CN115873991B

CN115873991B - Block crRNA, function enabling crRNA to switch and control binding with Cas12a and function verification method thereof

Info

Publication number: CN115873991B
Application number: CN202211361670.7A
Authority: CN
Inventors: 刘光中; 孙文龙; 李凌云; 郭振伟; 韩啸
Original assignee: Zhongchuang Kerui Beijing Biotechnology Co ltd
Current assignee: Zhongchuang Kerui Beijing Biotechnology Co ltd
Priority date: 2022-11-02
Filing date: 2022-11-02
Publication date: 2024-03-01
Anticipated expiration: 2042-11-02
Also published as: CN115873991A

Abstract

The invention discloses a block crRNA, a function for enabling the crRNA to switch and control the combination with Cas12a and a function verification method thereof, and simultaneously discloses 6 crRNA sequences of HPV 16, which can improve the sensitivity of CRISPR detection when used in combination. The block crRNA is formed by designing a complementary sequence of the crRNA and introducing a single-stranded DNA sequence, so that the block crRNA capable of being controlled by a switch is assembled; when the target DNA is not detected, the function of combining the block crRNA with the Cas12a can be lost, so that background is reduced; when the target DNA is detected, the crRNA in the block crRNA is released, and the crRNA, the DNA matched with the block crRNA in the system and the Case12a are assembled into a shearing compound, so that self-circulation shearing replication is formed, secondary signal amplification is realized, and the sensitivity is improved.

Description

Block crRNA, function enabling crRNA to switch and control binding with Cas12a and function verification method thereof

Technical Field

The invention relates to the technical field of gene detection, in particular to 6 crRNA sequences of HPV 16, which can improve the sensitivity of CRISPR detection and block crRNA when used in combination, and can switch and control the function combined with Cas12a and a function verification method thereof.

Background

Human papillomaviruses (Human Papilloma Virus, HPV) can be classified into low-risk and high-risk subtypes according to their harmfulness, and in most cancers associated with HPV, the high-risk HPV subtypes HPV16 and HPV18 play a major role in the occurrence of precancerous lesions. In order to rapidly identify the virus infected person and to block the transmission chain of the virus in time, development of a method capable of rapidly and accurately detecting the virus is urgently required. The most common current virus detection method is based on real-time fluorescent quantitative PCR (Quantitative Real Time-PCR, RT-qPCR) detection technology. RT-qPCR is used for detecting RNA viruses, and the method has high sensitivity, but long time consumption and high requirements on instruments and equipment and personnel quality. Thus, in the face of special sites such as basic clinics and homes, RT-PCR cannot meet the Point-of-Care test (POCT) requirements.

The information disclosed in this background section is only for enhancement of understanding of the general background of the invention and should not be taken as an acknowledgement or any form of suggestion that this information forms the prior art already known to a person of ordinary skill in the art.

Disclosure of Invention

The invention aims to provide a block crRNA, a function for enabling the crRNA to be controlled to be combined with Cas12a in a switching mode and a function verification method thereof, which can solve the problem that RT-PCR (reverse transcription-polymerase chain reaction) in special places such as basic clinics, families and the like cannot meet the requirement of instant detection.

To achieve the above object, the present invention provides a block crRNA targeting 6 crRNA sequences of HPV16 DNA, the sequences of the block crrnas being:

Block crRNA-1：

ccccgatatgcaccaccgggTTTTTTAATTTCTACTAAGTGTAGATcccggtggtgcatatcgggg(SEQ ID NO.2)；

Block crRNA-2：

ccccgatatgcaccaccgggTAATTTCTACTAAGTGTAGATcccggtggtgcatatcgggg(SEQ ID NO.3)；

Block crRNA-3：

ccccgauaugcaccaccgggTTATTUAAUUUCUACUAAGUGUAGAUcccgguggugcauaucgggg(SEQ ID NO.4)；

Block crRNA-4：

ccccgauaugcaccaccgggTTTTTUAAUUUCUACUAAGUGUAGAUcccgguggugcauaucgggg(SEQ ID NO.5)；

Block crRNA-5：

ccccgatatgcaccaccgggTTTTTUAAUUUCUACUAAGUGUAGAUcccgguggu gcauaucgggg(SEQ ID NO.6)；

Block crRNA-6：

ccccgatatgcaccaccgggTTATTUAAUUUCUACUAAGUGUAGAUcccgguggu gcauaucgggg(SEQ ID NO.7)。

preferably, the 6 crRNA sequences are respectively

HPV16 crRNA-1, including HPV16 crRNA-1-F:

TAATACGACTCACTATAGGGTAATTTCTACTAAGTGTAGATGAATACATTTACCTGACCCC (SEQ ID NO. 21), and

HPV16 crRNA-1-R：

GGGGTCAGGTAAATGTATTCATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTA(SEQ ID NO.22)；

HPV16 crRNA-2, including HPV16 crRNA-2-F:

TAATACGACTCACTATAGGGTAATTTCTACTAAGTGTAGATTAATCCAGATACACAGCGGC (SEQ ID NO. 23), and

HPV16 crRNA-2-R：

GCCGCTGTGTATCTGGATTAATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTA(SEQ ID NO.24)；

HPV16 crRNA-3, including HPV16 crRNA-3-F:

TAATACGACTCACTATAGGGTAATTTCTACTAAGTGTAGATTTAAATAAATTGGATGACAC (SEQ ID NO. 25), and

HPV16 crRNA-3-R：

GTGTCATCCAATTTATTTAAATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTA(SEQ ID NO.26)；

HPV16 crRNA-4, including HPV16 crRNA-4-F:

TAATACGACTCACTATAGGGTAATTTCTACTAAGTGTAGATGTGCTATGGACTTTACTACA (SEQ ID NO. 27), and

HPV16 crRNA-4-R：

TGTAGTAAAGTCCATAGCACATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTA(SEQ ID NO.28)；

HPV16 crRNA-5, including HPV16 crRNA-5-F:

TAATACGACTCACTATAGGGTAATTTCTACTAAGTGTAGATTTAACTCTAATGGTGGACAA (SEQ ID NO. 29), and

HPV16 crRNA-5-R：

TTGTCCACCATTAGAGTTAAATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTA(SEQ ID NO.30)；

HPV16 crRNA-6, including HPV16 crRNA-6-F:

TAATACGACTACTATAGGGTAATTTCTACTAAGTGTAGATATTGGTTGCAAACCACCTATA (SEQ ID NO. 31), and

HPV16 crRNA-6-R：

TATAGGTGGTTTGCAACCAATATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTA(SEQ ID NO.32)。

the invention also provides a block crRNA as described above that enables the crRNA to switch control the function of binding to Cas12 a.

The invention also provides a verification method for enabling the crRNA to switch and control the function combined with the Cas12a by the block crRNA, which comprises the following steps:

S1, designing a plurality of crRNAs of different regions of HPV16 DNA capable of being targeted, and synthesizing a plurality of different crRNA sequences;

s2, performing in-vitro transcription and purification on the crRNA obtained in the step S1 to obtain purified crRNA;

s3, CRISPR/Cas12a mediated nucleic acid detection, namely assembling Cas12a with the purified crRNAs in a plurality of different areas in the step S2, performing CRISPR nucleic acid detection, and selecting an FQ fluorescent probe, wherein the sequence of the FQ fluorescent probe is FAM-TTATT-BHQ1 (SEQ ID NO. 33), and screening crRNAs capable of generating strong fluorescence;

s4, sensitivity detection, namely diluting pUC57-HPV16 plasmids into different copy numbers to serve as an activation template, and performing CRISPR nucleic acid detection in a crRNA and Cas12a assembly system, and measuring fluorescence intensity by using an enzyme-labeled instrument to obtain sensitivity.

