CN113774169A - 2019 novel coronavirus delta variant nucleic acid detection reagent, kit and detection method - Google Patents

2019 novel coronavirus delta variant nucleic acid detection reagent, kit and detection method Download PDF

Info

Publication number
CN113774169A
CN113774169A CN202111112225.2A CN202111112225A CN113774169A CN 113774169 A CN113774169 A CN 113774169A CN 202111112225 A CN202111112225 A CN 202111112225A CN 113774169 A CN113774169 A CN 113774169A
Authority
CN
China
Prior art keywords
detection
delta
positive
nucleic acid
channel
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202111112225.2A
Other languages
Chinese (zh)
Inventor
蒋小琴
杨仲钦
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Eric Yang Medical Technology Co ltd
Original Assignee
Beijing Eric Yang Medical Technology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Eric Yang Medical Technology Co ltd filed Critical Beijing Eric Yang Medical Technology Co ltd
Priority to CN202111112225.2A priority Critical patent/CN113774169A/en
Publication of CN113774169A publication Critical patent/CN113774169A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Virology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a 2019 novel coronavirus (SARS-CoV-2) Delta (Delta) variant nucleic acid detection reagent, a kit and a detection method, belonging to the technical field of in-vitro diagnostic reagents. The detection reagent comprises specific primers and probes respectively designed aiming at Delta variant spinous process protein coding genes T19R, L452R, T478K and P681R mutation sites, and also comprises a one-step RT-PCR reaction solution, a positive control and a negative control. Based on the detection reagent, the invention fully utilizes the advantages of high detection speed, high sensitivity and low cost of a fluorescent quantitative PCR platform, develops a novel nucleic acid detection method for 2019 novel coronavirus Delta variant strains, which is simple, quick, accurate and low in cost, overcomes the defects of long time consumption, high cost and complex operation process in the aspect of Delta variant strain typing detection in the prior art (NGS), meets the detection requirements of a large number of samples in clinic, and provides powerful technical support for epidemic situation prevention and control.

