the DNA polymerase can be Taq enzyme.

In a particular embodiment, the kit of the invention comprises: reverse/reverse transcriptase, Taq enzyme, uracil glycosylase, Mg²⁺、Mn²⁺Rnasin, dNTP, primers, probes and PCR buffer solution.

Common PCR buffers are Tris-HCl, MgCl₂And buffer systems such as KCl and Triton X-100. The total volume of a single PCR reaction tube is 20-100 mu l.

In a specific embodiment, the kit of the present invention is compatible with a digital PCR amplification system, i.e., can be directly used for amplification on a digital PCR instrument.

In a fourth aspect, there is provided a method for detecting and typing a SARS-CoV-2 variant, the method comprising the steps of:

1) extracting or releasing nucleic acid of a sample to be detected;

2) performing fluorescence quantitative PCR and melting curve analysis on the nucleic acid obtained in step 1) using the composition of the present invention or the kit of the present invention;

3) results were obtained and analyzed.

In the present invention, the sample to be detected may be a pharyngeal swab, an oropharyngeal swab, a nasopharyngeal swab, sputum, alveolar lavage fluid, blood, or the like, but is not limited thereto.

Further, the reaction conditions of the fluorescent quantitative PCR are as follows:

reverse transcription is carried out at the temperature of 50-60 ℃ for 5-30 minutes, and 1 cycle is carried out; pre-denaturing cDNA at 95 deg.c for 1-10 min for 1 circulation; denaturation at 95 ℃ for 5-20 seconds, annealing at 55-60 ℃ for 20-60 seconds, and performing 40-50 cycles, collecting fluorescence at 95 ℃ for 0-1 minute at 35-90 ℃, and analyzing a melting curve.

In a specific embodiment, a method is provided for detecting and typing a SARS-CoV-2 variant strain for non-diagnostic purposes, the method comprising the steps of:

1) extracting or releasing nucleic acid of a sample to be detected;

3) results were obtained and analyzed.

As used herein, the term "non-diagnostic purpose" refers to information that is not intended to obtain information whether an individual is infected with a SARS-CoV-2 variant and has suffered pneumonia. For example, the method can be used to detect the presence of a SARS-CoV-2 Onckrenchen variant in a test culture in an experiment for research purposes.

Drawings

FIG. 1 shows the results of the test of Ormcken variant strains with the composition of the present invention;

FIG. 2 is a graph of the sensitivity test results (100 copies/mL) for the compositions of the present invention;

FIGS. 3 to 6 show the specific detection of the composition of the present invention (human coronavirus HKU 1/human coronavirus OC43, human coronavirus NL 63/human coronavirus 229E, SARS coronavirus/MERS coronavirus, and influenza A virus/influenza B virus in this order);

FIGS. 7-9 show the specific detection of the novel crown variant of the composition of the present invention (negative sample, Ormcken variant, novel crown wild type and other variants in order);

FIGS. 10 to 12 show the results of the tests of the comparative example compositions of the present invention.

Detailed Description

In the present invention, the expressions "first", "second", "third" and "fourth", etc. are used for descriptive purposes only to distinguish between the defined substances, and not to define an order or primary or secondary in any way.

The present invention will be specifically explained below with reference to specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly apparent therefrom. It will be understood by those skilled in the art that these specific embodiments and examples are illustrative of the invention and are not to be construed as limiting the invention.

Example 1 primers and probes used in the present invention

TABLE 1

Wherein, the fluorescent reporter groups of SEQ ID NO 3 and 21 are HEX; the fluorescent reporter groups of SEQ ID NO 6 and 9 are ROX; 12 is CY 5; the fluorescent reporter groups of SEQ ID NO 15 and 18 are FAM, and the 3' end of the probe also has a BHQ1 quenching group.

Example 2 method for detecting SARS-CoV-2

1. Specimen type: oropharyngeal swabs, nasopharyngeal swabs;

2. nucleic acid extraction:

a commercial RNA extraction kit, such as a nucleic acid extraction reagent based on a silica gel membrane centrifugal column method or a nucleic acid extraction reagent based on a magnetic bead method, is adopted, the operation is carried out according to the kit instruction, and finally 80 mu L of RNA solution is collected and directly detected.