Further, the method also comprises the following steps:

s5, lbCAs12a detection, namely preparing an LbCAs12a detection system, adding the crRNA, assembling at room temperature, reacting at 37 ℃, placing in a 485nm blue light glue instrument, photographing, and observing fluorescence change;

s6, specifically identifying LbCAs12a detection, respectively assembling HPV16 crRNA, HPV18 crRNA and LbCAs12a300nM in vitro to obtain an assembled product, mixing the assembled product with a pUC57-HPV18 activation template, reacting at 37 ℃, and measuring a fluorescence value by using a blue-light photographing or enzyme-labeling instrument;

S7, isothermal amplification mediated CRISPR nucleic acid detection, designing a primer, performing isothermal amplification screening to obtain isothermal amplification products, assembling crRNA and LbCAs12a, and performing CRISPR nucleic acid detection by taking the isothermal amplification products as templates.

Preferably, the primer in step S7 includes:

HPV16 RPA-F1：GAATGTATATCTATGGATTACAAACAAACAC(SEQ ID NO.9)，

HPV16 RPA-F2：TGTATATCTATGGATTACAAACAAACACA(SEQ ID NO.10)，

HPV16 RPA-F3: TATATCTATGGATTACAAACAAACACAATT (SEQ ID NO. 11) and

HPV16 RPA-R：TAGATGTACAAATATCCAGTGGAACT(SEQ ID NO.12)。

further, the method also comprises the steps of

S8, false virus detection sensitivity identification

(1) Packaging the lentivirus containing HPV16 fragments, transfecting 293T cells growing to 70% -80% by using a transfection reagent Lipo2000, adding plasmids to be transfected, centrifuging and standing after vortex mixing, sucking off liquid, adding an anti-10% FBS DMEM medium, and continuously culturing by changing the 10% FBS DMEM medium containing P/S diabodies after 10 hours of transfection;

(2) Centrifuging, transferring the supernatant into a centrifuge tube, adding the virus concentrate into the centrifuged culture medium according to the ratio of the culture medium to the virus concentrate of 4:1, and mixing the mixture by vortex at 4 ℃ overnight; centrifuging, removing supernatant, adding 1 XPBS to suspend the precipitate again, heating at 95deg.C for cleavage, adding the virus suspension after cleavage into a centrifuge tube of RNase-free, adding 4 XgDNA wind mix, gently stirring, mixing, incubating at 42deg.C for 2min to remove genomic DNA, adding 4 μL 5x HighScript II qRT Supper Mix II, incubating at 50deg.C for 5min after vortex mixing, incubating at 80deg.C for 5s, and storing the prepared sample at-20deg.C for use;

(3) Designing qPCR primers, identifying the copy number of HPV16 pseudovirus, diluting pUC57-HPV16 plasmids into different concentrations, establishing plasmid dilution templates with different concentrations in a qPCR tube, adding the qPCR primers, performing qPCR experiments, and establishing a standard curve of the copy number and Ct value according to qPCR experimental data; amplifying HPV16 pseudovirus samples by using the same qPCR primer, and calculating the slow virus copy number by combining the linear relation between the Ct value and the copy number;

(4) And (3) detecting the HPV16 pseudovirus CRISPR/Cas12a, performing reverse transcription after the HPV16 pseudovirus is cracked, performing recombinase polymerase amplification on a reverse transcription template, and performing CRISPR detection by using a primer to obtain a fluorescent image, and obtaining the copy number of the HPV16 pseudovirus.

Preferably, the qPCR primer in step S8 (3) comprises:

HPV16 qPCR primer 2-F: GTGTTGAGGTAGGTCGTGGT (SEQ ID NO. 13) and

HPV16 qPCR primer 2-R：TGTTCCCCTATAGGTGGTTTGC(SEQ ID NO.14)。

further, the method further comprises the steps of: the recombinase polymerase amplification method amplifies independent CRISPR detection, and specifically comprises the following steps:

(1) Performing in vitro transcription and purification of the block crRNA, designing a plurality of block crRNA sequences, performing in vitro transcription, amplifying to obtain a plurality of crCCDB Block crRNA sequences, and purifying;

(2) Inactivation detection of crRNA activity by in vitro transcribed block crRNA, adding crCCDB Block crRNA, 10x NEB3.1 Buffer, lbCas12a and water obtained after in vitro transcription into an RNase-free PCR tube, assembling for 15min at room temperature, then adding pdonor3.1 plasmid containing CCDB fragment into the RNase-free PCR tube as an activation template, reacting using FQ fluorescent probe at 37 ℃, and measuring fluorescent value by blue light photographing or enzyme-labeling instrument to obtain the result: no obvious fluorescence is generated in the PCR tubes of the crCCDB Block crRNA, so that the conclusion that the in vitro transcription block crRNA can effectively inhibit the activation of Cas12a is obtained;

(3) Synthesizing a block crRNA (ribonucleic acid) to control the crRNA activity in a switching way and activate secondary amplification to improve the detection of sensitivity, synthesizing a block crRNA with 5 DNA sequences TTTTT as the crRNA for signal amplification, firstly annealing the synthesized block crRNA, adding HPV16crRNA6, 10x NEB3.1 Buffer, lbCAs12a and water into an RNase-free PCR tube, mixing uniformly by vortex, adding pUC57-HPV16 plasmid into the RNase-free PCR tube as an activation template, and standing for 15min at room temperature for assembly and activation; after the assembly activation is completed, adding annealed block crRNA and pdonor3.1 plasmid and FQ fluorescent probe into the RNase-free PCR tube, reacting for 30min at 37 ℃, performing secondary amplification self-circulation type shearing replication, amplifying fluorescent signals and improving sensitivity; and measuring a fluorescence value by using an enzyme-labeled instrument or photographing by using blue light to obtain a fluorescence result after activating the secondary amplification.

Preferably, the sequences of crCCDB Block crRNA are respectively

crCCDB Block crRNA-1, including crCCDB Block crRNA-1-F:

TAATACGACTCACTATAGGGAAAAACCCGGTGGTGCATATCGGGGTAATTTCTACTAAGTGTAGATCCCGGTGGTGCATATCGGGG (SEQ ID NO. 15), and

crCCDB Block crRNA-1-R：

CCCGGTGGTGCATATCGGGGATCTACACTTAGTAGAAATTAAAAAACCCGGTGGTGCATATCGGGGCCCTATAGTGAGTCGTATTA(SEQ ID NO.16)；

crCCDB Block crRNA-2, including crCCDB Block crRNA-2-F:

TAATACGACTCACTATAGGGCCCCGATATGTGCACCACCGGGTAATTTCTACTAAGTGTAGATCCCGGTGGTGCATATCGGGG (SEQ ID NO. 17), and

crCCDB Block crRNA-2-R：

CCCCGATATGTGCACCACCGGGATCTACACTTAGTAGAAATTACCCGGTGGTGCATATCGGGGCCCTATAGTGAGTCGTATTA(SEQ ID NO.18)。

Compared with the prior art, the block crRNA, the function for enabling the crRNA to switch and control the combination with the Cas12a and the function verification method thereof have the following beneficial effects:

the method comprises the steps of (1) blocking crRNA, designing a complementary sequence of the crRNA, introducing a single-stranded DNA sequence on the Block crRNA, and enabling the crRNA to be on-off controlled to perform the function of combining with Cas12a when target nucleic acid is not present, so as to reduce background; when the target nucleic acid exists, the Cas12a activated by the target nucleic acid can trans-cleave the sequence, so that crRNA in the sequence is released, secondary signal amplification is realized, and the sensitivity is improved. The combined use of 6 crRNA sequences of HPV 16 can increase the sensitivity of CRISPR detection.

