CN113481327A - Novel coronavirus ORF1ab gene detection method based on RAA amplification and CRISPR-Cas12a - Google Patents

Abstract

The invention provides a crRNA molecule and a method for detecting SARS-CoV-2 nucleic acid by using CRISPR-Cas12 a. The method provided by the invention is simple, convenient, easy and rapid, and when the recombinase polymerase nucleic acid amplification technology is combined, the sensitivity for detecting ORF1ab gene of SARS-CoV-2 is 1000copies/mL, which shows extremely high sensitivity. In practical application, the detection sensitivity is 96.00%, the specificity is 100.00%, the positive predictive value is 100.00%, and the negative predictive value is 96.15%, so that the new coronavirus nucleic acid sample can be effectively detected. The method can complete all reactions only by providing 37-42 ℃, can judge and read results through simple fluorescence reading equipment, and is suitable for health institutions with simpler instrument conditions or epidemic situations.

Description

Novel coronavirus ORF1ab gene detection method based on RAA amplification and CRISPR-Cas12a

Technical Field

The invention relates to a detection method of virus nucleic acid, belonging to the field of microorganism detection application.

Background

Novel coronaviruses (Severe acid responsive Syndrome Coronavir-2, SARS-CoV-2) are single-stranded positive-strand RNA viruses whose functional coding genes include Open Reading Frame 1ab gene (Open Reading Frame 1ab, ORF1ab), Spike protein gene (S), Envelope protein gene (E), Membrane protein gene (M), and nucleoprotein gene (N). The new coronavirus can cause the new coronavirus pulmonary inflammation (Corona Virus Disease 2019, COVID-19) after infecting human body, patients have flu-like symptoms such as fever, cough, chest distress, fatigue and the like, and serious patients can have dyspnea, acute respiratory distress syndrome and even death. The infection source of the new coronary pneumonia is a new coronavirus infected person, the new coronavirus is directly contacted with new coronavirus pollutants through respiratory droplets, and the new coronavirus pollutants, the fecal oral route and other routes are rapidly transmitted among people, so that all people are susceptible. Currently, the detection and diagnosis methods for the new coronavirus are: nucleic acid detection methods, immunological detection methods and virus isolation and culture, wherein nucleic acid detection is the most accepted detection method.

CRISPR-Cas (Clustered regulated shorten Palindromic Repeats-CRISPR associated gene) is collectively referred to as "Clustered, Regularly Interspaced, Short Palindromic Repeats" and this system was first discovered in E.coli. With the gradual disclosure of the action mechanism of CRISPR-Cas system and the function of Cas protein, researchers find that the system has strong and wide application potential, such as: as a gene editing tool, regulating gene expression, being used for nucleic acid detection and diagnosis, nucleic acid imaging technology, rapid molecular typing of bacteria and the like. The newly discovered Cas12a system can be used for nucleic acid detection, enabling rapid diagnosis of pathogens. The principle of the CRISPR-Cas12a system for nucleic acid detection is as follows: the Cas12a protein first binds with the corresponding crRNA to form Cas12a-crRNA complex, then recognizes the pro-spacer Adjacent Motif (PAM) at the target DNA, the crRNA complementarily binds with the target strand in the DNA duplex to form R loop, the DNA duplex unwinds, the RuvC endonuclease catalyzes site conformation activation, and since the endonuclease site can only intercalate one DNA strand at a time, the target DNA duplex breaks in sequence, first cuts the non-target strand, and then cuts the target strand. After the cleavage product is released from the complex, the RuvC endonuclease catalytic site of the Cas12a protein remains activated, and any single-stranded DNA can be randomly sheared and degraded. Based on the principle, single-stranded DNA is prepared into a fluorescence quenching probe, and the specific detection of a target sequence is realized by monitoring the release of a fluorescence signal. However, the sensitivity of detection using a single CRISPR-Cas nucleic acid is very limited, and the sensitivity of detection can be greatly improved by applying a nucleic acid amplification technique in combination with the detection technique.

Commonly used nucleic acid amplification methods are: polymerase Chain Reaction (PCR), Recombinase Polymerase Amplification (RPA or recombinant-aid Amplification, RAA), Loop-mediated isothermal Amplification (LAMP), Rolling Circle Amplification (RCA), and the like. The RAA can complete nucleic acid amplification reaction at a lower temperature (37-42 ℃) in a short time, has the characteristics of simplicity and convenience in operation, rapidness, high sensitivity and strong specificity, and has great application potential in the field of rapid detection of pathogens.

The invention aims to establish a high-sensitivity and high-specificity nucleic acid detection method capable of quickly detecting novel coronavirus based on a CRISPR-Cas system and by combining RT-RAA/RAA constant-temperature amplification and CRISPR fluorescence detection methods.

Disclosure of Invention

Based on the above purpose, the invention firstly provides a crRNA molecule for detecting SARS-CoV-2 nucleic acid by using CRISPR-Cas12a technology, and the sequence of the crRNA molecule is selected from any one of SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5 and SEQ ID NO. 7.

Secondly, the invention also provides a method for detecting SARS-CoV-2 nucleic acid based on CRISPR-Cas12a technology for non-diagnostic purpose by applying the crRNA molecule, which comprises the following steps:

(1) preparing a sample nucleic acid template;

(2) reacting the nucleic acid template obtained in the step (1), the Cas12a protein, the fluorescent group and the fluorescence quenching group double-labeled DNA probe and the crRNA molecule in a CRISPR-Cas12a reaction system;

(3) and (3) detecting the fluorescence intensity of the reaction system in the step (2).

In a preferred embodiment, the sample nucleic acid template of step (1) is prepared by a recombinase polymerase nucleic acid amplification method.

