CN112981011B

CN112981011B - Primer composition for detecting SARS-CoV-2 and its application

Info

Publication number: CN112981011B
Application number: CN202110514745.XA
Authority: CN
Inventors: 陈佩璇; 郑焱; 丰晓威; 刘翔; 黄嫣丽; 盘璇; 卢炫廷; 吴玉莲; 盘耀亮
Original assignee: Beijing Kaipu Medical Laboratory Co ltd; Guangzhou Kaipu Pharmaceutical Technology Co ltd; Zhengzhou Kaipu Medical Laboratory LP; Hybribio Ltd
Current assignee: Beijing Kaipu Medical Laboratory Co ltd; Guangzhou Kaipu Pharmaceutical Technology Co ltd; Zhengzhou Kaipu Medical Laboratory LP; Hybribio Ltd
Priority date: 2021-05-12
Filing date: 2021-05-12
Publication date: 2021-08-17
Anticipated expiration: 2041-05-12
Also published as: CN112981011A

Abstract

The invention relates to a primer composition for detecting SARS-CoV-2 and application thereof. The primer composition comprises nucleic acid sequences shown in SEQ ID NO. 1-SEQ ID NO. 12. The primer composition is used for reverse transcription nested PCR, and Sanger sequencing is combined, so that SARS-CoV-2 gene information can be quickly and accurately obtained, SARS-CoV-2 can be quickly detected and SARS-CoV-2 mutant strain can be judged, and the primer composition has good accuracy, sensitivity, specificity and repeatability.

Description

Primer composition for detecting SARS-CoV-2 and its application

Technical Field

The invention belongs to the technical field of genetic engineering, and relates to a primer composition for detecting SARS-CoV-2 and application thereof.

Background

Coronaviruses belong to the order of nested viruses, the family of coronaviruses, the genus of coronaviruses, are RNA viruses with envelope and linear single-stranded positive strand genomes, and are a class of viruses widely existing in nature. Certain coronaviruses infect humans and cause diseases such as Middle East Respiratory Syndrome (MERS), Severe Acute Respiratory Syndrome (SARS), and pneumonia caused by SARS-CoV-2, the symptoms of which can range from the common cold to severe lung infections.

The pneumonia caused by SARS-CoV-2 is mainly manifested by fever, asthenia and dry cough. A few patients have nasal obstruction, watery nasal discharge, diarrhea, etc. SARS-CoV-2 is detected in suspected SARS case, suspected aggregate disease case, contact matter, etc. and proper measures are taken to identify the infection source and block epidemic propagation.

The SARS-CoV-2 genome is a complete single-stranded positive-strand RNA, about 30Kb in length. Genome annotation analysis of this virus using the orffnder tool on NCBI revealed a total of 14 open reading frames (with the ability to encode genes) in the SARS-CoV-2 genome, ORF1a, ORF1ab and 4 structural proteins: spike protein (S protein), membrane protein (M protein), envelope protein (E protein), nucleocapsid protein (N protein).

The occurrence of SARS-CoV-2 mutant is an inherent property of most RNA viruses, and has been reported, SARS-CoV-2 polymerase (proofreading polymerase) with proofreading function can make SARS-CoV-2 generate base substitution (substistutes) mutation with low probability, but SARS-CoV-2 is more susceptible to deletion (deletions) mutation, and this mutation is mostly generated in Repeated Deletion Regions (RDRs) of S protein, and as antibody recognition epitope, the deletion mutation of RDRs can cause the change of binding specificity of SARS-CoV-2 antibody, and make it generate antigen evolution (anti-genetic resolution), and further escape neutralizing antibody induced by SARS-CoV-2 before mutation.

At present, the method for detecting SARS-CoV-2 at home and abroad mainly focuses on two aspects of detection and sequencing technology (Sanger sequencing, NGS sequencing) based on target sequence PCR amplification, and the qualitative detection of SARS-CoV-2 nucleic acid mainly comprises reverse transcription and Real-time fluorescent quantitative PCR (Real-time PCR), wherein the fluorescent PCR technology is simple, rapid and sensitive, for example, CN111270021A discloses a primer pair, a probe, a composition, a kit and application for detecting novel coronavirus SARS-CoV-2, the fluorescent RT-RAA primer and the fluorescent probe can rapidly and qualitatively detect the novel coronavirus SARS-CoV-2 in a patient sample, but because the virus discovery time is short and the scientific cognition is insufficient, the genetic locus for differential diagnosis is not clinically verified on a large scale, false negative or false positive can exist, accuracy and analysis-specific risk.