Drawings

FIG. 1 is a graph showing the macroscopic fluorescence change generated after various time periods of the CRISPR detection reaction in step 3.2 of the validation method for the 6 crRNA sequences and the block crRNA of HPV to enable switchable control of the crRNA binding function to Cas12a according to the present invention;

FIG. 2 is a schematic diagram of a verification method of HPV 16-species crRNA sequences and block crRNA enabling switchable control of crRNA binding to Cas12a in step 3.3 according to the present invention, wherein A is a schematic diagram of using a plurality of crRNAs for detecting target nucleic acid, B is a fluorescent image when screening different crRNAs for detection, C is a fluorescent intensity statistical graph when screening different crRNAs for detection, D is a blue-light photograph when different crRNAs are combined for detection, E is a fluorescent intensity statistical graph when different crRNAs are combined for detection;

FIG. 3 is a fluorescent image of HPV16 crRNA-1 for detecting pUC57-HPV16 fragments of different copy numbers, B for detecting pUC57-HPV16 fragments of different copy numbers, C for detecting pUC57-HPV16 fragments of different copy numbers using HPV16crRNA 1-6 combinations, D for detecting pUC57-HPV16 fragments of different copy numbers using HPV16crRNA 1-6 combinations in step 3.4 of a validation method for enabling crRNA switchable control of binding function to Cas12a according to the present invention;

FIG. 4 is a statistical plot of fluorescence intensities of HPV16crRNA mix and HPV18 crRNA mix after detection of different samples in step 3.5 of a validation method for enabling switchable control of crRNA binding to Cas12a by segmented crRNA according to the present invention, A being the fluorescence images of HPV16crRNA mix and HPV18 crRNA mix after detection of different samples;

FIG. 5 is a agarose gel electrophoresis diagram of pUC57-HPV16 plasmids of different copy numbers amplified using different RPA amplification primers in step 4.1 of a validation method for enabling switchable control of crRNA binding function to Cas12a by segmented crRNA according to the present invention; b is a fluorescent image of CRISPR detection of the different amplification products;

FIG. 6 is a fluorescent image of products amplified using the screened HPV16 RPA-F2/R primer RPA for CRISPR detection in step 4.2 of a validation method for enabling the switchable control of crRNA binding function to Cas12a by segmented crRNA according to the present invention; b is a fluorescence intensity statistical graph measured by an enzyme label instrument after CRISPR detection of the amplified product;

FIG. 7 shows a block crRNA according to the invention with plasmid copy numbers of 6.1X10 in step 5.4 of the validation method of the switchable crRNA control of the binding function to Cas12a ⁵ 、6.1x10 ⁴ 、6.1x10 ³ 、6.1x10 ² Sensitivity Ct values at HPV16 qPCR primer-2 for qPCR detection, B is a standard curve between Ct value and plasmid copy number at 61 and 6.1;

FIG. 8 is a fluorescent image of a validation method of block crRNA enabling switchable crRNA control of binding function to Cas12a according to the invention in step 5.5 of reverse transcription of pseudoviruses after cleavage and CRISPR detection using HPV16crRNA-5, HPV16 crRNA-6 after RPA of reverse transcription templates;

FIG. 9 is a schematic diagram of a secondary signal amplification-based nucleic acid detection technique in step 6.1 of a validation method for enabling switchable control of crRNA binding to Cas12a by a segmented crRNA according to the present invention;

FIG. 10 is a schematic structural diagram of a Block crRNA capable of switchable control of crRNA binding to Cas12a in step 6.1 of the method for verifying the function of crRNA binding to Cas12a according to the present invention, wherein A is a sequence map of crCCDB Block-1 and crCCDB Block-2, B is a structural diagram of crCCDB Block-1 and crCCDB Block-2 after folding, and an electrophoresis diagram for identifying in vitro transcribed RNA using Urea-PAGE;

FIG. 11 is a graph showing fluorescence intensity statistics after 30min and 1h incubation for CRISPR detection under the same conditions, wherein A is a fluorescence image after 30min and 1h assembly reaction of different Block crRNAs with Cas12a in step 6.2 of a verification method for enabling switchable control of crRNAs with Cas12a by Block crRNAs according to the present invention;

Detailed Description

The following detailed description of embodiments of the invention is, therefore, to be taken in conjunction with the accompanying drawings, and it is to be understood that the scope of the invention is not limited to the specific embodiments.

Throughout the specification and claims, unless explicitly stated otherwise, the term "comprise" or variations thereof such as "comprises" or "comprising", etc. will be understood to include the stated element or component without excluding other elements or components.

According to block crRNA (Block crRNA) of the preferred embodiment of the invention, the 6 crRNA sequences of HPV 16DNA (SEQ ID No. 1) are targeted, in addition to the complete crRNA sequence, with the complementary sequence of the crRNA, in order to enable the block crRNA to switch the function of controlling binding to Cas12a, in order to reduce background. And then, introducing a single-stranded DNA sequence into the Block crRNA, wherein the Cas12a activated by the target nucleic acid can trans-cleave the sequence, so that the crRNA becomes the Block crRNA which can be controlled by a switch, thereby realizing secondary signal amplification and improving the sensitivity.

6 crRNA sequences are respectively

HPV16 crRNA-1, including HPV16 crRNA-1-F:

HPV16 crRNA-1-R：

GGGGTCAGGTAAATGTATTCATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTA(SEQ ID NO.22)；

HPV16 crRNA-2, including HPV16 crRNA-2-F:

HPV16 crRNA-2-R：

GCCGCTGTGTATCTGGATTAATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTA(SEQ ID NO.24)；

HPV16 crRNA-3, including HPV16 crRNA-3-F:

HPV16 crRNA-3-R：

GTGTCATCCAATTTATTTAAATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTA(SEQ ID NO.26)；

HPV16 crRNA-4, including HPV16 crRNA-4-F:

HPV16 crRNA-4-R：

TGTAGTAAAGTCCATAGCACATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTA(SEQ ID NO.28)；

HPV16 crRNA-5, including HPV16 crRNA-5-F:

HPV16 crRNA-5-R：

TTGTCCACCATTAGAGTTAAATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTA(SEQ ID NO.30)；

HPV16 crRNA-6, including HPV16 crRNA-6-F:

HPV16 crRNA-6-R：

TATAGGTGGTTTGCAACCAATATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTA(SEQ ID NO.32)。

the sequences of the Block crRNA are respectively,

Block crRNA-1：

ccccgatatgcaccaccgggTTTTTTAATTTCTACTAAGTGTAGATcccggtggtgcatatcgggg(SEQ IDNO.2)；

Block crRNA-2：

ccccgatatgcaccaccgggTAATTTCTACTAAGTGTAGATcccggtggtgcatatcgggg(SEQ ID NO.3)；

Block crRNA-3：

Block crRNA-4：

Block crRNA-5：

Block crRNA-6：

wherein the base at the underlined position is a DNA sequence, and the rest is an RNA sequence.

To reduce background, we first prepared Block crrnas by in vitro transcription and assembled with Cas12a for detection of human papillomaviruses (Human Papilloma Virus, HPV). The in vitro transcribed Block crRNA can inhibit trans-cleavage of Cas12a, essentially eliminating background signals.

CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat) is an abbreviation for regular clustered interval short palindromic sequence. CRISPR systems are adaptive immune response systems derived from bacteria or archaea that are resistant to infection by phage or plasmids (barrenagou et al 2007,Bolotin et al, 2005). The bacteria can integrate a portion of the sequence of the invading phage or exogenous plasmid into the CRISPR site, and when additional exogenous nucleic acid of the same sequence enters the bacteria, pre-CRISPR RNA (pre-crRNA) is transcribed from the CRISPR sequence and further processed into mature crRNA. The crRNA is assembled with Cas (CRISPR-associated enzyme) protein with endonuclease activity, further degrading the exogenous nucleic acid. This system mainly comprises two components, the effector protein, cas protein, CRISPR RNA, crRNA. crrnas can guide Cas proteins to recognize and cleave target nucleic acids by complementarily pairing to target DNA or RNA, which cleave and degrade viral nucleic acids when bacteria are infected with the same phage. However, crRNA recognition of DNA or RNA is generally limited by the PAM (protospacer adjacent motif) (jink et al 2012) sequence or PFS (protospacer flanking sequence) (Abudayyeh et al 2016). PAM sequences are critical for binding of Cas protein to DNA and for cleavage of target nucleic acids. For example, the PAM sequence recognized by spCas9 is 5'-NGG-3', with the cleavage site located 3 bases before NGG. Unlike Cas9, cas12a is able to recognize a T-rich PAM sequence, the identified PAM sequence being 5'-TTTN-3'.

Up to now, CRISPR-Cas systems can be largely divided into two broad categories, type I (Class I) systems and type II (Class II) systems. Among the different types of CRISPR systems, the type II system Cas protein is simple in composition, so the most current CRISPR-based nucleic acid diagnostics use the type II system. These Cas proteins, such as Cas12, cas13, for nucleic acid diagnostics, in addition to having the ability to cleave cis, are capable of cleaving surrounding single stranded nucleic acids in trans.

At present, the main flow of the CRISPR-based nucleic acid diagnosis technology comprises the following steps: and (3) collecting a sample, namely placing the sample into a sample preservation solution after the sample is collected through a nasopharyngeal swab. Nucleic acid extraction, adding a lysate to the sample to inactivate and lyse viruses, and extracting viral nucleic acids. Isothermal nucleic acid amplification, by designing specific primers to amplify a target nucleic acid sequence, can produce a large number of target nucleic acid sequences. CRISPR nucleic acid diagnostics by mixing crRNA and Cas12a with nucleic acid amplification fragments followed by detection of amplified signals.

According to the different characteristics of Cas proteins used for nucleic acid detection, current CRISPR diagnostic systems can be largely divided into two main categories: first, a nucleic acid detection method based on Cas9, and second, a nucleic acid detection method based on Cas12a or Cas13 a. Cas9 is used for nucleic acid detection primarily because Cas9 is able to recognize target nucleic acid sequences with high specificity; cas12a or Cas13a is used for nucleic acid detection mainly because of its ability to activate trans-cleavage after recognition of the nucleic acid sequence of interest, thereby amplifying the detection signal (Li et al, 2022).

The technology of detecting (DNA endonucleose-targeted CRISPR trans reporter, DNA endonuclease targeting CRISPR trans-reporter gene) is used for amplifying target DNA, and the technology of detecting (detecting) target DNA is RPA technology which is well compatible with detection of Cas12a because the optimal temperature of the RPA technology is 37 ℃. The detection technique is effective in detecting HPV16 virus and HPV18 virus by combining RPA (Recombinase Polymerase Amplification ) technology.

Persistent infection of high-risk HPV can cause cervical cancer, and has close relation with cancers such as oral cancer and the like. (Kasymova et al, 2019). In most cancers associated with HPV, the high-risk HPV subtypes HPV16 and HPV18 play a major role in the development of precancerous lesions (Woodman et al, 2007). Meanwhile, HPV is double-stranded DNA virus, reverse transcription is not needed when Cas12a is used for detection, so that the HPV is very suitable for a Cas12a detection system, and therefore, HPV16 virus sequences are used for subsequent nucleic acid detection experiments.

Block crRNA (Block crRNA) enables a validation method of crRNA switch control of Cas12a binding function comprising the steps of:

1. and synthesizing according to the sequence of the crRNA to obtain the crRNA.

2. In vitro transcription and purification of crRNA

2.1 selection of reagents

Using the in vitro transcription kit HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB E2050S), protease inhibitor (Bimake B14011) andRNA Purification Kit (Whole gold ER 701-01).

2.2 primer annealing

Designed by SnapGene and synthesized by the company, since the DNA template for in vitro transcription requires a T7 promoter sequence, the T7 promoter sequence (SEQ ID NO. 8) is TAATACGACTCACTTATAGGG, and thus the T7 promoter is added to the 5' end of crRNA, the following reaction system is configured in an RNase-free PCR tube: the forward strand F (10. Mu.M) and the reverse strand R (10. Mu.M) of the same set of crRNAs were each 2. Mu.L, 10x rCutsmart Buffer 2. Mu.L, and sterile ddH2O 14. Mu.L, with a total system of 20. Mu.L. And obtaining an annealing product.

The resulting crRNA sequences, see table 1crRNA sequences, block crRNA sequences, primer sequences, probe sequences and HPV16 sequences.

TABLE 1crRNA sequence, block crRNA sequence, primer sequence, probe sequence and HPV16 sequence

/>

2.3 in vitro transcription

Adding 2 mu L of annealed product, 1 mu L of T7 RNA polymerase, 1 mu L of RNase inhibitor, 1 mu L of NTP Mix Buffer, 3 mu L of 10 xrCutsmart and sterile ddH into an RNase-free PCR tube ₂ O to 30. Mu.L. Water bath at 37 deg.c for 2-3 hr to prolong the in vitro transcription reaction time RNA yield can be improved. Obtaining single-stranded crRNA.

2.4, digesting the DNA template by DNase I, removing DNA in single-stranded crRNA, eliminating the influence of DNA in a transcription system on the subsequent experiment,

10x DNase I Reaction Buffer 5. Mu.L of DNase I1. Mu.L was added to the in vitro transcription reaction system, RNase-free water was added to 50. Mu.L, and the mixture was reacted in a 37℃water bath for 30 minutes to remove DNA.

2.5 Single Strand crRNA purification

Using the whole gold RNA purification kit, RNA purification was performed according to the protocol of the kit itself.

3. CRISPR/Cas12a mediated nucleic acid detection

3.1 nucleic acid detection Using plasmid as activation template

(1) Assembly of Cas12a with the resulting single stranded crRNA

The following reaction system was configured in an RNase-free PCR tube: lbCAs12a 200nM (800 ng), HPV16 crRNA-1200nM (80 ng), 10x NEB3.1 Buffer 3. Mu.L, water was added to make up to 28. Mu.L. Assembling for 15min at room temperature.

(2) CRISPR nucleic acid detection

The pUC57-HPV16 plasmid was first diluted to different copy numbers as an activation template, after which 1. Mu.L of the dilution template and 1. Mu.L of FQ fluorescent probe (SEQ ID NO. 33) 2. Mu.M were added to the above reaction system. After 30min of reaction at 37℃the photograph was taken. To quantitatively measure the ability of trans-cleavage, fluorescence values were measured using an enzyme-labeled instrument, using excitation light 485nm, and emission light 535nm. For visual inspection experiments, we placed eight-tube in a 485nm blue light gum machine and photographed using a smartphone.