Or stored at-80 ℃. Extracting the negative quality control product and the positive quality control product;

3. system configuration:

according to the total reaction number N required for detection, 18.5. mu.l of RT-PCR amplification solution (MgCl) is added into each tube of PCR₂6mM, dNTP 0.8mM, and the concentration of the forward primer/the backward primer were all 0.2. mu.M, the concentration of the probe was 0.25. mu.M, the concentration of the universal forward primer was 0.6. mu.M, and the concentration of the universal backward primer was 6. mu.M), and 1.5. mu.l of an enzyme mixture (hot-start Taq enzyme, reverse transcriptase, uracil glycosylase (UNG)). Calculating the required total amount, uniformly mixing, and then packaging into a special PCR reaction tube;

4. sample adding:

respectively adding a negative quality control product, a sample RNA solution and a positive quality control product into the PCR reaction tube which is filled with the reagents, wherein the sample adding amount is 10 mu L, tightly covering a tube cover, uniformly mixing, centrifuging and collecting the solution, and placing the solution at the bottom of the tube;

5. performing on-machine amplification detection:

the settings of the RT-PCR amplification program and the melting curve analysis program are shown in Table 2 below:

TABLE 2

6. And (4) analyzing results:

on the premise that the amplification is effective, the judgment is as shown in table 3:

TABLE 3

For example, Q498R and N679K, etc. are distinguished from wild-type or other variant sites by allele-specific primer amplification, the amplification primer sequences of different mutation sites are different, the melting temperature Tm values of the detection probes are also different, and different types of mutations can be distinguished by different channels and Tm values.

Example 3 test results of test specimens of the composition of the invention

The primer and probe shown in example 1 were used to detect the Oncuronn pseudovirus according to the method of example 2, and the results are shown in FIG. 1. The results show that each channel can be detected normally, the multiple PCR system can detect the condition of the corresponding target, and the new crown variant strain is typed to identify the Onckronen variant strain.

Example 4 sensitivity of the compositions of the invention

The negative samples were diluted to a concentration of 100 copies/mL to verify the sensitivity of the compositions of the present invention shown in Table 1 and the detection method described in example 2. The detection result is shown in figure 2, the pseudovirus simulation sample of the Ormcken new crown variant strain with N, S two target genes and 4 characteristic variant sites with 100 copies/mL can be accurately detected, and the detection method has higher sensitivity.

Example 5 specificity of the compositions of the invention

Pseudoviruses of endemic human coronavirus (HKU 1, OC43, NL63 and 229E), SARS coronavirus, MERS coronavirus, influenza A virus, and influenza B virus were diluted to 1X 10⁶When the copy/mL is used as a specificity detection sample and detected by using the composition disclosed by the embodiment 1 of the invention, no specific amplification occurs in an experimental result, and partial detection results are shown in FIGS. 3-6.

The detection results show that 8 pathogens including endemic human coronavirus (HKU 1, OC43, NL63 and 229E), SARS coronavirus, MERS coronavirus, influenza A virus and influenza B virus are negative, and the composition has good specificity.

Example 6 specificity of novel crown variants of the compositions of the invention

In order to verify the accuracy and effectiveness of differential diagnosis of the composition and other variants of the new crown virus, pseudovirus samples of the wild type and other variants of the new crown virus, Alpha, Beta, Gamma, Delta, Lambda, Mu, Kappa, Eta and Ito are simultaneously verified by the composition, and the result shows that no cross reaction exists, and only the variation of Onckrjon has a melting peak corresponding to amplification. The kit can accurately identify and diagnose the Ormcken variant strain and other variant strains, and the detection is shown in figures 7-9.

Comparative example 1 primers and probes designed according to the invention with the remaining Effect not good

Because of the base complementary pairing principle, a dimer is formed between the primer and (or) the probe, but the probability is very small, and the dimer can be excluded at the beginning of the design. However, when multiple pathogens are jointly detected, a large number of primers and probes exist, dimers are easy to occur between the primers and the primers, between the probes and the probes, the designed conservativeness is ensured (the conservativeness is important for the detection accuracy), and the mutual interference between different primer probes is considered, so that the primer probes need to be designed elaborately.

Thus, the inventors also designed the remaining primers and probes (sequences not shown) to constitute different detection systems 1, 2 and 3, which were also used to detect the Onckrozen variant. The specific detection results are shown in fig. 10-12, and it can be seen from the graphs that only partial peaks of the target appear in the detection, and the peak pattern is poor, and other targets even have no characteristic peak, so the overall detection effect is poor.