In a more preferred embodiment, the upstream primer of the recombinase polymerase nucleic acid amplification is selected from the group consisting of nucleic acids comprising the sequences as shown in any of SEQ ID NO.10-14 and the downstream primer of the recombinase polymerase nucleic acid amplification is selected from the group consisting of nucleic acids comprising the sequences as shown in any of SEQ ID NO. 15-19.

Particularly preferably, the sequence of the upstream primer of the recombinase polymerase nucleic acid amplification is shown by SEQ ID number 14, and the sequence of the downstream primer of the recombinase polymerase nucleic acid amplification is shown by SEQ ID NO. 17.

In another preferred embodiment, the sequence of the crRNA molecule in step (2) is shown in SEQ ID NO. 7.

In yet another preferred embodiment, the DNA probe of step (2) has the sequence shown in SEQ ID NO. 9.

Thirdly, the invention also provides a CRISPR-Cas12a technology detection kit, which comprises the crRNA molecule, the Cas12a protein, a fluorescent group and a fluorescence quenching group double-labeled DNA probe as described in claim 1, an upstream primer containing a sequence shown in any one of SEQ ID NO.10-14 for recombinase polymerase nucleic acid amplification, and a downstream primer containing a sequence shown in any one of SEQ ID NO.15-19 for recombinase polymerase nucleic acid amplification.

In a preferred embodiment, the sequence of the crRNA molecule is shown as SEQ ID NO.7, the sequence of the upstream primer of the recombinase polymerase nucleic acid amplification is shown as SEQ ID NO.14, and the sequence of the downstream primer of the recombinase polymerase nucleic acid amplification is shown as SEQ ID NO. 17.

In another preferred embodiment, the DNA probe has the sequence shown in SEQ ID NO. 9.

Fourthly, the invention provides an upstream DNA single strand and a downstream DNA single strand for preparing the crRNA, wherein the sequence of the upstream DNA single strand is shown as SEQ ID NO.20, and the sequence of the downstream DNA single strand is selected from any one of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 and SEQ ID NO. 8.

In a preferred embodiment, the sequence of the downstream DNA single strand is shown in SEQ ID NO. 8.

Fifthly, the invention provides a method for preparing the crRNA, which comprises the steps of hybridizing an upstream DNA single chain with a sequence shown as SEQ ID NO.20 and a downstream DNA single chain with a sequence shown as any one of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 and SEQ ID NO.8 to prepare a DNA in vitro transcription template, and transcribing the crRNA according to the DNA in vitro transcription template.

In a preferred embodiment, the sequence of the downstream DNA single strand is shown in SEQ ID NO. 8.

Finally, the invention provides a plasmid for evaluating the sensitivity and/or specificity of the kit, wherein the plasmid is constructed by inserting nucleic acid with a sequence shown as SEQ ID NO.22 into a region from 402bp to 424bp of a pUC57 plasmid with a sequence shown as SEQ ID NO. 21. In a particular embodiment of the invention, the pUC57 plasmid has the 402bp to 424bp interval replaced by a nucleic acid having the sequence shown in SEQ ID NO. 22.

The method for detecting ORF1ab gene of SARS-CoV-2 by CRISPR-Cas11a technology provided by the invention is simple, convenient and rapid, can complete detection by aiming at sample nucleic acid in one step, only needs 30-60 minutes, and is convenient for rapid detection of a basal layer. When a Recombinase polymerase nucleic acid Amplification (RAA) technology is combined, the sensitivity of the RAA-Cas12a detection technology is high and can reach at least 1000 copies/mL. In the practical application of detecting ORF1ab gene of new coronavirus sample nucleic acid, the detection sensitivity of the detection method is 96.00%, the specificity is 100.00%, the positive prediction value is 100.00%, the negative prediction value is 96.15%, the new coronavirus nucleic acid sample can be effectively detected, and the method is higher in consistency with a fluorescent quantitative PCR method. The method can complete all reactions only by providing 37-42 ℃, can judge and read results through simple fluorescence reading equipment, and is suitable for health institutions with simpler instrument conditions or epidemic situations.

Drawings

FIG. 1 is a diagram of alignment results of nucleic acid detection target gene sequences of ORF1ab gene CRISPR-Cas12 a;

FIG. 2 is a schematic diagram of the design of in vitro transcription of single-stranded DNA from crRNA T7;

FIG. 3 is a map of a plasmid pUC57 containing a target gene sequence;

FIG. 4 is a diagram showing the screening results of ORF1ab gene detection targets;

FIG. 5 shows the screening electrophoresis of ORF1ab-4 isothermal amplification primers;

FIG. 6 is a graph showing the results of the target specificity detection of ORF1 ab-4;

FIG. 7 is a graph showing the results of the lower limit of detection of the ORF1ab-4 target.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are only illustrative and do not limit the scope of protection defined by the claims of the present invention.

Experimental Material

Reagent: recombinant CRISPR-Cas12a protein (Beijing Koch Biotechnology Co., Ltd.), RT-basic nucleic acid amplification reagent (RAA method) (Hangzhou Zhongzhu detection Biotechnology Co., Ltd.), Monarch RNA purification kit (T2030L) (American New England Biolabs Biotech., Ltd.), HiScribere T7 reagent kit for rapid and efficient RNA synthesis (E205 2050S) (American New England Biolabs.), DNase I (American New England Biolabs.), enzyme-free water (Beijing Bao Nigri technology Co., Ltd. (takara China)), novel coronavirus 2019-nCoV nucleic acid detection kit (fluorescent PCR method) (Shanghai Jie detection Biolabs Co., Ltd.)