Description

2019 novel coronavirus delta variant nucleic acid detection reagent, kit and detection method
Technical Field
The invention belongs to the technical field of in-vitro diagnostic reagents, and particularly relates to a 2019 novel coronavirus (SARS-CoV-2) Delta (Delta) variant nucleic acid detection reagent, a kit and a detection method.
Background
The Delta variant is one of the most important variant strains of the 2019 novel coronavirus (SARS-CoV-2), is becoming a main epidemic strain in many countries, has obviously enhanced transmission capability and shortened incubation period, and can cause the severity of diseases to increase, thus quickly becoming a dominant strain which is popular in the world at present.
As shown by the analysis of the nucleic acid sequence diversity of SARS-CoV-2, the most important change of Delta variant compared with wild-type SARS-CoV-2 is the occurrence of multiple base mutation in the nucleotide sequence of the encoding gene of the spinous process protein (Spike protein), and the typical mutation sites are: T19R, Delta 156-157, R158G, L452R, T478K, P681R, D950N, etc. By analyzing the sequence diversity of SARS-CoV-2 in the database of GISAID EpiCoV, the mutation sites T19R, L452R, T478K and P681R are simultaneously generated, thus the Delta variant can be specifically identified. Therefore, an accurate and rapid gene mutation typing detection reagent and a detection method thereof are developed for identifying T19R, L452R, T478K and P681R mutation in the SARS-CoV-2 spinous process protein coding gene, can realize rapid screening of Delta variant strains, and meet the urgent need of epidemic situation prevention and control.
The existing nucleic acid detection aiming at SARS-CoV-2 is mainly based on a fluorescence quantitative PCR detection platform, the detection is convenient and rapid, the cost is low, and the detection result is accurate and reliable; however, the Delta variant is caused by gene mutation of wild SARS-CoV-2, and the mutation type is mostly point mutation of single base sequence, so the development of the detection reagent on a fluorescent quantitative PCR detection platform is difficult, and no detection product exists in the market at present. The typing detection of the existing gene detection method aiming at the Delta variant strain is mainly second generation sequencing (NGS), the detection period is long, the cost is high, the operation is complicated, and the rapid screening requirement of a large number of clinical samples cannot be met.
Disclosure of Invention
The invention aims to provide a 2019 novel coronavirus (SARS-CoV-2) Delta (Delta) variant nucleic acid detection reagent, a kit and a detection method aiming at the defects of the prior art, wherein the reagent, the kit and the detection method are beneficial to making up the defects of the prior art, realize the rapid detection of the Delta variant with rapidness, accuracy and low cost, and provide powerful technical support for epidemic situation prevention and control.
In order to achieve the purpose, the invention provides a 2019 novel coronavirus delta variant nucleic acid detection reagent, which comprises specific primers and probes respectively designed for mutation sites of spike protein coding genes T19R, L452R, T478K and P681R of a delta variant:
Figure BDA0003270675510000021
in the present invention, the reporter fluorescent dye group labeled at both ends of the probe may be selected from conventional group species. Preferably, the 5 'end of the probe P1 is labeled with a reporter fluorescent dye FAM, and the 3' end is labeled with a reporter fluorescent dye BHQ; the 5 'end of the probe P2-1 is marked with a reporter fluorescent dye VIC, and the 3' end is marked with a reporter fluorescent dye BHQ; the 5 'end of the probe P2-2 is marked with a reporter fluorescent dye CY5, and the 3' end is marked with a reporter fluorescent dye BHQ; the 5 'end of the probe P3 is labeled with a reporter fluorescent dye ROX, and the 3' end is labeled with a reporter fluorescent dye BHQ.
Preferably, the detection reagent further comprises a one-step RT-PCR reaction solution, a positive control substance and a negative control substance;
wherein the one-step RT-PCR reaction solution comprises 10x buffer solution and Mg2+DTT, dNTPs, DNA polymerase, RNase inhibitor, UNG enzyme, RT enzyme;
the positive control is an RNA pseudovirus standard substance carrying mutation sites T19R, L452R, T478K and P681R of spinous process protein coding genes of Delta variant strains, and the negative control is DEPC water.
Preferably, the one-step RT-PCR reaction solution comprises 2x 10x buffer solution and 100 mu M Mg2+0.5nM DTT, 10. mu.M dNTPs, 2U DNA polymerase, 0.5U RNase inhibitor, 0.1U UNG enzyme, 0.2U RT enzyme.
The invention also provides a kit which comprises the 2019 novel coronavirus delta variant nucleic acid detection reagent provided by any technical scheme.
The invention also provides a 2019 novel coronavirus delta variant nucleic acid detection method, which adopts the detection reagent provided by any technical scheme for detection and comprises the following steps:
taking the extracted nucleic acid sample to be detected as a template, and simultaneously carrying out multiplex fluorescent quantitative PCR detection by using a positive reference substance, a negative reference substance and specific primers and probes respectively designed aiming at mutation sites of Delta variant spinous process protein coding genes T19R, L452R, T478K and P681R;
after the detection is finished, respectively adjusting the Start value and the End value of the base line of the FAM, the VIC, the CY5 and the ROX channel and the value of the threshold line according to the actual conditions, and obtaining the Ct values of the FAM, the VIC, the CY5 and the ROX channel based on the analysis result; and
and carrying out effectiveness interpretation and result interpretation according to the Ct value of each channel.
Preferably, the total volume of the reaction system for performing multiplex fluorescent quantitative PCR detection is 25 μ l, and the method specifically comprises the following steps:
one-step PCR reaction solution 12.5. mu.l, primer and probe mixture 5. mu.l at 1. mu.M, template/positive control/negative control 5. mu.l, and DEPC water 2.5. mu.l.
Preferably, the reaction conditions for performing multiplex fluorescent quantitative PCR detection are:
reverse transcription is carried out for 25min at 50 ℃; pre-denaturation at 95 ℃ for 2 min; denaturation at 95 ℃ for 10s, annealing and extension at 60 ℃ for 40s and fluorescence collection for 40 cycles.
Preferably, the Start value is set to 5 to 10, the End value is set to 10 to 15, and the amplification curve of the negative control is adjusted to be flat or lower than the threshold line.