3.2 LbCAs12a assay

(1) The following reaction system was configured in an RNase-free PCR tube: lbCAs12a 200nM (800 ng), 3 groups of HPV16crRNA-1, HPV16 crRNA-2 and HPV16 crRNA-3 each 200nM (80 ng), 10x NEB3.1 Buffer 3. Mu.L, and water was added to make up to 28. Mu.L. Assembling for 15min at room temperature.

(2) CRISPR nucleic acid detection

After reaction for 10min, 20min and 30min at 37 ℃, the eight connecting tubes are placed in a 485nm blue light glue tester, and a smart phone is used for photographing.

As shown in FIG. 1, CRISPR detection reactions were able to produce macroscopic fluorescence changes after various times, with 3 groups of HPV16crRNA-1, HPV16 crRNA-2 or HPV16 crRNA-3 all having fluorescence after 10min of detection and more intense fluorescence at 20min and 30min of reaction. Since the fluorescence generated at 30min was stronger, we set the subsequent CRISPR detection reaction time to 30min.

3.3 crRNA screening

(1) Cas12a and crRNA assembly

The following reaction system was configured in an RNase-free PCR tube:

the following reaction system was configured in an RNase-free PCR tube: lbCAs12a 200nM (800 ng), six groups of HPV16crRNA-1, HPV16 crRNA-2, HPV16 crRNA-3, HPV16 crRNA-4, HPV16 crRNA-5 or HPV16 crRNA-6 200nM (80 ng), 10x NEB3.1 Buffer 3. Mu.L, were selected, respectively, and water was added to make up to 28. Mu.L. Assembling for 15min at room temperature.

(2) CRISPR nucleic acid detection

After 30min of reaction at 37 ℃, blue light photographing or enzyme-labeled instrument is used for measuring fluorescence intensity.

As shown in fig. 2, the fluorescence images and fluorescence intensities of different crrnas were screened for detection, and whether the crrnas of different PAM sequences had a difference in activation of Cas12a trans-cleavage was tested, and first 6 crrnas capable of targeting different regions of HPV16 DNA were designed. Wherein the PAM sequence of HPV16 crRNA-4 is TTTG, and other crRNA PAM sequences are TTTA. The results show that HPV16 crRNA-4 produces little fluorescence compared to NC groups, while other crrnas are all able to produce significant fluorescence, suggesting that PAM sequences have an effect on the trans-cleavage activity of Cas12 a. Although the PAM sequences of HPV16 crrnas-1, 2, 3, 5, 6 are TTTA, there is also a significant difference in the intensity of fluorescence produced by these 5 different crrnas, with HPV16 crRNA-6 being able to produce stronger fluorescence than the other 5 crrnas. This suggests that Cas12a has a significant sequence bias, suggesting that we can screen crrnas that are capable of generating stronger fluorescence when tested using CRISPR/Cas12 a. It can also be seen that 6 crRNAs together added to the reaction system produce higher fluorescence intensity than HPV16 crRNA-6.

CRISPR nucleic acid detection techniques require DNA amplification prior to amplification to increase the sensitivity of the detection. However, the length of the RPA amplified sequence is limited, and the length of the sequence which can be effectively amplified is about 200 bp. Due to the restriction of the sequence length, crrnas can be designed to be limited. Three different positions of crRNA were selected, 3 groups of HPV16crRNA-1, HPV16 crRNA-3, HPV16 crRNA-6, wherein the target sequences of HPV16crRNA-1 and HPV16 crRNA-3 were closely spaced. We found that the combination of HPV16 crRNA-1/3, while capable of enhancing the fluorescence intensity of detection, did not differ significantly from HPV16 crRNA-6. Stronger fluorescence can be generated when using a combination of crRNA-1/6 and crRNA-3/6, whereas no stronger fluorescence intensity is generated when using three crRNAs, crRNA-1/3/6.

3.4 CrRNA mix sensitivity detection

(1) Multiple crrnas were used for detection: the following reaction system was configured in an RNase-free PCR tube:

the following reaction system was configured in an RNase-free PCR tube: lbCAs12a 400nM, 6 groups of HPV16crRNA-1/2/3/4/5/6 each 200nM,10x NEB3.1 Buffer 3. Mu.L were selected and made up to 28. Mu.L with water. Standing at room temperature for 15min.

(2) CRISPR nucleic acid detection

pUC57-HPV16 plasmids were first diluted to different copy numbers as activation templates, after which 1. Mu.L of dilution template and 1. Mu.L of FQ fluorescent probe (2. Mu.M) were added to the different crRNA and Cas12a assembly system. After 30min of reaction at 37 ℃, blue light photographing or enzyme-labeled instrument is used for measuring fluorescence intensity.

As shown in FIG. 3, the fluorescence images and fluorescence intensities of pUC57-HPV16 fragments of different copy numbers were detected, comparing whether the use of multiple crRNAs could increase the sensitivity of CRISPR nucleic acid detection, by first diluting pUC57-HPV16 plasmids to different concentrations and then using a single crRNA for detection. We found that using CRISPR/Cas12a with a sensitivity of 5x10 that can be detected when using HPV16crRNA-1 ⁹ Copying; only 5x10 when photographing with blue light ⁹ And 1x10 ¹⁰ The group had fluorescence generation. Then to test whether the combination of multiple crrnas can increase the sensitivity of detection, we used the combination of six HPV16 crrnas to test whether the crRNA mix (mix) has increased sensitivity to CRISPR detection. We found that when crRNA mix is used The detection sensitivity of the CRISPR/Cas12a detection system can be improved to 5x10 ⁸ Copy, and 5x10 at blue photo ⁸ The group had weak fluorescence. In order to make the detection result more reliable, we also measured the fluorescence intensity by an enzyme-labeled instrument. Can see 5x10 ⁸ The group was different from the NC group by 1X10 ⁹ 、5x10 ⁹ 、1x10 ¹⁰ The group showed more significant differences compared to the NC (negative control) group, indicating that crRNA mix could increase the sensitivity of the detection.

3.5 specific identification of LbCAs12a detection

In order to test the specificity of Cas12a detection, HPV16 crRNA-1 200nM, HPV18crRNA-1 200nM and LbCAs12a 300nM are assembled in vitro for 15min, respectively, to obtain HPV16 crRNA-1-Cas12a. The pUC57-HPV18 activation template will then be used in combination with HPV16 crRNA-1-Cas12a and pUC57-HPV16 activation template will be used in combination with HPV18crRNA-1-Cas12 a. The reaction is carried out for 30min at 37 ℃, and the fluorescence value is measured by blue light photographing or an enzyme label instrument. To investigate the effect of normal cell genome on CRISPR nucleic acid detection, we added RPE cell genomic DNA 100ng to different experimental groups to model the effect that normal cell genome may have on the detection results during sampling.

As shown in FIG. 4, the fluorescence images and intensity patterns of HPV16 crRNA mix and HPV18crRNA mix for different samples were used to verify the specificity of CRISPR/Cas12a nucleic acid detection, and HPV16 crRNA mix was mixed with different types of DNA templates for detection. It was found that for samples containing HPV16 plasmids, significant fluorescence was seen when using HPV16 crRNA mix, whereas for the experimental group containing HPV18 plasmids, no significant fluorescence was generated, and the intensity of fluorescence was significantly different for the experimental group containing HPV16 templates when measured with a microplate reader compared to the control group. For HPV18crRNA mix, there was also a significant fluorescence generation in the experimental group containing HPV18 plasmid, and there was a significant difference in fluorescence value relative to the control group. Thus has detection specificity for different subtype CRISPR/Cas12a nucleic acid detection systems of the same virus. Since CRISPR may have some probability of off-target, it is also possible to verify if the genomic DNA of normal cells would interfere with CRISPR detection. The genome DNA of the retinal pigment epithelial cells (RPA) is added into the detected sample to simulate the interference of the genome DNA from human cells to detection in the sampling process. We found that neither HPV16 crRNA mix nor HPV18 mix detected genomic DNA of RPE cells, indicating that crRNA mix has specificity for nucleic acid detection.