The instrument comprises the following steps: eppendorf 5424 centrifuge (Eppendorf, Germany), DeNovix DS-11FX ultramicro spectrophotometer (DeNovix, USA), 7500FAST fluorescent quantitative PCR instrument (Applied Biosystems, America), Bio-Rad CFX96 fluorescent quantitative PCR instrument (Bio-Rad, USA), multifunctional enzyme labeling instrument (Molecular Devices, USA)

Construction example establishment of novel coronavirus nucleic acid detection method based on RAA amplification and CRISPR-Cas12a

1.1 analysis of novel coronavirus gene sequences to search novel coronavirus CRISPR-Cas nucleic acid detection target

The method comprises the following steps: downloading 506 novel coronavirus gene sequences from an NCBI database, comparing the gene sequences by using mafft software, and setting parameters to be automatic to obtain the conserved gene sequences of the novel coronavirus. Meanwhile, the gene sequences of other six kinds of coronavirus capable of infecting human are downloaded from NCBI database, including HCoV-OC43, HCoV-229E, HCoV-NL63, HCoV-HKU1, SARS-CoV and MERS-CoV, and the gene sequences of these coronavirus and the gene sequence of new type coronavirus are compared again to obtain the specific conserved gene sequence of new type coronavirus.

The 5' end PAM sequence of the target gene sequence is TTTN in nucleic acid detection of the CRISPR-Cas12a system. And searching a nucleic acid detection target of a CRISPR-Cas12a system in a conserved region of a new coronavirus ORF1ab gene sequence obtained by sequence alignment.

As a result: after the 506 novel coronavirus gene sequences are compared, CRISPR-Cas12a nucleic acid detection targets of 4 ORF1ab genes are found, see table 1, and have no cross with other six coronavirus gene sequences capable of infecting human, and the gene sequences of 4 detection targets have good specificity, see fig. 1. In fig. 1: a: ORF1ab-1 detection target, b: ORF1ab-2 detection target, c: ORF1ab-3 detection target, d: ORF1ab-4 detection target

TABLE 1ORF1ab gene CRISPR-Cas12a nucleic acid detection target

Note: the position of the detection target point is referred to NC 045512 gene sequence.

1.2 Synthesis of crRNA for Each assay target

The method comprises the following steps: and designing corresponding crRNA according to the gene sequence of each target and a CRISPR-Cas12 nucleic acid detection system. The crRNA sequence consists of two parts: the conserved gene sequence at the 5 'end (scaffold/repeat part), and the complementary sequence of the target gene sequence at the 3' end. The crRNA sequence may be synthesized directly by the organism company, or may be obtained by in vitro transcription of T7. The invention mainly obtains crRNA of each nucleic acid detection target point in a T7 in-vitro transcription mode, and the process is described in detail below.

1.2.1 in vitro transcription template of T7 for the design and Synthesis of crRNA

In the CRISPR-Cas12a system, according to the complementary gene sequence of the target gene sequence in the double-stranded DNA, the conserved gene sequence of the CRISPR-Cas12a nucleic acid detection system is inserted into the 5' end of the double-stranded DNA, and then the crRNA sequence of the detection target can be obtained. The 5' end of the crRNA sequence is inserted with a T7 promoter gene sequence: taatacgactcactataggg (SEQ ID NO.20), and obtaining the T7 in vitro transcription single-stranded DNA template of the detection target point after the gene sequence is reversely complemented, as shown in figure 2. In fig. 2, the underlined part of the crRNA sequence is the conserved gene sequence of the CRISPR-Cas12a nucleic acid detection system, and the underlined part of the in vitro transcription template sequence is the reverse complement of the T7 promoter.

1.2.2 in vitro transcription of T7 to generate crRNA

1.2.2.1 annealing to generate double stranded DNA required for T7 in vitro transcription

When the annealing method is used for generating T7 in vitro transcription double-stranded DNA, an upstream DNA single strand and a downstream DNA single strand are required, wherein the upstream (T7-focused) is a T7 promoter sequence, and the downstream (T7-Reverse) is a T7 in vitro transcription single-stranded DNA template sequence of each nucleic acid detection target, and an annealing reaction system is configured according to the scheme shown in Table 2. Placing the reaction system in a PCR instrument, a water bath kettle or a constant-temperature metal bath, incubating for 10 minutes at 95 ℃, turning off the power supply of the instrument, naturally cooling the temperature of the instrument to room temperature, and taking out; or putting the reaction system into a PCR instrument, incubating for 10 minutes at 95 ℃, cooling to 4 ℃ at the speed of 0.1 ℃/s, taking out, and storing the annealing product at-20 ℃ for later use.

TABLE 2 annealing reaction System

1.2.2.2 in vitro transcription of T7 to generate crRNA

The annealing products of each nucleic acid detection target were used as sample DNA, and in vitro transcription was performed using T7 in vitro transcription kit (HiScribe T7 Rapid high efficiency RNA Synthesis kit, NEB), and the in vitro transcription reaction system is shown in Table 3. The prepared transcription system is mixed evenly and centrifuged for a short time, and then the mixture is placed in a constant temperature incubator or a constant temperature metal bath at 37 ℃ for overnight incubation (12-16 hours).

TABLE 3 annealing in vitro transcription reaction System

1.2.2.3 purification recovery of crRNA

And taking out the overnight incubated sample, adding 20 mu L of enzyme-free water and 2 mu L of DNase I into the reaction tube in sequence to remove residual DNA nucleic acid, mixing uniformly, centrifuging for a short time, placing in a constant-temperature incubator or a constant-temperature metal bath at 37 ℃, incubating for 15 minutes, and taking out.