Preferably, when the validity judgment is performed, the criteria judged to be valid are:
detection site Fluorescent channel Negative control Positive control
T19R FAM channel Ct value free Ct≤35
L452R VIC channel Ct value free Ct≤35
T478K CY5 channel Ct value free Ct≤35
P681R ROX channel Ct value free Ct≤35
。
Preferably, when the result is judged, the criteria for judging as positive or negative are:
positive interpretation: FAM channel CT less than or equal to 39 is positive for T19R mutation; the VIC channel CT less than or equal to 39 is positive for the L452R mutation; CT less than or equal to 39 of CY5 channel is positive for mutation of T478K; the ROX channel CT less than or equal to 39 is positive for P681R mutation; if the FAM, VIC, CY5 and ROX channels simultaneously meet the condition that CT is less than or equal to 39, the strain is judged to be a Delta variant strain;
negative interpretation: results other than the positive interpretation were all judged to be negative.
Preferably, the method further comprises a step of extracting a sample of nucleic acid to be detected using a nucleic acid extraction reagent before performing the multiplex quantitative PCR assay.
Preferably, the detection method has the sensitivity of 5 copies/mu L on mutation sites of T19R, L452R, T478K and P681R genes encoding the spinous process proteins of the Delta variants.
Compared with the prior art, the invention has the advantages and positive effects that:
the invention fully utilizes the advantages of high detection speed, high sensitivity and low cost of a fluorescent quantitative PCR platform, develops a novel nucleic acid detection method for 2019 novel coronavirus Delta variant strains, which is simple, quick, accurate and low in cost, overcomes the defects of long time consumption, high cost and complex operation process in the aspect of Delta variant strain typing detection in the prior art (NGS), meets the detection requirements of a large number of samples in clinic, and provides powerful technical support for epidemic prevention and control.
In the concrete implementation, the invention is based on the Delta variant spinous process protein coding genes T19R, L452R, T478K and P681R, and the mutation points are initiated and the specific amplification primers and probes are uniquely designed, the primers and the probes have good specificity and high sensitivity, and the 2019 novel coronavirus Delta variant can be efficiently and accurately identified; by combining the one-step RT-PCR reaction solution and the reaction system formula, RNA can be directly used as a template, and the PCR amplification efficiency is high, so that the detection sensitivity of a target sequence can be effectively improved.
Drawings
FIG. 1 shows the specific detection results of RNA pseudovirus simulation samples carrying mutation sites of T19R, L452R, T478K and P681R of spinous process protein coding genes of Delta variant strains by the multiplex fluorescence RT-PCR method established according to the present invention;
FIG. 2 is RNA quantitative analysis of T19R in RNA pseudovirus mock samples carrying four mutation sites by the multiplex fluorescent RT-PCR method established according to the present invention; wherein, the amplification curve of A, B, C, D sequentially represents the results of amplification detection of 1000, 20, 5 and 0 copies/. mu.l RNA pseudovirus simulated samples by adopting the amplification system;
FIG. 3 is the RNA quantitative analysis of L453R in a RNA pseudovirus mock sample carrying four mutation sites by the multiplex fluorescent RT-PCR method established according to the present invention; wherein, the amplification curve of A, B, C, D sequentially represents the results of amplification detection of 1000, 20, 5 and 0 copies/. mu.l RNA pseudovirus simulated samples by adopting the amplification system;
FIG. 4 shows RNA quantitative analysis of T478K in RNA pseudovirus mimic sample carrying four mutation sites by multiplex fluorescent RT-PCR method according to the present invention; wherein, the amplification curve of A, B, C, D sequentially represents the results of amplification detection of 1000, 20, 5 and 0 copies/. mu.l RNA pseudovirus simulated samples by adopting the amplification system;
FIG. 5 is RNA quantitative analysis of P681R in RNA pseudovirus mock sample carrying four mutation sites by the multiplex fluorescence RT-PCR method established according to the present invention; wherein, the amplification curve of A, B, C, D sequentially shows the results of amplification detection of 1000, 20, 5 and 0 copies/. mu.l RNA pseudovirus simulant samples by using the amplification system.
Detailed Description
Based on a fluorescent quantitative PCR detection platform, on the basis of an ARMS primer design method, specific primers and probes are designed aiming at T19R, L452R, T478K and P681R mutation sites of a spinous process protein coding gene of a Delta variant of SARS-CoV-2, and are used for identifying the mutation sites, so that whether the Delta variant is detected or not is judged.
In one embodiment, the 2019 novel coronavirus delta variant nucleic acid detection reagent provided by the invention comprises a primer, a probe, a one-step method RT-PCR reaction solution, a positive control and a negative control, wherein: (1) the RT-PCR reaction solution of the one-step method comprises 10x buffer and Mg2+DTT, dNTPs, DNA polymerase, rnase inhibitor, UNG enzyme, RT enzyme; (2) the positive control is RNA pseudovirus standard substance carrying mutations of Delta variant spinous process protein coding genes T19R, L452R, T478K and P681R; (3) the negative control was DEPC water.
In a preferred embodiment, the primer and probe sequences are shown in Table 1, and the one-step RT-PCR reaction solution is shown in Table 2.
TABLE 1 primer and Probe List
Figure BDA0003270675510000061
TABLE 2 one-step RT-PCR reaction solution formula
Name of reagent Concentration of
10x buffer 2x buffer
Mg2+ 100μM
DTT 0.5nM
dNTPs 10μM
DNA polymerase 2U
RNase inhibitors 0.5U
UNG enzyme 0.1U
RT enzymes 0.2U
In another preferred embodiment, the 2019 novel coronavirus delta variant nucleic acid detection method provided by the invention comprises the following steps:
(1) viral nucleic acid samples were extracted using commercial nucleic acid extraction reagents and then used directly for PCR detection.
(2) The extracted nucleic acid sample is used as a template, a positive control and a negative control are used at the same time, specific primers and probes of Delta variant spinous process protein coding gene mutation sites T19R, L452R, T478K and P681R are used for carrying out multiplex fluorescence quantitative PCR detection, a reaction system and a program are shown in tables 3-4, and an ABI 7500 is used as a detection instrument.