Sequence listing

<110> Shenzhen combined medical science and technology Limited

<120> composition, kit, method and use for detecting SARS-CoV-2 variant

<160> 23

<170> PatentIn version 3.5

<210> 1

<211> 42

<212> DNA

<213> Artificial sequence

<400> 1

tccacctcgt caacccttct gcacaccttg taatggtgtt gc 42

<210> 2

<211> 22

<212> DNA

<213> Artificial sequence

<400> 2

tgctggtgca tgtagaagtt ca 22

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence

<400> 3

tccacctcgt caacccttct 20

<210> 4

<211> 46

<212> DNA

<213> Artificial sequence

<400> 4

ccgacctctc catgtcttca cctcctttac aatcatatgg tttccg 46

<210> 5

<211> 22

<212> DNA

<213> Artificial sequence

<400> 5

tgtgcctgtt aaaccattga ag 22

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence

<400> 6

ccgacctctc catgtcttca cc 22

<210> 7

<211> 50

<212> DNA

<213> Artificial sequence

<400> 7

cccactccag cttgcactga ccaaccgcta gttatcagac tcagactaag 50

<210> 8

<211> 22

<212> DNA

<213> Artificial sequence

<400> 8

agtgacatag tgtaggcaat ga 22

<210> 9

<211> 25

<212> DNA

<213> Artificial sequence

<400> 9

cccactccag cttgcactga ccaac 25

<210> 10

<211> 49

<212> DNA

<213> Artificial sequence

<400> 10

cttctcggtc cttcctcttg actctccctg aaatctatca ggccggtaa 49

<210> 11

<211> 22

<212> DNA

<213> Artificial sequence

<400> 11

ctgtatggtt ggtaaccaac ac 22

<210> 12

<211> 27

<212> DNA

<213> Artificial sequence

<400> 12

cttctcggtc cttcctcttg actctcc 27

<210> 13

<211> 41

<212> DNA

<213> Artificial sequence

<400> 13

cttcctcctt gccgacaccg gggaacttct cctgctagaa t 41

<210> 14

<211> 22

<212> DNA

<213> Artificial sequence

<400> 14

cagacatttt gctctcaagc tg 22

<210> 15

<211> 19

<212> DNA

<213> Artificial sequence

<400> 15

cttcctcctt gccgacacc 19

<210> 16

<211> 46

<212> DNA

<213> Artificial sequence

<400> 16

ccctcctcct tgccacgcca gcctacacat gagctgcgtg tggctc 46

<210> 17

<211> 18

<212> DNA

<213> Artificial sequence

<400> 17

gctggggtgt tgaaggtc 18

<210> 18

<211> 28

<212> DNA

<213> Artificial sequence

<400> 18

ccctcctcct tgccacgcca gcctacac 28

<210> 19

<211> 39

<212> DNA

<213> Artificial sequence

<400> 19

ttcccttccg tgaccttcct caagtgtctg tggatcacg 39

<210> 20

<211> 21

<212> DNA

<213> Artificial sequence

<400> 20

cctgtgcctg ttaaaccatt g 21

<210> 21

<211> 18

<212> DNA

<213> Artificial sequence

<400> 21

ttcccttccg tgaccttc 18

<210> 22

<211> 19

<212> DNA

<213> Artificial sequence

<400> 22

tccgcaacta acgctgctt 19

<210> 23

<211> 19

<212> DNA

<213> Artificial sequence

<400> 23

tccgcaacta acgctgctt 19

Claims

1. A composition capable of detecting and typing a SARS-CoV-2 variant, said composition comprising in combination:

a first nucleic acid composition:

a second nucleic acid composition:

a third nucleic acid composition:

2. The composition of claim 1, wherein the composition further comprises a fourth nucleic acid composition.

3. The composition of claim 2, wherein the fourth nucleic acid composition is used to detect at least one of a SARS-CoV-2N gene, a SARS-CoV-2 ORF1ab gene, a human reference gene.

4. The composition of claim 3, wherein the fourth nucleic acid composition for detecting SARS-CoV-2N gene is an N gene upstream primer shown in SEQ ID NO. 13, an N gene downstream primer shown in SEQ ID NO. 14, and an N gene probe shown in SEQ ID NO. 15; or

The fourth nucleic acid composition for detecting the human reference gene is an internal reference upstream primer shown as SEQ ID NO. 16, an internal reference downstream primer shown as SEQ ID NO. 17 and an internal reference probe shown as SEQ ID NO. 18.

5. The composition of claim 1, wherein the composition comprises a universal primer.

6. The composition of any one of claims 1 to 5, wherein each nucleic acid composition of the composition is present in the same package.

7. Use of the composition of any one of claims 1 to 6 in the preparation of a kit for detecting and typing a SARS-CoV-2 variant.

8. A kit for detecting and typing a SARS-CoV-2 variant, the kit comprising the composition of any one of claims 1 to 6.

9. The kit of claim 8, wherein the kit further comprises a nucleic acid releasing reagent, a nucleic acid extracting reagent, dntps, reverse transcriptase, uracil glycosylase, DNA polymerase, PCR buffer, and Mg²⁺At least one of (1).

10. A method for detecting and typing a SARS-CoV-2 variant for non-diagnostic purposes, the method comprising the steps of:

1) extracting or releasing nucleic acid of a sample to be detected;

2) performing fluorescence quantitative PCR and melting curve analysis on the nucleic acid obtained in the step 1) by using the composition according to any one of claims 1 to 6 or the kit according to any one of claims 8 to 9;

3) results were obtained and analyzed.