The method comprises the following steps of using a Monarch RNA purification and recovery kit to purify and recover crRNA according to instructions:

a) adding 100 mu L of RNA clean Binding Buffer into 50 mu L of sample, uniformly mixing by blowing, and standing for 10 minutes at room temperature to ensure that crRNA is fully combined with the reaction solution;

b) adding 150 mu L of absolute ethyl alcohol into a sample, blowing and uniformly mixing, putting an adsorption column into a collecting pipe, adding a sample reaction solution into the adsorption column, standing for several minutes, centrifuging at 13000r for 1 minute, and removing waste liquid;

c) putting the adsorption column back into the collection tube again, adding 500 mu L of RNA clean Wash Buffer into the adsorption column, centrifuging for 1 minute at 13000r, discarding the waste liquid, and repeating the step twice; when the lotion is used for the first time, absolute ethyl alcohol with corresponding volume is added according to the instructions;

d) transferring the adsorption column to a 1.5ml enzyme-free tube, adding 20-30 μ L of enzyme-free water to the adsorption membrane, eluting the purified sample crRNA, standing at room temperature for 10 min, centrifuging at 13000r for 1 min, and collecting the centrifugate; the crRNA concentration was measured using an ultramicro spectrophotometer and stored in a freezer at-80 ℃ for future use.

All the in vitro transcription single-stranded DNA template sequences of T7 and the gene sequence of the T7 promoter are synthesized by Beijing Tianyihui Yuan Biotech Co.

As a result: according to the principle of CRISPR-Cas12a system nucleic acid detection and the conserved gene sequence of crRNA thereof, crRNA of 4N genes and a crRNA T7 in-vitro transcription single-stranded DNA sequence are designed and obtained, and the crRNA of the detection target is obtained through direct synthesis or T7 in-vitro transcription. The specific gene sequences are detailed in Table 4.

ORF1ab Gene crRNA and crRNA T7 in vitro transcribed Gene sequences

1.3 Standard substance of positive plasmid of target

The method comprises the following steps: inserting a target gene sequence comprising a nucleic acid detection target of ORF1ab gene CRISPR-Cas12a and nucleotide sequences of 200-424 bp respectively before and after the gene sequence into a pUC57 plasmid skeleton to replace a region from 402 to 424bp, and synthesizing a positive plasmid of the corresponding nucleic acid detection target for evaluating the specificity of the detection target. In a specific embodiment of the invention, the inserted nucleotide sequence is shown in SEQ ID NO.22 and the pUC57 plasmid sequence is shown in SEQ ID NO. 21. Using the same method, the gene sequences of the approximate positions were selected and six other positive plasmid standards of ORF1ab genes of human-infectable coronaviruses were synthesized, wherein the inserted ORF1ab gene sequence of SARS-CoV is shown in SEQ ID NO.23, the inserted ORF1ab gene sequence of MERS-CoV is shown in SEQ ID NO.24, the inserted ORF1ab gene sequence of HCoV-OC43 is shown in SEQ ID NO.25, the inserted ORF1ab gene sequence of HCoV-NL63 is shown in SEQ ID NO.26, the inserted ORF1ab gene sequence of HCoV-HKU1 is shown in SEQ ID NO.27, and the inserted ORF1ab gene sequence of HCoV-229E is shown in SEQ ID NO. 28. The plasmid map of the pUC57 plasmid is shown in FIG. 3, and the Target mark is the position of the inserted sequence. All plasmid whole genome sequences were synthesized by limited Biotech, Beijing Tianyihui.

1.4 nucleic acid detection based on CRISPR-Cas12a System

1.4.1 Synthesis of Single-stranded DNA fluorescent reporter probes

FAM fluorescent group and BHQ1 fluorescent quenching group are respectively marked at two ends of single-stranded DNA gene sequence, thus forming single-stranded DNA fluorescent report probe. The gene sequence of the reporter probe is: 5 '-FAM-tttttttttttt-BHQ 1-3' (SEQ ID NO.9) synthesized by limited Biotech, Beijing Yihui Yuan Biotech.

1.4.2 fluorescence detection of CRISPR-Cas12a System

The CRISPR-Cas12a nucleic acid detection system established by the invention is used for detecting gene amplification products of each detection target of the new coronavirus ORF1ab gene, and a fluorescence detection system is prepared according to a table 5. Adding the prepared reaction solution into a 96-well plate, and detecting the fluorescence intensity by using a multifunctional microplate reader or a fluorescence quantitative PCR (polymerase chain reaction) instrument, wherein the microplate reader is provided with an excitation light wavelength of 495nm and an emission light wavelength of 520nm, and the fluorescence quantitative PCR instrument selects an FAM fluorescence channel. The reaction temperature is 37 ℃, the fluorescence value is detected every 2 minutes for continuous detection for 30-60 minutes, and the increase of the fluorescence intensity in the CRISPR detection reaction of each target spot is observed.

TABLE 5 CRISPR-Cas12a fluorescence detection System

Note: the total volume of the reaction system of the fluorescent quantitative PCR instrument is 25 mu L, and all reaction components in the table are halved.

1.4.3 determination of Positive result

Compared with a negative control, the fluorescence intensity is obviously increased after 60 minutes of detection, and through statistical analysis, the fluorescence intensity values of three repeated experiments are statistically different from the negative control.

1.5 nucleic acid amplification (RT-RAA/RAA method)

1.5.1 design of isothermal amplification primers for Each assay target

The design requirements of the RAA constant temperature amplification primer are as follows: the length of the primer is 30-35bp, the 5 'end of the primer is an AT base enrichment region, the 3' end of the primer is a CG base enrichment region, the primer is prevented from forming a hairpin structure, a primer dimer is prevented from being formed between an upstream primer and a downstream primer, and the Tm value of the dissolution temperature of the primer can be not considered. In this example, when designing the isothermal amplification primers, the length of the amplified product fragments was minimized while maintaining the amplification efficiency of the primers.