TABLE 3 reaction System
Name (R) Volume of
One-step PCR reaction solution 12.5μl
Primer and probe mixture (1. mu.M)*1 5μl
Template/positive control/negative control 5μl
DEPC water 2.5μl
*1: the primers and probes were diluted to the original concentrations to make one tube of mixture, where the final concentrations of each primer and probe were 1 μ M. For example, a primer or probe at an initial concentration of 100. mu.M is prepared in a primer-probe mixture having a volume of 1mL, wherein 10. mu.L of each of the primer and probe is added.
TABLE 4 reaction procedure
Figure BDA0003270675510000071
(3) Data processing: after the reaction is finished, adjusting the Start Value and the End Value of Baseline of FAM, VIC, CY5 and ROX channels and the Value of Threshold respectively according to actual conditions (the Start Value is recommended to be set at 5-10, the End Value is recommended to be set at 10-15, and simultaneously, the amplification curve of negative control is adjusted to be straight or lower than a Threshold line), clicking Analysis to obtain Analysis results, and obtaining Ct values of FAM, VIC, CY5 and ROX channels.
(4) And (3) judging the effectiveness: the detection results of the negative and positive control substances need to meet the requirements of the table 4, otherwise, the test result is invalid.
TABLE 5 negative and positive controls
Detection site Fluorescent channel Negative control Positive control
T19R FAM channel Ct value free Ct≤35
L452R VIC channel Ct value free Ct≤35
T478K CY5 channel Ct value free Ct≤35
P681R ROX channel Ct value free Ct≤35
(5) And (4) interpretation of results:
positive interpretation: FAM channel CT is less than or equal to 39, and T19R mutation is positive; VIC channel CT is less than or equal to 39, and L452R mutation is positive; CT of CY5 channel is less than or equal to 39, and mutation of T478K is positive; ROX channel CT is less than or equal to 39, and P681R is positive in mutation; if FAM, VIC, CY5 and ROX channels simultaneously satisfy CT less than or equal to 39, the strain is judged to be Delta variant.
Negative interpretation: results other than the positive interpretation were all judged to be negative.
Firstly, the invention adopts specific amplification primers and probes of Delta variant spinous process protein coding genes T19R, L452R, T478K and P681R mutation sites, the sequences of the primers and the probes are initiated, the design is unique, the specificity is good, the sensitivity is high, and the efficient and accurate identification of the 2019 novel coronavirus Delta variant can be realized. Secondly, the invention adopts a one-step RT-PCR reaction solution and a reaction system formula, the formula can directly use RNA as a template, the PCR amplification efficiency is high, and the detection sensitivity of the target sequence is effectively improved.
The technical solutions in the embodiments of the present invention will be clearly and completely described below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention. The reagents and biomaterials used below are all commercially available products unless otherwise specified.
Example 1: design of primers and probes
Specific primers and probes are respectively designed according to mutation sites of spinous process protein coding genes of 2019 novel coronavirus Delta variant strains, and the specific primers and the probes are respectively designed aiming at T19R, L452R, T478K and P681R mutation sites and can distinguish unmutated 2019 novel coronaviruses from other virus strains. Wherein, the specific primers and the probes are as follows:
primer F1(SEQ ID NO. 1): TCTCTAGTCAGTGTGTTAATCTTAGA
Primer R1(SEQ ID NO. 2): ATGGTAGGACAGGGTTATCAAACCTCT
Probe P1(FAM-SEQ ID NO. 3-BHQ):
FAM-ACGTGGTGTTTATTACCCTGACA-BHQ
primer F2(SEQ ID NO. 4): GTTGGTGGTAATTACAATTACCGG
Primer R2(SEQ ID NO. 5): TAAACCACTGAAGTTGAAATTGAC
Probe P2-1(VIC-SEQ ID NO. 6-BHQ):
VIC-GAGAGATATTTCAACTGAAATCT-BHQ
probe P2-2(CY5-SEQ ID NO. 7-BHQ):
CY5-CCGGTAGCAAACCTTGTAATGG-BHQ
primer F3(SEQ ID NO. 8): GACTCAGACTAATTCTCGTCG
Primer R3(SEQ ID NO. 9): CTAATAGTAAAATTTGTGGGTATGGC
Probe P3(ROX-SEQ ID NO. 10-BHQ):
ROX-TGTAGCTAGTCAATCCATCATTGC-BHQ
example 2: 2019 detection of nucleic acid of novel coronavirus delta variant
(1) Materials, reagents, instruments: the extraction reagent uses a magnetic bead method virus nucleic acid extraction reagent of Fengpo biological corporation, primers and probes (designed according to example 1) are synthesized by Shanghai Czeri bioengineering Inc., RNA pseudovirus is customized and synthesized by Weitusheng bioengineering (Shanghai) corporation, and the fluorescent quantitative PCR instrument adopts American Saimei ABI 7500.
(2) Preparation of a specimen: a positive specimen is an inactivated virus throat swab sample after a human is infected with the 2019 novel coronavirus delta variant strain; the negative control specimen is a pharyngeal swab sample of a healthy person. All the above samples are from a certain clinical unit.
(3) Nucleic acid extraction: and respectively extracting nucleic acids of the negative/positive specimen, the positive control substance and the negative control substance by using a magnetic bead method virus nucleic acid extraction kit, and then using the nucleic acids for PCR detection.
(4) And (3) PCR amplification:
a. primers and probes: the design and synthesis were performed as in example 1.
b. Positive control:
the positive control in the method is RNA pseudovirus carrying Delta variant spinous process protein coding genes T19R, L452R, T478K and P681R mutation, and DEPC water is used for 106And (4) diluting by times, and taking the diluted RNA pseudovirus as a positive control in the method.
c. One-step RT-PCR reaction platform:
the PCR reaction system (total volume 25. mu.l) included: one-step PCR reaction solution 12.5. mu.l, 1. mu.M primer and probe mixture 5. mu.l, template/positive control/negative control 5. mu.l and DEPC water 2.5. mu.l.
PCR amplification reaction conditions: reverse transcription is carried out for 25min at 50 ℃; pre-denaturation at 95 ℃ for 2 min; denaturation at 95 ℃ for 10s, annealing and extension at 60 ℃ for 40s (fluorescence collection), 40 cycles.
d. One-step RT-PCR reaction: and (3) performing multiplex fluorescent quantitative PCR detection by using the extracted nucleic acid sample as a template, using a positive control and a negative control, and using specific primers and probes of Delta variant spinous process protein coding gene mutation sites T19R, L452R, T478K and P681R.