4.1 isothermal amplification primer screening

(1) Primers HPV16 RPA-F1 (SEQ ID NO. 9), HPV16 RPA-F2 (SEQ ID NO. 10), HPV16 RPA-F3 (SEQ ID NO. 11) and HPV16RPA-R (SEQ ID NO. 12) were designed. To the lyophilized protein was added 19.4. Mu.L of A Buffer, 2. Mu.L of forward primer HPV16 RPA-F1 or F2 or F3 (10. Mu.M), 2. Mu.L of reverse primer HPV16RPA-R (10. Mu.M), 1. Mu.L of plasmid template of different dilution concentration, and 13.1. Mu.L of sterile dd H ₂ O, 2.5. Mu.L of activator was added after vortexing. Vortex mixing and centrifuging, reacting at 37deg.C for 30min, and inactivating at 95deg.C for 10min. Adding proteinase K to digest the constant-temperature amplification enzyme system, digesting for 15min at 55 ℃ and inactivating proteinase K for 10min at 95 ℃. For the negative control group, it is necessary to change the amplified plasmid template to sterile dd H ₂ O, the rest of the reagents are added normally.

(2) The following reaction system was configured in aseptic PCR: RPA target gene amplification product 4 μ L, lbCas12a 200nM, crRNA 200nM, fluorescent probe 2 μM, 10x NEB3.1 Buffer 3 μL, and sterile ddH2O to 30 μL. The nucleic acid reaction system was added to a PCR tube and reacted at 37℃for 30 minutes.

As shown in FIG. 5, agarose gel electrophoresis patterns after pUC57-HPV 16 plasmids with different copy numbers were amplified using different RPA amplification primers and fluorescence images of CRISPR detection of different amplification products, the sensitivity of RPA amplification was often related to primer design, and in order to screen primers for RPA amplification and test the sensitivity of these primers, we first mixed different primers with different concentrations of plasmid template, RPA reagent, and amplified at 37℃for 30min. After digestion with proteinase K10. Mu.L of the reaction product was pipetted for agarose gel electrophoresis. As can be seen by agarose gel electrophoresis, the three pairs of primers are 1e in the amplified template ⁴ 、1e ⁵ When copied, there is a distinct band. The three pairs of primers HPV16 RPA-F1/R, HPV16RPA-F2/R, HPV RPA-F3/R can be usedAmplification of 1e ⁴ 、1e ⁵ And (3) copying the plasmid. However for 1e ² 、1e ³ The copied plasmid, three pairs of primers, all had no obvious amplified bands. To confirm the amplification effect of the RPA product, we used 4. Mu.L of the amplification product as an activation template for CRISPR nucleic acid detection. On the amplification products of these three pairs of primers are recognition sites for HPV16crRNA-5 and HPV16 crRNA-6. To enhance the effect of the assay, we selected HPV16 crRNA-6 for later detection. For the amplified product of HPV16 RPA-F1/R, HPV16RPA-F2/R, HPV RPA-F3/R, although 1e ² 、1e ³ Copies were detected by agarose gel electrophoresis, but fluorescence was still generated by CRISPR nucleic acid detection. It is demonstrated that DNA templates of sufficient CRISPR/Cas12a system detection can be generated after different copy numbers of DNA RPA. Since the amplification effect of HPV16RPA-F2/R primer is good, we selected HPV16RPA-F2/R for later experiments.

4.2 isothermal amplification and detection of different copy number DNA

(1) Isothermal amplification of the Anpu future reagents:

LbCAs12a and crRNA assembly: the following reaction system was configured in an RNase-free PCR tube: lbCAs12a 300nM, different crRNAs 200nM,10x NEB3.1 3. Mu.L, supplemented with water to 25. Mu.L. The mixture was left at room temperature for 15min.

And detecting nucleic acid by taking the isothermal amplification product as a template.

As shown in FIG. 6, the screened HPV16 RPA-F2/R primer RPA amplified product was used for fluorescent image of CRISPR detection, and the amplified product was subjected to CRISPR detection, and the fluorescence intensity was measured by using an enzyme-labeled instrument, and pUC57-HPV16 plasmid was diluted to different copy numbers, and then HPV16 RPA-F2/R was used for isothermal amplification and CRISPR detection. We found that 1e under blue light irradiation compared to NC group ² 、1e ³ 、1e ⁴ 、1e ⁵ After the copy number DNA is amplified by RPA, obvious fluorescence is generated. 1e when measuring fluorescence values using a microplate reader compared to NC groups ² 、1e ³ 、1e ⁴ 、1e ⁵ There is also a significant difference in the copy arrays. Thus for plasmid templates, we established CRISPR/Cas12a detectionThe nucleic acid detection sensitivity that can be achieved by the system is around 252 copies (13 aM) per reaction.

pUC57-HPV16

(6.02x 10 ²³ Copy number/mol) x (concentration g/ml)/(DNA length×660) =copies/ml

5 false virus detection sensitivity identification

5.1 reagents and cell lines used

The reagent used is as follows: DMEM medium (Thermo C11965500 BT-20), FBS (Sunrise AR 100140.03), 1 XPBS (Thermo C20012500 BT-20), lipofectamine 2000 (Thermo 11668019-10), lentiviral concentration kit (Yesen 41101ES 50)

Cell lines used: HEK293 cell line

5.2 packaging of lentiviruses containing HPV16 fragments

First, 293T cells of 1 well are spread in a six-well plate in advance, and transfection is performed when the 293T cells grow to 70% -80%. The transfection reagent was Lipo2000, and the transfection system for one well cell volume was as follows: 200 mu L of opti-MEM is added into two sterile centrifuge tubes, and plasmids PHAGE-HPV16, pCMV-dR8.2 dvpr and pCMV-VSV-G to be transfected are added into one of the centrifuge tubes, and are subjected to vortex mixing, centrifugation and standing for 15min. To the other tube, 4. Mu.L Lipo2000 was added, and the mixture was vortexed and centrifuged to stand for 15min. Mixing the two reagents uniformly, and then vortex centrifuging and standing for 15min. The liquid medium was aspirated, 1mL of the non-anti 10% fbs DMEM medium was added to each of the six well plates, and the transfection reagent after mixing was added thereto. After 10h of transfection, the culture was continued for 48h with 10% FBS DMEM medium containing the P/S diabody.

5.3 HPV16 lentivirus lysis and reverse transcription

The expressed supernatant was collected and centrifuged at 4℃for 15min. Transferring the supernatant into a new 15mL centrifuge tube, adding the virus concentrate into the centrifuged culture medium according to the ratio of the culture medium to the virus concentrate of 4:1, and mixing by vortex at 4 ℃ overnight. After overnight virus centrifugation at 4℃for 15min, the supernatant was discarded, and the pellet was resuspended in 500. Mu.L 1 XPBS and lysed by heating at 95℃for 6min. 12. Mu.L of the virus suspension after lysis was added to a centrifuge tube of RNase-free, and 4. Mu.L of 4 XgDNA wind mix was added thereto, gently swiping and mixing, and incubating at 42℃for 2min to remove genomic DNA. To this was added 4. Mu.L of 5x HighScript II qRT Supper Mix II, and after vortexing, incubation was performed at 50℃for 5min and at 80℃for 5s. The prepared sample was stored at-20℃for further use.