Designing a plurality of upstream amplification primers and a plurality of downstream amplification primers at each CRISPR nucleic acid detection target gene, and amplifying positive plasmid standard substances containing all detection target gene sequences after pairing and combination.

All primers were synthesized by Beijing Tianyihui-Yuan Biotech, Inc.

1.5.2RAA amplification

Amplifying each target positive plasmid by using a basic nucleic acid amplification reagent (RAA method), and preparing a constant temperature amplification system according to the scheme in Table 6. Adding each reaction solution into an enzyme reaction dry powder tube, fully and uniformly mixing, centrifuging for a short time, placing the reaction tube in a constant-temperature metal bath or a PCR instrument at 39 ℃ for reacting for 30 minutes, taking out after amplification is finished, and storing an amplification product at 4 ℃ for later use.

The nucleic acid amplification effect of each primer pair can be determined by DNA gel electrophoresis detection.

TABLE 6 RAA isothermal amplification System

Note: the solution A is hydrated solution, and the solution B is magnesium acetate.

1.5.3 reverse transcription-RAA amplification (RT-RAA)

The RT-basic nucleic acid amplification reagent (RAA method) is used to perform a one-step reverse transcription-isothermal amplification reaction on the novel coronavirus sample nucleic acid, and the nucleic acid amplification system is shown in Table 6. And (3) placing the prepared reaction solution into a constant-temperature metal bath or a PCR instrument at 42 ℃ for reaction for 30 minutes, taking out the reaction solution after the amplification is finished, and storing the amplification product at 4 ℃ for later use.

The nucleic acid amplification effect can be judged by DNA gel electrophoresis detection, and the experimental method is the same as the above.

1.6 screening novel crown ORF1ab gene CRISPR-Cas12a nucleic acid detection target

As a result: the positive plasmids with the same concentration and containing the gene sequences of all detection targets are DNA samples, the same CRISPR-Cas12a nucleic acid detection system is used, the concentrations of all target crRNA are kept consistent in a detection system, and CRISPR fluorescence detection is carried out on 4 nucleic acid detection targets of ORF1ab genes under the same reaction time and conditions. Compared with a negative control, the fluorescence values of the four detection targets are statistically different, the ORF1ab-1 and the ORF1ab-4 detection targets with the highest fluorescence values are selected as the nucleic acid detection targets of the CRISPR-Cas12a system of the ORF1ab gene, and the detection specificity and the detection lower limit of the targets are further evaluated. The detection result is shown in FIG. 4, the fluorescence values of the 4 detection targets are statistically different from those of the negative control, P is less than 0.0001, the detection target ORF1ab-4 with the highest fluorescence value is selected as the CRISPR-Cas12a nucleic acid detection target of ORF1ab gene, and the specificity and the lower limit of detection of the target are further evaluated. In fig. 4, when 4 nucleic acid detection targets are CRISPR fluorescence detected, the graph of fold line of change of fluorescence value of each target within 60 minutes; b: fluorescence intensity values of 4 nucleic acid detection targets in 60 minutes; fluorescence values for each group were compared to the negative control group, P < 0.0001. NC is negative control.

1.6.1ORF1ab-4 design and screening of isothermal amplification primers for detection of target

As a result: ORF1ab-4 detection targets are designed and synthesized with 5 upstream primers and 5 downstream primers, and the gene sequence information of each primer is shown in Table 7. The upstream and downstream primers were paired and combined, and the positive plasmid of the target gene was amplified at constant temperature, and the amplification of nucleic acid by each primer pair is shown in FIG. 5. And for the primer pair with similar amplification effect, carrying out CRISPR-Cas12a nucleic acid detection on the amplification product, and finally selecting the primer pair ORF1ab-4-AF5/ORF1ab-4-AR3 with shorter nucleic acid amplification fragment to establish the isothermal amplification system of the ORF1ab-4 target spot. In FIG. 5, lanes 1-5: 1F and 1R-5R are sequentially paired; lanes 6-10: 2F and 1R-5R are sequentially paired; lanes 11-15: 3F and 1R-5R are sequentially paired; lanes 16-20: 4F and 1R-5R are sequentially paired; lanes 21-25: 5F pairs with 1R-5R in sequence. Lane 23 is the final selection primer pair amplification result.

TABLE 7 isothermal amplification primers for ORF1ab-4 detection target

1.6.2ORF1ab-4 specificity of detection targets

As a result: and (3) carrying out RAA constant temperature amplification on ORF1ab gene positive plasmids of other six coronaviruses by using the screened amplification primers of the ORF1ab-4 detection targets, and then carrying out CRISPR-Cas12a detection to observe the increase of the fluorescence value. The detection results are shown in fig. 6: the specificity of the ORF1ab-4 target point is better, and when the fluorescence value of the positive plasmid of the new coronavirus ORF1ab gene is detected for 60 minutes, the fluorescence values of other coronaviruses are not increased. Therefore, ORF1ab-4 was finally selected as the CRISPR-Cas12a nucleic acid detection target of the ORF1ab gene of the novel coronavirus, and the lower detection limit thereof was further evaluated. NC in fig. 6 is a negative control.

1.7 detection lower limit of ORF1ab-4 detection target

The method comprises the following steps: the positive plasmid of ORF1ab-4 target is used as standard for evaluating the sensitivity/lower limit of the fluorescence detection of each target RAA-CRISPR. The concentration of positive plasmid was measured using a ultramicro spectrophotometer, and plasmid copy number was calculated from the plasmid concentration and plasmid fragment size. Plasmid concentrations were diluted in a ten-fold gradient until a single copy per microliter was obtained.