e. Data processing: after the reaction is finished, adjusting the Start Value and the End Value of Baseline of FAM, VIC, CY5 and ROX channels and the Value of Threshold respectively according to actual conditions (the Start Value is recommended to be set at 5-10, the End Value is recommended to be set at 10-15, and simultaneously, the amplification curve of negative control is adjusted to be straight or lower than a Threshold line), clicking Analysis to obtain Analysis results, and obtaining Ct values of FAM, VIC, CY5 and ROX channels.
f. And (3) judging the effectiveness: the detection results of the negative and positive control substances need to meet the requirements of the table 4, otherwise, the test result is invalid.
g. And (4) interpretation of results:
positive interpretation: FAM channel CT is less than or equal to 39, and T19R mutation is positive; VIC channel CT is less than or equal to 39, and L452R mutation is positive; CT of CY5 channel is less than or equal to 39, and mutation of T478K is positive; ROX channel CT is less than or equal to 39, and P681R is positive in mutation; if the FAM, VIC, CY5 and ROX channels simultaneously meet the condition that CT is less than or equal to 39, the FAM, VIC, CY5 and ROX channels are judged to be Delta variant strains;
negative interpretation: results other than the positive interpretation were all judged to be negative.
(5) Results of specificity and sensitivity detection assays:
a. and (3) specific detection results:
RNA pseudovirus mock samples carrying T19R, L452R, T478K and P681R mutations, RNA pseudovirus mock samples of influenza A virus, RNA pseudovirus mock samples of influenza B virus, mycoplasma, human genome (293T cell line source) and negative samples (DEPC water) were tested by the above test methods, and the results of the specific tests are shown in FIG. 1.
As shown in figure 1, the multiplex fluorescence RT-PCR method established according to the invention has better specificity on mutation sites of T19R, L452R, T478K and P681R of spinous process protein coding genes of Delta variant strains, shows positive detection results of RNA pseudovirus simulation samples carrying the four mutation sites, and has no cross reaction on other pathogens, human genomes, blank controls (samples obtained by extracting nucleic acid by taking DEPC water as samples) and the like.
b. Sensitivity test results:
and (3) carrying out nucleic acid extraction on the RNA pseudovirus simulated sample carrying the four mutation sites by using a virus nucleic acid rapid extraction reagent, then measuring the RNA concentration by using a Qubit 4.0 instrument, and calculating the copy number of the sample according to a conversion formula in a customized RNA pseudovirus product specification so as to carry out RNA quantitative analysis. Then, the fluorescent probe is respectively diluted to 1000 copies/. mu.l, 20 copies/. mu.l, 5 copies/. mu.l and 0 copies/. mu.l, and the fluorescent probe is detected by the fluorescent RT-PCR method established by the invention. The results of the sensitivity measurements are shown in FIGS. 2-5. As shown in FIG. 2(T19R), FIG. 3(L453R), FIG. 4(T478K) and FIG. 5(P681R), the results show that the sensitivity of the mutation sites of T19R, L452R, T478K and P681R genes for detecting the spinous process protein coding genes of Delta variants by the fluorescence RT-PCR method reaches 5 copies/. mu.l.
Example 3: validation of clinical samples
(1) Materials, reagents, instruments: refer to example 2.
(2) Preparation of a specimen: inactivated virus pharyngeal swab samples of 10 suspected patients for clinical nucleic acid detection are collected as samples to be detected, meanwhile, inactivated virus pharyngeal swab samples of 1 suspected infected 2019 novel coronavirus delta variant strain are collected as positive reference substances, and pharyngeal swab samples of 5 healthy people are collected as negative reference substances. All the above samples are from a certain clinical unit.
(3) Nucleic acid extraction: and respectively extracting nucleic acids of the sample to be detected, the positive reference substance and the negative reference substance by using a magnetic bead method virus nucleic acid extraction kit, and then using the nucleic acids for PCR detection.
(4) And (3) PCR amplification: refer to example 2.
(5) Comparison reagent: the detection results of the clinical samples are verified by using a commercially available 2019 novel coronavirus nucleic acid detection reagent (Shanghai river Biotechnology GmbH, novel coronavirus 2019-nCoV nucleic acid detection kit (fluorescent PCR method), 25 persons/box and national institutes of record 20203400057) as a contrast reagent, and the detection results are further verified by a second-generation sequencing method (a new coronavirus sequencing project which is entrusted to a third-party medical inspection unit).
(6) And (3) detection results: as shown in Table 6, the test results of the test reagents developed by the present invention on clinical specimens completely coincided with the results of the commercially available contrast reagents and the second-generation sequencing. Wherein, the detection period of the second generation sequencing method is about two weeks, and the detection cost is 3000-4000 yuan/case; the detection period required by the detection method used by the invention is within one day, and the detection cost is lower than 50 Yuan/example.
Therefore, the nucleic acid detection reagent and the method for the 2019 novel coronavirus (SARS-CoV-2) Delta variant strain, which are developed by the invention, have accurate and reliable detection effects, not only make up the defect that the commercial 2019 novel coronavirus contrast reagent cannot identify the Delta variant strain, but also avoid the defects of long detection period, high cost and complex operation of second-generation sequencing.
TABLE 6 test results
Figure BDA0003270675510000121
Figure BDA0003270675510000131
Sequence listing
<110> Beijing Elelix medical science and technology Co., Ltd
<120> 2019 novel coronavirus delta variant nucleic acid detection reagent, kit and detection method
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 26
<212> RNA
<213> T19R Forward primer (Artificial sequence)
<400> 1
<210> 2
<211> 27
<212> RNA
<213> T19R reverse primer (Artificial sequence)
<400> 2
<210> 3
<211> 23
<212> RNA
<213> T19R Probe P1 (Artificial sequence)
<400> 3
<210> 4
<211> 24
<212> RNA
<213> L452R/T478K Forward primer (Artificial sequence)
<400> 4
<210> 5
<211> 24
<212> RNA
<213> L452R/T478K reverse primer (Artificial sequence)
<400> 5
<210> 6
<211> 23
<212> RNA
<213> L452R/T478K Probe P2-1 (Artificial sequence)
<400> 6
<210> 7
<211> 22
<212> RNA
<213> L452R/T478K Probe P2-2 (Artificial sequence)
<400> 7
<210> 8
<211> 21
<212> RNA
<213> P681R Forward primer (Artificial sequence)
<400> 8
<210> 9
<211> 26
<212> RNA
<213> P681R reverse primer (Artificial sequence)
<400> 9
<210> 10
<211> 24
<212> RNA
<213> P681R Probe P3 (Artificial sequence)
<400> 10