In conclusion, the primer and the detection method for accurately detecting SARS-CoV-2 are provided, and the discovery of the new mutation site has important significance for the prevention and control of SARS-CoV-2.

Disclosure of Invention

Aiming at the defects and actual requirements of the prior art, the invention provides a primer composition for detecting SARS-CoV-2 and application thereof, the primer composition is utilized to carry out reverse transcription nested PCR, and is combined with sequencing, the SARS-CoV-2 gene information can be rapidly and accurately obtained, thereby rapidly detecting SARS-CoV-2 and judging SARS-CoV-2 mutant strains can be realized.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the invention provides a primer composition for detecting SARS-CoV-2, wherein the primer composition comprises a nucleic acid sequence shown by SEQ ID NO. 1-SEQ ID NO. 12.

SEQ ID No.1：CAGTGTGTTAATCTTACAACCAGAAC。

SEQ ID No.2：CAGACTTTAATAACAACATTAGTAGCGTT。

SEQ ID No.3：GAACAGGAAGAGAATCAGCAAC。

SEQ ID No.4：ACTCAGTAAGAACACCTGTGCCT。

SEQ ID No.5：GTTTCTGCCTTTCCAACAATTTGGC。

SEQ ID No.6：CTGCATTCAGTTGAATCACCAC。

SEQ ID No.7：TCTTTCACACGTGGTGTTTATTAC。

SEQ ID No.8：ACAATAAGTAGGGACTGGGTCTTC。

SEQ ID No.9：CTGTGTTGCTGATTATTCTGTCCTATAT。

SEQ ID No.10：AACCATTGAAGTTGAAATTGACAC。

SEQ ID No.11：GACATTGCTGACACTACTGATGCT。

SEQ ID No.12：CTGGTAGAATTTCTGTGGTAACACTAAT。

In the invention, when designing a primer composition, firstly, through evolutionary tree analysis, bat-SL-CoVZC45 virus which is closest to the affinity of SARS-CoV-2 is discovered, and secondly, SARS-CoV virus is discovered, in order to improve the amplification specificity, the selected target sequences have more than 5% of base difference with the bat-SL-CoVZC45 and SARS-CoV sequences, and through Blast comparison, no cross reaction with a human genome, a common human body or environmental microorganisms is ensured.

Thus, the primer composition of the present invention enables highly specific amplification against the S protein specific regions of SARS-CoV-2, g.21765_21770 del (p.HV 69_70del), g.A22812C (p.K417T), g.G22813C/T (p.K417N), g.G23012A (p.E484K), g.A23063T (p.501NY), g.A23403G (p.D614G) and g.C23604A (p.P681H).

Preferably, the primer composition further comprises an internal reference primer.

Preferably, the internal reference primer is a B2M internal reference primer.

Preferably, the B2M internal reference primer comprises the nucleic acid sequences shown as SEQ ID NO. 13 and SEQ ID NO. 14.

SEQ ID No.13：TCATGAGGAGTATGCAGACTCT。

SEQ ID No.14：TCCACATCTGTGGATTCAGCA。

In the invention, the internal reference primer can be used as an index for monitoring the extraction and reverse transcription processes.

In a second aspect, the invention provides the use of the primer composition for detecting SARS-CoV-2 of the first aspect in the preparation of a SARS-CoV-2 detection product.

In a third aspect, the present invention provides a kit for detecting SARS-CoV-2, the kit comprising the primer composition for detecting SARS-CoV-2 according to the first aspect.

Preferably, the kit further comprises a PCR reaction solution, a sequencing primer and a sequencing reagent.

Preferably, the PCR reaction solution comprises DNA polymerase and Mg²⁺Buffer, dNTPs and water.

Preferably, the PCR reaction solution further comprises reverse transcription amplification Mix, 10 XQIAGEN buffer and 5Q solution.

Preferably, the sequencing primer comprises the nucleic acid sequences shown as SEQ ID NO.7, SEQ ID NO. 9 and SEQ ID NO. 11.

Preferably, the Sequencing reagent comprises a BigDye Terminator v3.1 Cycle Sequencing Kit.