Plasmid copy number calculation formula:

note: c is the plasmid concentration, DNA length is the full length of the gene sequence of the positive plasmid, and x is the copy number of the finally obtained plasmid.

As a result: and (3) using the amplification primer pair of ORF1ab-4 target obtained by screening, carrying out RAA isothermal amplification gradient dilution on positive plasmids of the new coronavirus ORF1ab-4 target at each concentration, and carrying out CRISPR-Cas12a detection on the amplification products. The result is shown in figure 7, after reacting for 30min, the lower limit of detection of ORF1ab-4 target can reach 1000copies/ml, the CRISPR detection fluorescence value is less than 0.05 compared with the negative control, and the fluorescence values of other concentration positive plasmid samples and the negative control P value are less than 0.0001. In fig. 7, a: when ORF1ab-4 detects the CRISPR fluorescence detection of the target, a fold line graph of the change of the fluorescence value of each concentration sample within 30 minutes; b: the ORF1ab-4 target spot of each concentration sample is detected for 30 minutes, and the fluorescence value of each group is compared with that of a negative control group, wherein P is less than 0.05. NC is negative control.

Therefore, the CRISPR fluorescence detection based on the CRISPR-Cas12a nucleic acid detection system established by the invention has high detection sensitivity on the new coronavirus ORF1ab gene by using RAA nucleic acid amplification combined with ORF1ab-4 CRISPR fluorescence detection as a target point, and can reach at least 1000 copies/mL.

Application examples novel detection of coronavirus nucleic acid samples

The method comprises the following steps: the established nucleic acid detection platform of the new coronavirus ORF1ab gene is used for detecting a new coronavirus nucleic acid sample confirmed by a nucleic acid detection gold standard fluorescent quantitative PCR method, and the detection condition of each target spot RT-RAA-CRISPR fluorescence detection on the actual nucleic acid sample is verified.

RT-PCR method: the novel coronavirus sample nucleic acid is detected and identified by using a novel coronavirus 2019-nCoV nucleic acid detection kit (fluorescence PCR method) of Shanghai Berjie medical science and technology, Inc. Preparing a reaction system according to the instruction, detecting the nucleic acid of the sample by using a Bio-Rad CFX96 fluorescent quantitative PCR instrument, setting reaction conditions according to the instruction, selecting FAM, HEX and ROX fluorescent channels, and judging the detection result of the nucleic acid sample of the new coronavirus according to the CT value of each fluorescent channel.

As a result: 25 novel coronavirus positive clinical nucleic acid samples and 25 negative samples are collected, wherein the negative samples are from asymptomatic general population, and the integrity of all nucleic acid samples is good after the verification of a fluorescent quantitative RT-PCR experiment. The RT-RAA isothermal amplification and CRISPR-Cas12a combined system established by the invention is used for detecting ORF1ab gene of new coronavirus sample nucleic acid. The detection results of the ORF1ab-4 target nucleic acid of the new coronavirus nucleic acid sample are shown in Table 8, 24 positive samples are detected, all negative samples are detected, the detection sensitivity of the detection method is 96.00%, the specificity is 100.00%, the positive predictive value is 100.00%, the negative predictive value is 96.15%, the new coronavirus nucleic acid sample can be effectively detected, and the consistency with a fluorescence quantitative PCR method is high.

TABLE 8 sample fluorescent quantitation RT-PCR assay and CRISPR assay identity (ORF1ab-4)

Sequence listing

<110> China people liberation force disease prevention control center

<120> novel coronavirus ORF1ab gene detection method based on RAA amplification and CRISPR-Cas12a

<160> 28

<170> SIPOSequenceListing 1.0

<210> 1

<211> 41

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

uaauuucuac uaaguguaga uaacucucau gaagugugau c 41

<210> 2

<211> 61

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gatcacactt catgagagtt atctacactt agtagaaatt accctatagt gagtcgtatt 60

a 61

<210> 3

<211> 41

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

uaauuucuac uaaguguaga uuuggaauuu gcgagaaaug c 41

<210> 4

<211> 61

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gcatttctcg caaattccaa atctacactt agtagaaatt accctatagt gagtcgtatt 60

a 61

<210> 5

<211> 41

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

uaauuucuac uaaguguaga uagagaagug aggacuauua a 41

<210> 6

<211> 61

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ttaatagtcc tcacttctct atctacactt agtagaaatt accctatagt gagtcgtatt 60

a 61

<210> 7

<211> 41

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

uaauuucuac uaaguguaga uuauugcaua gacggugcuu u 41

<210> 8

<211> 61

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aaagcaccgt ctatgcaata atctacactt agtagaaatt accctatagt gagtcgtatt 60

a 61

<210> 9

<211> 12

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tttttttttt tt 12

<210> 10

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gctcagtatg aacttaagca tggtacattt acttg 35

<210> 11

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ccacctgctc agtatgaact taagcatggt acatt 35

<210> 12

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

caagctacaa aatatctagt acaacaggag tcacc 35

<210> 13

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

caagctacaa aatatctagt acaacaggag tcacc 35

<210> 14

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

cttaagcatg gtacatttac ttgtgctagt gagta 35

<210> 15

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tgtctttctt ataataattg tccaacttag ggtca 35

<210> 16

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

tcgaagcttg cgtttggata tggttggttt ggta 34

<210> 17

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

atccgtaata ggacctttgt attctgagga ctttg 35

<210> 18

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

ctggttttat ggttgttgtg taactgtttt ctttg 35

<210> 19

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

ccaatttata agtaactggt tttatggttg ttgtg 35

<210> 20

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

taatacgact cactataggg 20

<210> 21

<211> 2710

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120

ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180

accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240

attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300

tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360

tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cgagctcggt acctcgcgaa 420

tgcatctaga tatcggatcc cgggcccgtc gactgcagag gcctgcatgc aagcttggcg 480

taatcatggt catagctgtt tcctgtgtga aattgttatc cgctcacaat tccacacaac 540

atacgagccg gaagcataaa gtgtaaagcc tggggtgcct aatgagtgag ctaactcaca 600

ttaattgcgt tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat 660

taatgaatcg gccaacgcgc ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc 720

tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc agctcactca 780

aaggcggtaa tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca 840

aaaggccagc aaaaggccag gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg 900

ctccgccccc ctgacgagca tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg 960

acaggactat aaagatacca ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt 1020

ccgaccctgc cgcttaccgg atacctgtcc gcctttctcc cttcgggaag cgtggcgctt 1080

tctcatagct cacgctgtag gtatctcagt tcggtgtagg tcgttcgctc caagctgggc 1140

tgtgtgcacg aaccccccgt tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt 1200

gagtccaacc cggtaagaca cgacttatcg ccactggcag cagccactgg taacaggatt 1260

agcagagcga ggtatgtagg cggtgctaca gagttcttga agtggtggcc taactacggc 1320

tacactagaa gaacagtatt tggtatctgc gctctgctga agccagttac cttcggaaaa 1380

agagttggta gctcttgatc cggcaaacaa accaccgctg gtagcggtgg tttttttgtt 1440

tgcaagcagc agattacgcg cagaaaaaaa ggatctcaag aagatccttt gatcttttct 1500

acggggtctg acgctcagtg gaacgaaaac tcacgttaag ggattttggt catgagatta 1560

tcaaaaagga tcttcaccta gatcctttta aattaaaaat gaagttttaa atcaatctaa 1620

agtatatatg agtaaacttg gtctgacagt taccaatgct taatcagtga ggcacctatc 1680

tcagcgatct gtctatttcg ttcatccata gttgcctgac tccccgtcgt gtagataact 1740

acgatacggg agggcttacc atctggcccc agtgctgcaa tgataccgcg agacccacgc 1800

tcaccggctc cagatttatc agcaataaac cagccagccg gaagggccga gcgcagaagt 1860

ggtcctgcaa ctttatccgc ctccatccag tctattaatt gttgccggga agctagagta 1920

agtagttcgc cagttaatag tttgcgcaac gttgttgcca ttgctacagg catcgtggtg 1980

tcacgctcgt cgtttggtat ggcttcattc agctccggtt cccaacgatc aaggcgagtt 2040

acatgatccc ccatgttgtg caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc 2100

agaagtaagt tggccgcagt gttatcactc atggttatgg cagcactgca taattctctt 2160

actgtcatgc catccgtaag atgcttttct gtgactggtg agtactcaac caagtcattc 2220

tgagaatagt gtatgcggcg accgagttgc tcttgcccgg cgtcaatacg ggataatacc 2280

gcgccacata gcagaacttt aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa 2340

ctctcaagga tcttaccgct gttgagatcc agttcgatgt aacccactcg tgcacccaac 2400

tgatcttcag catcttttac tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa 2460

aatgccgcaa aaaagggaat aagggcgaca cggaaatgtt gaatactcat actcttcctt 2520

tttcaatatt attgaagcat ttatcagggt tattgtctca tgagcggata catatttgaa 2580

tgtatttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa agtgccacct 2640

gacgtctaag aaaccattat tatcatgaca ttaacctata aaaataggcg tatcacgagg 2700

ccctttcgtc 2710

<210> 22

<211> 533

<212> DNA

<213> SARS-CoV-2

<400> 22

ctgttatgta catgggcaca ctttcttatg aacaatttaa gaaaggtgtt cagatacctt 60

gtacgtgtgg taaacaagct acaaaatatc tagtacaaca ggagtcacct tttgttatga 120

tgtcagcacc acctgctcag tatgaactta agcatggtac atttacttgt gctagtgagt 180

acactggtaa ttaccagtgt ggtcactata aacatataac ttctaaagaa actttgtatt 240

gcatagacgg tgctttactt acaaagtcct cagaatacaa aggtcctatt acggatgttt 300

tctacaaaga aaacagttac acaacaacca taaaaccagt tacttataaa ttggatggtg 360

ttgtttgtac agaaattgac cctaagttgg acaattatta taagaaagac aattcttatt 420

tcacagagca accaattgat cttgtaccaa accaaccata tccaaacgca agcttcgata 480

attttaagtt tgtatgtgat aatatcaaat ttgctgatga tttaaaccag tta 533

<210> 23

<211> 210

<212> DNA

<213> SARS-CoV

<400> 23

tgtggtaaac aagctacaca atatctagta caacaagagt caccttttgt tatgatgtct 60

gcaccacccg cccaatatga acttaagcat ggtacatttg tttgtgctag tgagtatact 120

ggtaattacc agtgtggtca ctacaaacat ataacttcta aagaaacctt gtattgtata 180

gatggtgctt tactcacaaa gtcctctgag 210

<210> 24

<211> 210

<212> DNA

<213> MERS

<400> 24

gccattatgt tcatgcttgc ctgaagggtg gtcttatttt aaagtttgac tctggcaccg 60

ttagcaagac ttcagactgg aagtgcaagg tgacagatgt acttttcccc ggccaaaaat 120

acagtagcga ttgtaatgtc gtacggtatt ctttggacgg taatttcaga acagaggttg 180

atcccgacct atctgctttc tatgttaagg 210

<210> 25

<211> 210

<212> DNA

<213> HCoV

<400> 25

gtggactgtt cttgcggtaa aaagctaatt cattgtgtac gatttgatgt accattttta 60

atttgcagta atacacctgc tagtgtaaaa ttacctaagg gtgtaggaag tgcaaatatt 120

tttataggtg ataatgttgg tcattatgtt catgttaagt gtgaacaatc ttatcagctt 180

tatgatgctt ctaatgttaa gaaggttaca 210

<210> 26

<211> 210

<212> DNA

<213> HCoV

<400> 26

taaaagtact gtagttgaag ttaaaagtgc tattgtttgt gctagtgtgc ttaaagatgg 60

ttgtgatgtt ggtttttgtc cacacagaca taaattgcgt tcacgtgtta agtttgttaa 120

tggacgtgtt gttattacca atgttggtga acctataatt tcacaatctt ctaagttgct 180

taatggtatt gcttatacaa cattttcagg 210

<210> 27

<211> 210

<212> DNA

<213> HCoV

<400> 27

cttaaattta ataaatggca gtggcaggaa gcatggtatg aatttcgtgc tggcagacca 60

catagattag ttgctcttgt tttagctaaa ggtcatttta aatttgatga accatcagat 120

gctactgatt ttattcgtgt tgttttgaaa caagctgatt tatcaggtgc aatttgtgaa 180

ttagaactta tttgtgattg tggtattaaa 210

<210> 28

<211> 210

<212> DNA

<213> HCoV

<400> 28

aagtatcttg ctaatgaagc tcaagttcaa ttagaacatt atagttcttg tgttgaatgt 60

gatgctaaat ttaaaaactc tgttacatct atcaattctg ctatagtttg tgctagtgtc 120

aaacgtgatg gtgtgcaagt tggttattgt gtccatggta ttaagtacta ttcacgtgtt 180

aaaagtgtta gaggtagagc tattatagtc 210

Claims (15)

1. A crRNA molecule for detecting SARS-CoV-2 nucleic acid by CRISPR-Cas12a technology, wherein the sequence of the crRNA molecule is selected from any one of SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5 and SEQ ID NO. 7.

2. A method for detecting SARS-CoV-2 nucleic acid based on CRISPR-Cas12a technology of non-diagnostic interest using the crRNA molecule of claim 1, the method comprising the steps of:

(1) preparing a sample nucleic acid template;

(2) reacting the nucleic acid template obtained in the step (1), the Cas12a protein, the fluorescent group and the fluorescence quenching group double-labeled DNA probe and the crRNA molecule in a CRISPR-Cas12a reaction system;

(3) and (3) detecting the fluorescence intensity of the reaction system in the step (2).

3. The method of claim 2, wherein the sample nucleic acid template of step (1) is prepared by a recombinase polymerase nucleic acid amplification method.

4. The method of claim 3, wherein the upstream primer of the recombinase polymerase nucleic acid amplification is selected from the group consisting of nucleic acids comprising the sequences as set forth in any one of SEQ ID nos. 10-14 and the downstream primer of the recombinase polymerase nucleic acid amplification is selected from the group consisting of nucleic acids comprising the sequences as set forth in any one of SEQ ID nos. 15-19.

5. The method of claim 4, wherein the sequence of the upstream primer of the recombinase polymerase nucleic acid amplification is represented by SEQ ID No.14 and the sequence of the downstream primer of the recombinase polymerase nucleic acid amplification is represented by SEQ ID No. 17.

6. The method of claim 2, wherein the sequence of the crRNA molecule in step (2) is shown as SEQ ID NO. 7.

7. The method according to any one of claims 2 to 6, wherein the DNA probe of step (2) has a sequence shown in SEQ ID NO. 9.

8. A CRISPR-Cas12a technical detection kit, which is characterized by comprising the crRNA molecule of claim 1, a Cas12a protein, a fluorescent group and a fluorescence quenching group double-labeled DNA probe, an upstream primer containing a sequence shown in any one of SEQ ID NO.10-14 and used for recombinase polymerase nucleic acid amplification, and a downstream primer containing a sequence shown in any one of SEQ ID NO.15-19 and used for recombinase polymerase nucleic acid amplification.

9. The kit of claim 8, wherein the sequence of the crRNA molecule is shown as SEQ ID No.7, the sequence of the upstream primer of the recombinase polymerase nucleic acid amplification is shown as SEQ ID No.14, and the sequence of the downstream primer of the recombinase polymerase nucleic acid amplification is shown as SEQ ID No. 17.

10. The kit according to any one of claims 8 or 9, wherein the DNA probe has the sequence shown in SEQ ID No. 9.

11. An upstream DNA single strand and a downstream DNA single strand for preparing the crRNA of claim 1, wherein the sequence of the upstream DNA single strand is shown as SEQ ID NO.20, and the sequence of the downstream DNA single strand is selected from any one of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 and SEQ ID NO. 8.

12. The upstream single-stranded DNA and the downstream single-stranded DNA of claim 11, wherein the sequence of the downstream single-stranded DNA is represented by SEQ ID No. 8.

13. A method for preparing the crRNA of claim 1, characterized in that an upstream DNA single strand with a sequence shown as SEQ ID No.20 and a downstream DNA single strand with a sequence shown as any one of SEQ ID No.2, SEQ ID No.4, SEQ ID No.6 and SEQ ID No.8 are hybridized to prepare a DNA in vitro transcription template, and then the crRNA is prepared by transcription according to the DNA in vitro transcription template.

14. The method according to claim 13, wherein the sequence of the downstream DNA single strand is represented by SEQ ID No. 8.

15. A plasmid for evaluating the sensitivity and/or specificity of the kit according to claim 8, wherein the plasmid is constructed by inserting a nucleic acid shown as SEQ ID No.22 into the interval from 402bp to 424bp of the pUC57 plasmid shown as SEQ ID No. 21.

Images