Claims (10)

1. The 2019 novel coronavirus delta variant nucleic acid detection reagent is characterized by comprising the following specific primers and probes which are respectively designed aiming at mutation sites of delta variant spinous process protein coding genes T19R, L452R, T478K and P681R:
Figure FDA0003270675500000011
2. the detection reagent according to claim 1, wherein the probe P1 is labeled with a reporter fluorescent dye FAM at the 5 'end and a reporter fluorescent dye BHQ at the 3' end; the 5 'end of the probe P2-1 is marked with a reporter fluorescent dye VIC, and the 3' end is marked with a reporter fluorescent dye BHQ; the 5 'end of the probe P2-2 is marked with a reporter fluorescent dye CY5, and the 3' end is marked with a reporter fluorescent dye BHQ; the 5 'end of the probe P3 is marked with a report fluorescent dye ROX, and the 3' end is marked with a report fluorescent dye BHQ.
3. The detection reagent according to claim 1 or 2, further comprising a one-step RT-PCR reaction solution, a positive control and a negative control;
wherein the one-step RT-PCR reaction solution comprises 10x buffer solution and Mg2+DTT, dNTPs, DNA polymerase, RNase inhibitor, UNG enzyme and RT enzyme;
the positive control is an RNA pseudovirus standard product carrying mutation sites T19R, L452R, T478K and P681R of spike protein coding genes of the delta variant, and the negative control is DEPC water.
4. The detection reagent of claim 3, wherein the one-step RT-PCR reaction solution comprises 2 X10 Xbuffer solution and 100 μ M Mg2+0.5nM DTT, 10. mu.M dNTPs, 2U DNA polymerase, 0.5U RNase inhibitor, 0.1U UNG enzyme, 0.2U RT enzyme.
5. A kit comprising the 2019 novel coronavirus delta variant nucleic acid detection reagent of any one of claims 1-4.
6. A2019 novel coronavirus delta variant nucleic acid detection method, which is characterized in that the detection is carried out by using the detection reagent of any one of claims 1-4, and comprises the following steps:
taking the extracted nucleic acid sample to be detected as a template, and simultaneously using a positive reference substance, a negative reference substance and specific primers and probes respectively designed aiming at mutation sites of T19R, L452R, T478K and P681R of spike protein coding genes of the delta variant strain to perform multiplex fluorescent quantitative PCR detection;
after the detection is finished, respectively adjusting the Start value and the End value of the base line of the FAM, the VIC, the CY5 and the ROX channel and the value of the threshold line according to the actual conditions, and obtaining the Ct values of the FAM, the VIC, the CY5 and the ROX channel based on the analysis result;
and carrying out effectiveness interpretation and result interpretation according to the Ct value of each channel.
7. The detection method according to claim 6, wherein the total volume of the reaction system for performing the multiplex quantitative PCR detection is 25. mu.l, and specifically comprises: one-step PCR reaction solution 12.5. mu.l, 1. mu.M primer and probe mixed solution 5. mu.l, template/positive control/negative control 5. mu.l and DEPC water 2.5. mu.l;
the reaction conditions for performing multiplex fluorescent quantitative PCR detection are as follows: reverse transcription is carried out for 25min at 50 ℃; pre-denaturation at 95 ℃ for 2 min; denaturation at 95 ℃ for 10s, annealing and extension at 60 ℃ for 40s and fluorescence collection for 40 cycles.
8. The detection method according to claim 6, wherein the Start value is set to 5 to 10, the End value is set to 10 to 15, and the amplification curve of the negative control is adjusted to be flat or lower than a threshold line;
when effectiveness judgment is carried out, the effective standard is as follows:
detection site Fluorescent channel Negative control Positive control T19R FAM channel Ct value free Ct≤35 L452R VIC channel Ct value free Ct≤35 T478K CY5 channel Ct value free Ct≤35 P681R ROX channel Ct value free Ct≤35
；
When result judgment is carried out, the criteria of judging as positive or negative are as follows:
positive interpretation: FAM channel CT less than or equal to 39 is positive for T19R mutation; the VIC channel CT less than or equal to 39 is positive for the L452R mutation; CT less than or equal to 39 of CY5 channel is positive for mutation of T478K; the ROX channel CT less than or equal to 39 is positive for P681R mutation; if the FAM, VIC, CY5 and ROX channels simultaneously meet the condition that CT is less than or equal to 39, the strain is judged to be a delta variant strain;
negative interpretation: results other than the positive interpretation were all judged to be negative.
9. The method of claim 6, further comprising the step of extracting the sample of nucleic acid to be tested using a nucleic acid extraction reagent before performing the multiplex quantitative fluorescence PCR assay.
10. The method according to claim 6, wherein the sensitivity of the method to the mutation sites of the T19R, L452R, T478K and P681R genes encoding the spinous process proteins of the delta variant strain is 5 copies/. mu.l.
CN202111112225.2A 2021-09-18 2021-09-18 2019 novel coronavirus delta variant nucleic acid detection reagent, kit and detection method Pending CN113774169A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111112225.2A CN113774169A (en) 2021-09-18 2021-09-18 2019 novel coronavirus delta variant nucleic acid detection reagent, kit and detection method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111112225.2A CN113774169A (en) 2021-09-18 2021-09-18 2019 novel coronavirus delta variant nucleic acid detection reagent, kit and detection method