In a fourth aspect, the present invention provides a method of using the kit for detecting SARS-CoV-2 of the third aspect for the purpose of non-disease treatment and/or diagnosis, the method comprising:

taking nucleic acid in a sample as a template, performing reverse transcription nested PCR by using the primer composition for detecting SARS-CoV-2, sequencing the product of the reverse transcription nested PCR, and analyzing the sequencing result.

In the invention, the primer composition can be used for carrying out highly specific reverse transcription nested PCR on SARS-CoV-2, sequencing the product of the reverse transcription nested PCR, and accurately acquiring SARS-CoV-2 gene information, thereby carrying out SARS-CoV-2 detection and mutant strain analysis.

In the present invention, the sample may be a human body sample, or may be an environmental sample such as a contact product or food.

Preferably, the nested reverse transcription PCR comprises a one-step nested reverse transcription PCR.

Preferably, the sequencing comprises Sanger sequencing.

In the invention, the SARS-CoV-2 nucleic acid sequence is obtained by using Sanger sequencing method, the sequence of DNA can be directly read, the sequencing length is long, and new variation sites can be found, including new and rare mutation forms and exact types of mutation, such as point mutation, fragment deletion and the like.

Preferably, the one-step reverse transcription nested PCR comprises a first round of amplification and a second round of amplification.

Preferably, the primers for the first round of amplification comprise nucleic acid sequences shown as SEQ ID NO. 1-6, SEQ ID NO. 13 and SEQ ID NO. 14.

Preferably, the reaction system of the first round of amplification is shown in table 1, wherein the mixed enzyme comprises hot start Taq enzyme, reverse transcriptase and UNG enzyme.

TABLE 1

Preferably, the procedure for the first round of amplification is as shown in table 2.

TABLE 2

Preferably, the primers for the second round of amplification comprise nucleic acid sequences shown as SEQ ID NO 7-12, SEQ ID NO 13 and SEQ ID NO 14.

Preferably, the reaction system of the second round of amplification is shown in table 3.

TABLE 3

Preferably, the procedure for the second round of amplification is as shown in table 4.

TABLE 4

Preferably, the primer mapping is shown in table 5.

TABLE 5

Preferably, the method further comprises the step of recovering the amplification product;

preferably, the method of recovering the amplification product comprises recovering the amplification product by agarose gel electrophoresis.

Preferably, the mass percent of the agarose gel is 1-3% (w/w).

Preferably, the voltage of electrophoresis is 80-120V.

Preferably, the electrophoresis time is 15-25 min.

Preferably, the Sanger sequencing comprises:

and (3) performing sequencing PCR by using a BigDye Terminator kit, purifying a sequencing PCR product by using alcohol, adding Hi-Di formamide, loading, setting according to the instrument instruction of ABI 3500XL Dx to start a running program, and performing result analysis after unloading.

As a preferred technical scheme, the using method of the kit for detecting SARS-CoV-2 for the purpose of non-disease treatment and/or diagnosis comprises the following steps:

(1) extracting nucleic acid in the sample;

(2) taking nucleic acid in a sample as a template, and using primers shown in SEQ ID NO. 1-6, SEQ ID NO. 13 and SEQ ID NO. 14 to amplify the nucleic acid by an amplification program: at the temperature of 53-57 ℃, 14-16 min; 93-96 ℃ and 28-32 sec; 93-96 ℃, 9-11 sec, 58-62 ℃, 58-62 sec, and 13-17 cycles; performing first amplification at 36-40 ℃ for 28-32 sec, performing electrophoresis at 80-120V for 15-25 min by using 1-3% (w/w) agarose gel, and recovering a first amplification product;

(3) taking the first round amplification product as a template, and using primers shown in SEQ ID NO 7-12, SEQ ID NO 13 and SEQ ID NO 14 according to an amplification program: at the temperature of 93-97 ℃, 14-16 min; 93-95 ℃, 28-32 sec, 58-62 ℃, 58-62 sec, 70-74 ℃, 58-62 sec, 33-37 cycles; at 70-74 ℃, for 9-11 min; performing second-round amplification at 36-40 ℃ for 28-32 sec, performing electrophoresis for 15-25 min at 80-120V by using 1-3% (w/w) agarose gel, and recovering a second-round amplification product;

(4) and performing Sanger sequencing on the second round amplification products by using sequencing primers shown in SEQ ID NO.7, SEQ ID NO. 9 and SEQ ID NO. 11, and analyzing the sequencing result.

Compared with the prior art, the invention has the following beneficial effects:

(1) the primer composition has high specificity, and can carry out high-specificity reverse transcription nested PCR aiming at the specific region of the S protein of SARS-CoV-2;

(2) the primer composition is used for reverse transcription nested PCR, and Sanger sequencing is combined, so that SARS-CoV-2 gene information can be quickly and accurately obtained, SARS-CoV-2 can be quickly detected and SARS-CoV-2 mutant strain can be judged, and the primer composition has good accuracy, sensitivity, specificity and repeatability.

Drawings

FIG. 1 is a diagram of agarose gel electrophoresis of a second round of amplification products in example 2;

FIG. 2 is a graph showing the sequencing results of the amplification product No.1 in example 2, in which the rectangular mark indicates the mutation start position, and g.21765-21770 del (p.HV 69-70 del) is mutated;

FIG. 3 is a graph showing the sequencing results of the amplification product No. 2 in example 2, in which the rectangle labeled is a mutation region, and g.G22813T (p.K417N) is mutated;

FIG. 4 is a graph showing the sequencing result of the amplification product No. 2 in example 2, in which the rectangle marks are mutation regions and g.G23012A (p.E 484K) has no mutation;

FIG. 5 is a graph showing the sequencing result of the amplification product No. 2 in example 2, in which the rectangle marks are mutation regions and g.A23063T (p.N 501Y) has no mutation;

FIG. 6 is a graph showing the sequencing results of the amplification product No. 3 in example 2, in which the rectangle labeled is the mutation region, g.A23403G (p.D 614G) mutation;

FIG. 7 is a graph showing the sequencing results of the amplification product No. 3 in example 2, in which the rectangle marked is a mutation region and g.C23604A (p.P 681H) has no mutation;

FIG. 8 is an agarose gel electrophoresis of the second round amplification product of example 3;

FIG. 9 is a graph showing the sequencing results of the amplification product No.1 in example 3, in which the rectangular mark indicates the mutation start position, and g.21765-21770 del (p.HV 69-70 del) is mutated;

FIG. 10 is a graph showing the results of sequencing of the amplification product No. 2 in example 3, in which the rectangle labeled is a mutation region, and g.G22813T (p.K417N) is mutated;

FIG. 11 is a graph showing the sequencing results of the amplification product No. 2 in example 3, in which the rectangle marks are mutation regions, and g.G23012A (p.E 484K) is mutated;

FIG. 12 is a graph showing the sequencing results of the amplification product No. 2 in example 3, in which the rectangle marks are mutation regions and g.A23063T (p.N 501Y) has no mutation;

FIG. 13 is a graph showing the sequencing results of the amplification product No. 3 in example 3, in which the rectangle marks the mutation region and g.A23403G (p.D 614G) has no mutation;

FIG. 14 is a graph showing the sequencing results of the amplification product No. 3 in example 3, in which the rectangle labeled is a mutation region and g.C23604A (p.P 681H) has no mutation.

Detailed Description

To further illustrate the technical means adopted by the present invention and the effects thereof, the present invention is further described below with reference to the embodiments and the accompanying drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting of the invention.

The examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The reagents or apparatus used are conventional products commercially available from normal sources, not indicated by the manufacturer.

Example 1

The embodiment provides a SARS-CoV-2 detection kit and a use method thereof, the kit comprises a primer composition shown in SEQ ID No. 1-12, a sequencing primer shown in SEQ ID No.7, SEQ ID No. 9, and SEQ ID No. 11, a reagent for PCR reaction and a reagent for Sanger sequencing, wherein the reagent for PCR reaction comprises a reverse transcription amplification Mix of Bordetella, a mixed enzyme of Bordetella (including hot start Taq enzyme, reverse transcriptase and UNG enzyme), 10 xbuffer of QIAGEN, 5Q solution of QIAGEN, and 25 mM Mg of QIAGEN²⁺25 mM dNTPs and H for QIAGEN₂O, Sanger Sequencing reagent for Sammerfer BigDye Terminator v3.1 Cycle Sequencing Kit (including: BigDye, 5 x seq Buffer).

The using method comprises the following steps:

(1) collecting nasopharyngeal swab samples;

(2) extracting nucleic acid by a magnetic bead method;

(3) carrying out amplification reaction by using a primer combination with a nucleotide sequence shown as SEQ ID No. 1-12,

the first round of amplification reaction system is 30 μ L, Primers are formed by mixing the primer combinations shown in SEQ ID Nos. 1-6, and the reaction system is shown in Table 6.

TABLE 6

The first round amplification reaction procedure is shown in table 7.

TABLE 7

The second round of amplification reaction was performed in a system of 50. mu.L, Primers was the primer set shown in SEQ ID Nos. 7 to 12, and the reaction system is shown in Table 8.

TABLE 8

The second round amplification reaction procedure is shown in table 9.

TABLE 9

(3) Agarose gel electrophoresis and recovery of amplification products

Performing electrophoresis with 2% (w/w) agarose gel under 100V for 20 min, and recovering amplification product with centrifugal column type common agarose gel DNA recovery kit (Tiangen, Cat number DP 209-03);

(4) sanger sequencing

And (3) performing Sanger sequencing by using sequencing primers with nucleotide sequences shown in SEQ ID No.7, 9 and 11 by using the second round amplification product as a template, performing sequencing PCR by using a BigDye Terminator kit, purifying the sequencing PCR product by using alcohol, adding Hi-Di formamide, loading, setting according to the instrument instruction of ABI 3500XL Dx to start a running program, and performing result analysis after unloading.

The sequencing PCR reaction system was 10. mu.L, and the specific system is shown in Table 10.

Watch 10

Composition of	Volume (μ L)
		BigDye	0.5
5×seq Buffer	1.75
		Primer and method for producing the same	1
Form panel	1
		Water (W)	Make up to 10

The procedure for sequencing the PCR reaction is shown in table 11.

TABLE 11

Example 2

In this example, SARS-CoV-2 (sample origin: remaining nucleic acid sample from human specimen examined by Karpu medical examination) was detected using the kit and the method described in example 1, and specifically, SARS-CoV-2S protein gene mutations g.21765_21770 del (p.HV 69_70del), g.A22812C (p.K417T), g.G22813C/T (p.K417N), g.G23012A (p.E484K), g.A23063T (p.N501Y), g.A23403G (p.D614G) and g.C23604A (p.681PH).

As shown in Table 5, the primers for the first and second rounds of amplification, in which the SEQ ID NOS: 1 and 2 and the SEQ ID NOS: 7 and 8 are g.21765-21770 del (p.HV 69-70 del) segments, respectively, were first subjected to the first round of amplification using the primers shown in SEQ ID NOS: 1 and 2 and second round of amplification using the primers shown in SEQ ID NOS: 7 and 8 to obtain amplification product No.1, and similarly, the primers shown in SEQ ID NOS: 3 and 4 were subjected to the first round of amplification and the primers shown in SEQ ID NOS: 9 and 10 were subjected to the second round of amplification to obtain amplification product No. 2; first amplification is carried out by using primers shown in SEQ ID NO. 5 and 6, second amplification is carried out by using primers shown in SEQ ID NO. 11 and 12 to obtain amplification product No. 3, agarose gel electrophoresis is carried out, the result is shown in figure 1, the left first lane is DNA marker (the band sizes are 1000 bp, 700 bp, 500 bp, 400 bp, 300 bp, 200 bp and 100 bp from top to bottom respectively), the left second lane 2-5 is amplification product No. 1-3 and internal reference amplification product respectively, each amplification product is recovered and subjected to Sanger sequencing, and the result is shown in figure 2-7, and the sample detection results are g.21765_21770 del (p.HV 69_70del), g.G22813T (p.K417N) and g.a23403G (p.D 35614) mutation.

Example 3

In this example, SARS-CoV-2 (sample origin: RNA sample of pseudovirus, pseudovirus purchased from Ehryssinica Biotechnology Co., Ltd., Guangzhou) was detected using the kit and the method described in example 1, and specifically SARS-CoV-2S protein gene mutations g.21765_21770 del (p.HV 69_70del), g.A22812C (p.K417T), g.G22813C/T (p.K417N), g.G23012A (p.E482304K), g.A63T (p.N501Y), g.A23403G (p.D614G) and g.C23604A (p.P681H).

As shown in Table 5, the primers for the first and second rounds of amplification, in which the SEQ ID NOS: 1 and 2 and the SEQ ID NOS: 7 and 8 are g.21765-21770 del (p.HV 69-70 del) segments, respectively, were first subjected to the first round of amplification using the primers shown in SEQ ID NOS: 1 and 2 and second round of amplification using the primers shown in SEQ ID NOS: 7 and 8 to obtain amplification product No.1, and similarly, the primers shown in SEQ ID NOS: 3 and 4 were subjected to the first round of amplification and the primers shown in SEQ ID NOS: 9 and 10 were subjected to the second round of amplification to obtain amplification product No. 2; first round amplification is carried out by using primers shown in SEQ ID NO 5 and 6, second round amplification is carried out by using primers shown in SEQ ID NO 11 and 12, and amplification product No. 3 is obtained, agarose gel electrophoresis is carried out, the result is shown in FIG. 8, the left first lane is DNA marker (the band sizes are 1000 bp, 700 bp, 500 bp, 400 bp, 300 bp, 200 bp and 100 bp from top to bottom respectively), the left second lane 2-5 is amplification product No. 1-3 and internal reference amplification product respectively, each amplification product is recovered and subjected to Sanger sequencing, and the result is shown in FIG. 9-FIG. 14, and the sample detection result is g.21765_21770 del (p.HV 69_70del), g.G22817T (p.K417N) and g.G12302A (p.E484K) mutation.

Example 4

In this example, the kit and the method of use described in example 1 were used to detect SARS-CoV-2 sample under known mutation conditions, so as to verify the performance of the detection kit and the method of use of the present invention, and the verification performance is divided into four parts: accuracy verification, sensitivity and specificity verification, minimum detection quantity verification and repeatability verification.

The accuracy verification results are shown in table 12.

TABLE 12

The results of the sensitivity detection are shown in Table 13.

Watch 13

The results of the specific detection are shown in Table 14.

TABLE 14

The minimum detection amount detection results are shown in table 15.

Watch 15

The results of the repetitive measurements are shown in tables 16 and 17.

TABLE 16

TABLE 17

In conclusion, the primer composition has high specificity, can perform high-specificity reverse transcription nested PCR aiming at the specific region of the S protein of SARS-CoV-2, and can rapidly and accurately acquire SARS-CoV-2 gene information by performing reverse transcription nested PCR by using the primer composition and combining Sanger sequencing, thereby rapidly detecting SARS-CoV-2 and judging SARS-CoV-2 mutant strains, and having good accuracy, sensitivity, specificity and repeatability.

The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.

SEQUENCE LISTING

<110> Guangdong Kappan Biotechnology GmbH, Beijing Kappan medical laboratory GmbH, Zhengzhou Kappan medical laboratory GmbH (Limited partnership), Guangzhou Kappan medical science and technology GmbH

<120> primer composition for detecting SARS-CoV-2 and its application

<130> 20210428

<160> 14

<170> PatentIn version 3.3

<210> 1

<211> 26

<212> DNA

<213> Artificial sequence

<400> 1

cagtgtgtta atcttacaac cagaac 26

<210> 2

<211> 29

<212> DNA

<213> Artificial sequence

<400> 2

cagactttaa taacaacatt agtagcgtt 29

<210> 3

<211> 22

<212> DNA

<213> Artificial sequence

<400> 3

gaacaggaag agaatcagca ac 22

<210> 4

<211> 23

<212> DNA

<213> Artificial sequence

<400> 4

actcagtaag aacacctgtg cct 23

<210> 5

<211> 25

<212> DNA

<213> Artificial sequence

<400> 5

gtttctgcct ttccaacaat ttggc 25

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence

<400> 6

ctgcattcag ttgaatcacc ac 22

<210> 7

<211> 24

<212> DNA

<213> Artificial sequence

<400> 7

tctttcacac gtggtgttta ttac 24

<210> 8

<211> 24

<212> DNA

<213> Artificial sequence

<400> 8

acaataagta gggactgggt cttc 24

<210> 9

<211> 28

<212> DNA

<213> Artificial sequence

<400> 9

ctgtgttgct gattattctg tcctatat 28

<210> 10

<211> 24

<212> DNA

<213> Artificial sequence

<400> 10

aaccattgaa gttgaaattg acac 24

<210> 11

<211> 24

<212> DNA

<213> Artificial sequence

<400> 11

gacattgctg acactactga tgct 24

<210> 12

<211> 28

<212> DNA

<213> Artificial sequence

<400> 12

ctggtagaat ttctgtggta acactaat 28

<210> 13

<211> 22

<212> DNA

<213> Artificial sequence

<400> 13

tcatgaggag tatgcagact ct 22

<210> 14

<211> 21

<212> DNA

<213> Artificial sequence

<400> 14

tccacatctg tggattcagc a 21

Claims

1. A primer composition for detecting SARS-CoV-2 is characterized in that the primer composition comprises a nucleic acid sequence shown by SEQ ID NO. 1-SEQ ID NO. 12.

2. The primer composition of claim 1, wherein the primer composition further comprises an internal reference primer.

3. The primer composition of claim 2, wherein the reference primer is B2M, and the B2M reference primer comprises the nucleic acid sequences shown as SEQ ID NO. 13 and SEQ ID NO. 14.

4. Use of the primer composition for detecting SARS-CoV-2 as claimed in any of claims 1 to 3 in the preparation of SARS-CoV-2 detection product.

5. A kit for detecting SARS-CoV-2, comprising the primer composition for detecting SARS-CoV-2 according to any one of claims 1 to 3.

6. The kit of claim 5, wherein the kit further comprises PCR reaction solution, sequencing primers and sequencing reagents.

7. The kit according to claim 6, wherein the PCR reaction solution comprises DNA polymerase, Mg²⁺Buffer, dNTPs and water.

8. The kit of claim 6, wherein the sequencing primer comprises the nucleic acid sequences shown in SEQ ID NO 7, SEQ ID NO 9 and SEQ ID NO 11.

9. A method of using the kit for detecting SARS-CoV-2 according to any one of claims 5 to 8 for non-disease treatment and/or diagnosis purposes, the method comprising:

performing reverse transcription nested PCR using nucleic acid in a sample as a template and the primer composition for detecting SARS-CoV-2 according to any one of claims 1 to 3, sequencing the product of the reverse transcription nested PCR, and analyzing the sequencing result.

10. The method of claim 9, wherein the nested reverse transcription PCR comprises a one-step nested reverse transcription PCR.

11. The method of claim 9, wherein the sequencing comprises Sanger sequencing.

12. The method of claim 10, wherein the one-step reverse transcription nested PCR comprises a first round of amplification and a second round of amplification.

13. The method of claim 12, wherein the primers for the first round of amplification comprise nucleic acid sequences shown as SEQ ID NO 1-6, SEQ ID NO 13 and SEQ ID NO 14.

14. The method of claim 12, wherein the first round of amplification comprises:

53~57℃，14~16 min；

93~96℃，28~32 sec；

93-96 ℃, 9-11 sec, 58-62 ℃, 58-62 sec, and 13-17 cycles;

36~40℃，28~32 sec。

15. the method of claim 12, wherein the primers for the second round of amplification comprise the nucleic acid sequences shown in SEQ ID NO.7-12, SEQ ID NO. 13 and SEQ ID NO. 14.

16. The method of claim 12, wherein the second round of amplification comprises:

93~97℃，14~16 min；

93-95 ℃, 28-32 sec, 58-62 ℃, 58-62 sec, 70-74 ℃, 58-62 sec, 33-37 cycles;

70~74℃，9~11 min；

36~40℃，28~32 sec。

17. method according to any of claims 9-16, characterized in that the method comprises the steps of:

(1) extracting nucleic acid in the sample;

(2) taking nucleic acid in a sample as a template, and using primers shown in SEQ ID NO. 1-6, SEQ ID NO. 13 and SEQ ID NO. 14 to amplify the nucleic acid by an amplification program: at the temperature of 53-57 ℃, 14-16 min; 93-96 ℃ and 28-32 sec; 93-96 ℃, 9-11 sec, 58-62 ℃, 58-62 sec, and 13-17 cycles; performing a first amplification cycle at 36-40 ℃ for 28-32 sec;

(3) taking the first round amplification product as a template, and using primers shown in SEQ ID NO 7-12, SEQ ID NO 13 and SEQ ID NO 14 to perform amplification according to an amplification program: at the temperature of 93-97 ℃, 14-16 min; 93-95 ℃, 28-32 sec, 58-62 ℃, 58-62 sec, 70-74 ℃, 58-62 sec, 33-37 cycles; at 70-74 ℃, for 9-11 min; performing a second amplification cycle at 36-40 ℃ for 28-32 sec;

(4) the sequencing primers shown in SEQ ID NO 7, SEQ ID NO 9 and SEQ ID NO 11 were used to perform Sanger sequencing on the second round amplification products, and the sequencing results were analyzed.