5.4 HPV16 pseudovirus qPCR

To determine the sensitivity of CRISPR/Cas12a to pseudovirus detection, we first need to identify the copy number of the pseudovirus.

(1) HPV16 virus standard curve

We first diluted pUC57-HPV16 plasmids to different concentrations and amplified using primer set HPV16 qPCR primer 2. The following reaction system was configured in qPCR tube: 2x ChamQ Universal SYBR qPCR Master Mix 10. Mu.L of HPV16 qPCR primer 2-F (SEQ ID NO. 13) (10. Mu.M) 0.4. Mu.L, HPV16 qPCR primer 2-R (SEQ ID NO. 14) (10. Mu.M) 0.4. Mu.L, plasmid dilution templates of different concentrations 1. Mu.L, vortexing and centrifugation were used for qPCR experiments. And establishing a standard curve of copy number and Ct value according to qPCR experimental data.

As shown in FIG. 7, the sensitivity of HPV16 qPCR primer-2 for qPCR detection was used with plasmid copy numbers of 6.1X10, respectively ⁵ 、6.1x10 ⁴ 、6.1x10 ³ 、6.1x10 ² And 61 and 6.1, a standard curve of copy number and Ct value was established. Mimicking the sensitivity of CRISPR/Cas12a detection systems to virus sample detection we first encapsulate HPV16 fragments in lentiviral particles, constituting pseudo-viral particles. In order to quantify the copy number of lentiviral nucleic acids, we performed an absolute quantification experiment. The pUC57-HPV16 plasmid is diluted to different copy numbers, qPCR amplification is carried out, and Ct values corresponding to the different copy numbers are determined. pUC57-HPV16 plasmid was diluted to 6.1x10 in copy number ⁵ 、6.1x10 ⁴ 、6.1x10 ³ 、6.1x10 ² And (6) and (61) and (6.1) determining Ct values corresponding to different copy numbers. A linear relationship between Ct value and copy number is then established.

(2) Pseudovirus qPCR

The following reaction system was configured in qPCR tube: 2xChamQ Universal SYBR qPCR Master Mix 10. Mu.L of HPV16 qPCR primer 2-F (10. Mu.M) 0.4. Mu.L, HPV16 qPCR primer 2-R (10. Mu.M) 0.4. Mu.L, pseudoviral reverse transcription template 10. Mu.L, vortexing and centrifugation were performed for qPCR experiments. And the Ct after amplification was carried into a standard curve, and the copy number in 10. Mu.L of the split virus sample was calculated to be 85 copies.

HPV16 pseudovirus samples were amplified using the same qPCR primers, and lentiviral copy number was calculated to be 86 copies by fitting the formula in combination with the linear relationship between Ct value and copy number.

5.5 HPV16 pseudovirus CRISPR/Cas12a detection

The following reaction system was added to a nuclease-free PCR tube: 17. Mu.L of pseudovirus reverse transcription product (about 146 copies), lbCAs12a 300nM,HPV16 crRNA-5 or HPV16 crRNA-6 200nM, FQ fluorescent probe 10. Mu.M, 10x NEB 3.1Buffer 3. Mu.L, and sterile water was added to make up 30. Mu.L. After incubation at 37℃for 30min, a photograph was taken with blue light.

As shown in FIG. 8, fluorescent images of HPV16crRNA-5 and HPV16 crRNA-6 were used for CRISPR detection after cleavage of pseudoviruses followed by reverse transcription and RPA of the reverse transcription template. To increase the sensitivity of the pseudovirus detection, we amplified the pseudovirus and performed CRISPR detection again using isothermal amplification techniques. We packaged plasmids containing HPV sequences into lentiviruses, split the viruses for 6min at 95℃and reverse transcribed, and subject approximately 146 copies of the viral reverse transcription product to RPA amplification and detection using CRISPR. When tested using HPV16 crRNA-6, the pseudovirus RPA amplified group showed significant fluorescence compared to the NC group, whereas when tested using HPV16crRNA-5, the pseudovirus RPA amplified group showed no fluorescence. It was demonstrated that 146 copies of the viral fragment could be detected using HPV16 crRNA-6, whereas it could not be detected using HPV16 crRNA-5. This may be related to the ability of HPV16 crRNA-6 to generate a stronger fluorescence intensity per unit time. In summary, by combining reverse transcription with RPA amplification and CRISPR detection, we established nucleic acid detection techniques that can detect pseudo-viral copy numbers of around 146 copies (8 aM).

6. RPA amplification independent CRISPR detection method

6.1 In vitro transcription and denaturing PAGE verification of Block crRNA

In order to increase the sensitivity of detection, the mainstream methods of CRISPR/Cas12 a-based nucleic acid detection all require amplification of target nucleic acids, including PCR, RPA or LAMP techniques, to rapidly increase the accumulation of fluorescent signals by increasing the amount of target nucleic acids.

As shown in FIG. 9, a specific Block crRNA was synthesized based on a schematic of the second signal amplification technique, which crRNA contained the complementary sequence of the normal crRNA sequence, and the crRNA spacer sequence was paired with its complementary region by annealing, and the activity was masked. To achieve secondary signal amplification, we join the crRNA sequence and the complement of the spacer sequence of the crRNA together via single stranded DNA, annealing the DNA bases on the folded crRNA to expose to form single stranded DNA. When the target DNA to be detected exists, the crRNA of the target DNA can guide Cas12a to cut a single-stranded DNA sequence on the block crRNA, so that crRNA in the block crRNA is released, and the crRNA, DNA matching with the block crRNA in the system and the Case12a are assembled into a shearing compound to form self-circulation shearing replication, so that secondary signal amplification is realized, sensitivity is improved, and low-background or even background-free detection can be realized.

(1) Block RNA in vitro transcription and purification: to develop a isothermal amplification independent CRISPR detection method, two Block crrnas were designed. Adding 2 mu L of annealed product, 1 mu L of T7 RNA polymerase, 1 mu L of RNase inhibitor, 1 mu L of NTP Mix Buffer, 3 mu L of 10 xrCutsmart and sterile ddH into an RNase-free PCR tube ₂ O to 30. Mu.L. The RNA yield can be improved by prolonging the in vitro transcription reaction time in water bath at 37 ℃ for 2-3 h.

As shown in FIG. 10, the sequence patterns of crCCDB Block crRNA-1 (SEQ ID NO.15 and SEQ ID NO. 16) and crCCDB Block crRNA-2 (SEQ ID NO.17 and SEQ ID NO. 18), the structure after folding of crCCDB Block crRNA-1 and crCCDB Block crRNA-2 and the identification of RNA transcribed in vitro using Urea-PAGE. The red portion is the crRNA sequence, the black portion is the linker sequence, and the gray portion is the saper complement.

Block crRNA, crCCDB Block crRNA-1 and crCCDB Block crRNA-2 were amplified in vitro. To verify whether Block crRNA can combine with Cas12a and activate trans-cleavage ability, we first performed in vitro transcription of crCCDB Block crRNA-1 and crCCDB Block crRNA-2 and band size by PAGE electrophoresis. Between 50nt and 100nt, two distinct bands were seen by PAGE electrophoresis, indicating that we successfully amplified crCCDB Block crRNA-1 and crCCDB Block crRNA-2 from vitro by in vitro transcription.

(2) Denaturation identification: 2.52g of urea was weighed using an analytical balance and added to a 15mL centrifuge tube, to which 600. Mu.L 10x TBE Buffer,40% polyacrylamide 1.5mL was added, followed by sterile ddH ₂ O to 6mL, the tube was repeatedly inverted several times until the urea was completely dissolved. To this was added 60. Mu.L of 10% APS, vortexed, and 6. Mu.L of TEMED vortexed. And adding the mixed solution into a gel preparation tank, and performing electrophoresis gel running after the mixed solution is solidified. The RNA after in vitro transcription of DNA marker and 500ng was denatured with 2X Urea-TBE Loading Buffer 98 ℃for 5min, respectively, and then placed on ice for 2min. DNA markers and in vitro transcribed RNA were added sequentially to the coagulated PAGE gel. Electrophoresis was performed at 180V for 1-2h, and after 5min staining with gel red, photographs were taken.

6.2 in vitro transcription (In Vitro transcription, IVT) inactivation of Block crRNA on crRNA Activity

The following reaction system was added to the RNase-free PCR tube: after in vitro transcription, block crRNA 200nM,10x NEB3.1 Buffer 3. Mu.L, lbCAs12a 200nM, was made up to 28. Mu.L with water. Assembling for 15min at room temperature. The pdonor3.1 plasmid was then added as an activation template (containing the CCDB fragment) and reacted at 37℃for 30min. And (5) measuring a fluorescence value by blue light photographing or an enzyme label instrument.

As shown in fig. 11, in vitro transcribed Block crrnas cannot activate Cas12a trans-cleavage activity, the upper layer is a fluorescence image after 30min and 1h of assembly reaction of different Block crrnas with Cas12a, and the lower layer is a fluorescence intensity histogram after 30min and 1h of CRISPR detection incubation under the same conditions.

To avoid false positives in this assay, it is first necessary to verify whether crCCDB Block-1 and crCCDB Block-2 are able to bind to Cas12a and activate its trans-cleaving activity. The pdonor3.1 plasmid contains the CCDB sequence, and we combined crCCDB Block crRNA-1 and crCCDB Block crRNA-2 with Cas12a, respectively, and reacted with pdonor3.1 plasmid. We found that after 30min and 1h of reaction, there was no significant fluorescence in both crCCDB Block crRNA-1 and crCCDB Block crRNA-2 compared to NC, whereas there was significant fluorescence in the PC group of normal crRNA. Thus, both crCCDB Block crRNA-1 and crCCDB Block crRNA-2 transcribed in vitro are effective in inhibiting activation of Cas12 a.

The pdonor3.1 plasmid (SEQ ID NO. 34) has the sequence of

6.3 Synthesis of Block crRNA for release of crRNA, second order amplification detection of Activity

To achieve self-circulating shear replication to amplify the signal, we synthesized a Block crRNA with 5 TTTTTs at the qing company for use as the signal amplifying crRNA. To verify whether it can bind to Cas12a and activate its ability to trans-cleave, the Block crRNA is first annealed to a structure capable of shielding Cas12a activity. Firstly, HPV16 crRNA6, 10x NEB3.1 Buffer, lbCAs12a and water are uniformly mixed in a RNase-free PCR tube in a vortex manner, pUC57-HPV16 plasmid is added into the PCR tube as an activation template, and the mixture is kept stand for 15min at room temperature for assembly and activation; and after the second step of assembly activation, adding annealed block crRNA and pdonor3.1 plasmid into the PCR tube, reacting for 30min at 37 ℃, performing secondary amplification self-circulation type shearing replication, amplifying fluorescent signals and improving sensitivity. And measuring a fluorescence value by using an enzyme-labeled instrument or photographing by using blue light to obtain a fluorescence result after activating the secondary amplification.

Influence of preference of PAM sequence on trans-cleavage activation capability of Cas12a in-vitro detection system, and the trans-cleavage capability of Cas12a is stronger when the PAM sequence is TTTA. The effect of the nucleic acid sequence on the trans-cleavage activity of Cas12a, there is a clear sequence preference. We also increase the sensitivity of the system to detect by using multiple different crrnas for detection simultaneously. By combining isothermal nucleic acid amplification techniques, we determined that the detection sensitivity of CRISPR/Cas12a with HPV DNA fragments as templates can reach 8400 copies/mL (about 13 aM). We achieved a detection sensitivity of 4867 copies/mL (about 8 aM) by subjecting a pseudovirus sample containing HPV sequences to sample processing and reverse transcription. To achieve secondary signal amplification, we further introduced single stranded DNA on Block crRNA, further increasing sensitivity. After the crRNA sequence and the complementary sequence are connected by single-stranded DNA, a Block crRNA capable of being controlled in a switching way is formed. When exogenous nucleic acid exists, the single-stranded DNA is cut, the Block crRNA is recovered to normal function, and the Block crRNA is further cut, and the detection signal is amplified. It is therefore necessary to verify whether the Block crRNA with single stranded DNA can maintain a low background signal and controllably activate the secondary signal.

The foregoing descriptions of specific exemplary embodiments of the present invention are presented for purposes of illustration and description. It is not intended to limit the invention to the precise form disclosed, and obviously many modifications and variations are possible in light of the above teaching. The exemplary embodiments were chosen and described in order to explain the specific principles of the invention and its practical application to thereby enable one skilled in the art to make and utilize the invention in various exemplary embodiments and with various modifications as are suited to the particular use contemplated. It is intended that the scope of the invention be defined by the claims and their equivalents.

Claims

1. A block crRNA combination, wherein the block crRNA combination consists of the following 6 block crRNA sequences:

Block crRNA-1：

Block crRNA-2：

ccccgatatgcaccaccgggTAATTTCTACTAAGTGTAGATcccggtggtgcatatcgggg(SEQ ID NO.3)；

Block crRNA-3：

Block crRNA-4：

Block crRNA-5：

Block crRNA-6：

ccccgatatgcaccaccgggTTATTUAAUUUCUACUAAGUGUAGAUcccgguggu gcauaucgggg(SEQ ID NO.7)；

the 6 block crRNA sequences described above target the following 6 crRNA sequences of HPV16 DNA, respectively:

HPV16 crRNA-1, including HPV16 crRNA-1-F:

HPV16 crRNA-1-R：

GGGGTCAGGTAAATGTATTCATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTA(SEQ ID NO.22)；

HPV16 crRNA-2, including HPV16 crRNA-2-F:

HPV16 crRNA-2-R：

GCCGCTGTGTATCTGGATTAATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTA(SEQ ID NO.24)；

HPV16 crRNA-3, including HPV16 crRNA-3-F:

HPV16 crRNA-3-R：

GTGTCATCCAATTTATTTAAATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTA(SEQ ID NO.26)；

HPV16 crRNA-4, including HPV16 crRNA-4-F:

HPV16 crRNA-4-R：

TGTAGTAAAGTCCATAGCACATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTA(SEQ ID NO.28)；

HPV16 crRNA-5, including HPV16 crRNA-5-F:

HPV16 crRNA-5-R：

TTGTCCACCATTAGAGTTAAATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTA(SEQ ID NO.30)；

HPV16 crRNA-6, including HPV16 crRNA-6-F:

HPV16 crRNA-6-R：

TATAGGTGGTTTGCAACCAATATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTA(SEQ ID NO.32)。

2. the use of the segmented crRNA combination of claim 1 in the preparation of an HPV detection or diagnostic reagent.