Publications (1)

Publication Number Publication Date
CN113774169A true CN113774169A (en) 2021-12-10

Family

ID=78852724

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111112225.2A Pending CN113774169A (en) 2021-09-18 2021-09-18 2019 novel coronavirus delta variant nucleic acid detection reagent, kit and detection method

Country Status (1)

Country Link
CN (1) CN113774169A (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114369688A (en) * 2022-03-22 2022-04-19 深圳联合医学科技有限公司 Compositions, kits, methods and uses for detecting a variant of SARS-CoV-2 Oncuronte
CN115725794A (en) * 2022-10-28 2023-03-03 圣湘生物科技股份有限公司 Composition, method and application for combined detection of novel coronavirus and monkeypox virus
WO2024014734A1 (en) * 2022-07-12 2024-01-18 (주)제노텍 Qpcr method and kit having increased specificity and sensitivity
WO2024034796A1 (en) * 2022-08-12 2024-02-15 (주)제노텍 Qpcr method for detection of variant through simultaneous analysis of multiple targets

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111733293A (en) * 2020-07-24 2020-10-02 西南医科大学附属中医医院 Double-stranded primer probe, kit and multiplex PCR method for detecting SARS-COV-2
CN113215313A (en) * 2021-04-28 2021-08-06 山东莱博生物科技有限公司 Detection kit for coronavirus SARS-CoV-2 and mutant strain thereof and application thereof
CN113215164A (en) * 2021-06-21 2021-08-06 南方医科大学 Method for detecting novel coronavirus variant and subtype
CN113249525A (en) * 2021-06-25 2021-08-13 山西大学 qRT-PCR method for identifying novel coronavirus Indian variety
WO2021162183A1 (en) * 2020-02-11 2021-08-19 대한민국(국군의무사령부 사령관) Lamp composition for detecting 2019 novel coronavirus, and use thereof

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021162183A1 (en) * 2020-02-11 2021-08-19 대한민국(국군의무사령부 사령관) Lamp composition for detecting 2019 novel coronavirus, and use thereof
CN111733293A (en) * 2020-07-24 2020-10-02 西南医科大学附属中医医院 Double-stranded primer probe, kit and multiplex PCR method for detecting SARS-COV-2
CN113215313A (en) * 2021-04-28 2021-08-06 山东莱博生物科技有限公司 Detection kit for coronavirus SARS-CoV-2 and mutant strain thereof and application thereof
CN113215164A (en) * 2021-06-21 2021-08-06 南方医科大学 Method for detecting novel coronavirus variant and subtype
CN113249525A (en) * 2021-06-25 2021-08-13 山西大学 qRT-PCR method for identifying novel coronavirus Indian variety

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ALEJANDRO LOPEZ-RINCON 等: "Design of specific primer sets for the detection of SARS-CoV-2 variants of concern B. 1.1. 7, B. 1.351, P. 1, B. 1.617. 2 using artificial intelligence", BIORXIV, pages 4 - 5 *
JIANYING LIU 等: "BNT162b2-Elicited Neutralization of Delta Plus, Lambda, and Other Variants", BIORXIV, pages 13 - 14 *
VIJAY LAKSHMI JAMWAL 等: "Optimization and validation of RT-LAMP assay for diagnosis of SARS-CoV2 including the globally dominant Delta variant", VIROLOGY JOURNAL, vol. 18, no. 1, pages 1 - 14 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114369688A (en) * 2022-03-22 2022-04-19 深圳联合医学科技有限公司 Compositions, kits, methods and uses for detecting a variant of SARS-CoV-2 Oncuronte
WO2024014734A1 (en) * 2022-07-12 2024-01-18 (주)제노텍 Qpcr method and kit having increased specificity and sensitivity
WO2024034796A1 (en) * 2022-08-12 2024-02-15 (주)제노텍 Qpcr method for detection of variant through simultaneous analysis of multiple targets
CN115725794A (en) * 2022-10-28 2023-03-03 圣湘生物科技股份有限公司 Composition, method and application for combined detection of novel coronavirus and monkeypox virus
CN115725794B (en) * 2022-10-28 2024-02-02 圣湘生物科技股份有限公司 Compositions, methods and uses for novel coronavirus and monkey pox virus joint detection

Similar Documents

Publication Publication Date Title
CN111187856B (en) Cpf1 kit for rapid detection of new coronavirus nucleic acid and preparation method and application thereof
CN110982943B (en) Novel coronavirus RT-PCR detection method and kit
CN113774169A (en) 2019 novel coronavirus delta variant nucleic acid detection reagent, kit and detection method
CN110760617B (en) Real-time fluorescent PCR primer probe combination and kit for detecting African swine fever virus wild virus
CN113774168A (en) 2019 novel coronavirus, Deltay and lambda variant strain typing nucleic acid detection kit and detection method thereof
CN112981011B (en) Primer composition for detecting SARS-CoV-2 and its application
CN112538550B (en) RT-RPA and CRISPR/Cas-based DHAV-1 and DHAV-3 detection system and application
CN113817872A (en) 2019 novel coronavirus lambda variant nucleic acid detection reagent, kit and detection method
CN112063764A (en) Multiplex real-time fluorescent RT-PCR primer probe composition and kit for novel coronavirus nucleic acid detection
CN114107574A (en) Kit and method for detecting novel coronavirus and Omicron mutant strain thereof
CN111411173A (en) Novel coronavirus loop-mediated isothermal amplification rapid detection kit and use method thereof
CN109913591A (en) A type Sai Nika virus fluorescent quantitative RT-PCR detection method and kit based on TaqMan probe method
CN113652505A (en) Method and kit for detecting novel coronavirus and VOC-202012/01 mutant strain thereof
CN114107567A (en) Virus nucleic acid mutation detection method and application
CN113481325A (en) Method and kit for detecting novel coronavirus B.1.1.7 mutant strain
CN111471800B (en) Kit for detecting novel coronavirus and amplification primer composition thereof
CN113718045A (en) DNA fragment, primer, probe and kit for detecting 4 kinds of Bordetella pertussis and specifically detecting Bordetella pertussis and application
CN111676316B (en) Primer, probe and detection method for rapidly distinguishing African swine fever virus gene type II from other genotypes
CN113046477A (en) Specific crRNA for identifying D614G mutation site, system, kit and application
CN115786541B (en) SNP molecular marker, primer probe, kit, method and application for identifying Brucella vaccine strain A19
CN113755620B (en) Nucleic acid detection kit for rapidly detecting two leishmanias and application thereof
CN116042917A (en) Triple RT-PCR primer group for detecting porcine epidemic diarrhea, transmissible gastroenteritis and T-coronavirus and application thereof
CN112501321B (en) Method for molecular typing of mycobacterium tuberculosis
CN111455106B (en) Kit for detecting 2019 novel coronavirus nucleic acid
CN113481324A (en) Method and kit for detecting novel coronavirus and D614G mutant strain thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination