CN108486234B - CRISPR (clustered regularly interspaced short palindromic repeats) typing PCR (polymerase chain reaction) method and application thereof - Google Patents
CRISPR (clustered regularly interspaced short palindromic repeats) typing PCR (polymerase chain reaction) method and application thereof Download PDFInfo
- Publication number
- CN108486234B CN108486234B CN201810271385.3A CN201810271385A CN108486234B CN 108486234 B CN108486234 B CN 108486234B CN 201810271385 A CN201810271385 A CN 201810271385A CN 108486234 B CN108486234 B CN 108486234B
- Authority
- CN
- China
- Prior art keywords
- dna
- crispr
- pcr
- typing
- artificial sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Abstract
The invention discloses a CRISPR typing PCR method and application thereof, and the method is a method for carrying out DNA detection and typing. According to the method, Cas9 protein and sgRNA of target DNA are added into a conventional PCR reaction system, a short-time constant-temperature incubation program is added before a PCR reaction program, and then a conventional PCR amplification program is started. The CRISPR typing PCR method disclosed by the invention is a homogeneous detection technology, namely detection can be finished by only one PCR amplification step, the method utilizes the specificity recognition cutting characteristic of the CRISPR technology on DNA, can simply, homogeneously, quickly and sensitively carry out specificity detection and typing on target DNA, is a novel DNA detection method with high specificity and sensitivity, and successfully detects human HPV DNA in clinical samples by applying the method.
Description
Technical Field
The invention belongs to the technical field of biology, and relates to a DNA detection and typing method based on CRISPR (clustered regularly interspaced short palindromic repeats), in particular to a CRISPR typing PCR method (ctPCR method for short) and application thereof.
Background
DNA detection and genotyping have long been important for basic research, various detection and diagnostic applications. Therefore, DNA detection and genotyping techniques have been receiving much attention, thereby promoting the development of such techniques. In short, there are mainly three types of DNA detection and genotyping techniques that are widely used. The first is a variety of techniques based on the Polymerase Chain Reaction (PCR). PCR is the most commonly used technique for DNA detection and genotyping. PCR-based DNA detection and genotyping relies mainly on the design of specific primers and multiplex PCR amplification. PCR detection can be achieved by traditional PCR (tpcr), quantitative PCR (qpcr), and recently developed digital PCR. Q-PCR is highly popular in almost all research, detection and diagnostic laboratories because of its obvious advantages, such as real-time detection and high sensitivity. More accurate digital PCR has now been developed with great potential and advantages as a clinical testing tool. However, PCR techniques are limited to multiplex amplification and highly specific primers when used to distinguish between highly related genotypes. In addition to PCR, various DNA hybridization techniques such as DNA microarray are widely used for detecting and typing DNA. However, due to its expensive equipment, complicated detection procedures and inevitable nonspecific hybridization, the DNA microarray technology cannot become a conventional DNA detection and genotyping tool like PCR. DNA sequencing is another effective DNA detection and genotyping technique. Particularly with the advent of Next Generation Sequencing (NGS) technology, more and more DNA sequencing tools are available for NGS platforms such as Illumina NovaSeq. However, they are still not as useful for routine research, detection and diagnosis as PCR due to the need for expensive equipment and chemicals. Thus, in contrast, PCR remains the most convenient, cost-effective platform for DNA detection and genotyping if the limitations of primer design are overcome.
Ishino et al first found clustered regularly interspaced short palindromic repeats in the genome of E.coli (E.coli) in 1987 and was defined by Jansen et al as CRISPR (clustered regular intercarried compact palindromic repeat) in 2002. There are three different types of CRISPR systems (types I, II and III). Type I and III systems require multiple Cas proteins to interact to function normally and are therefore much more complex than type II. In type II systems, only one protein (Cas9) is required, Cas9 in combination with a guide rna (grna) is capable of specifically recognizing and cleaving double stranded dna (dsdna). Cas9 is a marker protein for type II systems that functions under the direction of transactivation of crRNA (tracrrna) and CRISPR RNA (crRNA). tracrRNA is capable of activating Cas9 nuclease, and crRNA is specifically complementary to the 20 nucleotide sequence of the target DNA. The crRNA thus determines the specificity of the CRISPR-Cas9 system. The integration of tracrRNA and crRNA into one RNA, single guide RNA (sgrna), greatly simplifies the application of type II CRISPR systems. Cas 9-mediated site-specific cleavage is dependent on sgRNA and pam (protospacer adjjacent motif). If there is PAM in the target DNA, Cas9 cleaves the target DNA three bases upstream of the PAM under the guidance of the sgRNA. Currently, the CRISPR-Cas9 system has been widely used by many researchers in the field of genome editing due to simplicity and high efficiency. In addition, dCas9(dead Cas9) is formed by modifying Cas9, nuclease activity is lost, a gene transcription Activation Domain (AD) or a gene transcription Inhibition Domain (ID) is reserved, and dCas9(dead Cas9) is widely applied to endogenous gene expression regulation as a novel artificial transcription factor.
Although Cas9/sgRNA has been widely used for gene editing and regulation, it has little application to nucleic acid detection. By virtue of the high specificity of DNA cleavage ability (capable of distinguishing single bases), Cas9/sgRNA has great potential in DNA detection and typing. For example, the CRISPR-Cas9 system has been used to detect Zika virus and is capable of typing both American and African Zika viruses (Sci Transl Med.2017,9 (388): pii: eaag0538.doi: 10.1126/scitranslim. aag 0538). Based on the high specificity of CRISPR, the CRISPR-Cas9 can achieve the resolution of single base when differentiating virus strains, and can perform typing detection on orthologous bacteria and viruses on the level of single base. Currently, with the commercial production of Cas9 protein, Cas 9-based DNA detection technology is gradually coming up with new developments. For example, Cas9/sgRNA has been reported for use in treating blood-free DNA (cfDNA) to eliminate wild-type genotypes, to facilitate enrichment of disease-associated mutant genotypes in ctDNA, and to allow detection of mutant genotypes by PCR amplification (Oncogene, 2017, 36: 6823-6829). In addition, we combined the PCR technology with the Cas9/sgRNA system item, and have developed two new DNA detection and typing technologies, named "CRISPR-typing PCR (ctPCR)"; these techniques have already reported national invention patents (201711146674.2, 201711156103.7) and published academic papers (Anal Bioanal Chem,2018, DOI:10.1007/s 00216-018-. In order to facilitate differentiation and reflect differences and improvements between the techniques, the ctPCR of the two studies described above was named ctPCR1.0 (bioxiv: DOI: https:// doi.org/10.1101/236588) and ctPCR2.0(Anal Bioanal Chem,2018, DOI:10.1007/s 00216-018-one 0873-5).
Based on the sequence-specific cleavage function of the CRISPR system on nucleic acid molecules, the application of the CRISPR system in the field of nucleic acid detection is being developed gradually. In addition to the Cas9 enzyme, applications of other Cas proteins have also demonstrated application value in the field of nucleic acid detection in CRISPR systems. For example, Cas13a (also known as C2C2) of the type III CRISPR system has recently been applied to the detection of Zika virus and has an ultra-high sensitivity (the amount of virus particles is as low as 2aM) (this method is named Sherlock) (science.2017; 356(6336):438-442.DOI: 10.1126/science.aamm9321; Science, 2018, eaaq 0179; DOI: 10.1126/science.aaq0179). However, Sherlock technology can only be used for detecting RNA because it relies on cas13a enzyme which can only cut RNA; if the DNA needs to be detected, the recombinase amplification (RPA) technology is used for carrying out isothermal amplification on the DNA, a T7 promoter sequence is introduced at the tail end of an amplification product through a primer during amplification, then in vitro transcription is carried out to generate RNA, then cas13a specific cleavage is carried out on the RNA, and further the non-specific cleavage activity of cas13a on single-stranded RNA is activated to achieve the purpose of detecting the DNA. The detection technology depends on recombinase amplification and in vitro transcription, and although the detection technology is favorable for improving the sensitivity of detection, the detection process is complicated and the cost is high. Furthermore, based on the property that Cas12a (also known as Cpf1) specifically cleaves target double-stranded DNA (dsdna) followed by non-specific single-stranded DNA (ssdna), a new technique for detecting target DNA molecules was developed (this method was named Detectr) (Science, 2018, doi.10.1126/Science. aar 6245). The Detectr technology can detect amole-grade molecules and has high sensitivity, but like Sherlock, the Detectr also depends on a nucleic acid isothermal amplification process, and is high in cost and time-consuming. These studies indicate that CRISPR systems have great potential and advantages for the development of nucleic acid detection techniques.
HPV is a double-stranded DNA virus and is closely related to the pathogenesis of cervical, anal and other cancers. There are approximately 100 different variant types of HPV. HPV is classified into high-risk type HPV (hrHPV) and low-risk type HPV (lrHPV) according to the difference of carcinogenic capacity. The most common hrHPV in the world is HPV16 and HPV18, which cause about 70% of cervical cancers. Other hrHPV include HPV31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 82, etc. LrHPV includes HPV6, 11, 40, 42, 43, 44, 61, 81, and the like. Due to its abundant DNA polymorphism, HPV is a good experimental material for studying DNA detection and typing techniques. Therefore, the present invention uses HPV DNA as a material to demonstrate the method of the present invention. In addition, the ctPCR technology and the sgRNA designed, screened and developed for targeting high-risk HPV basically develop a new technology for detecting clinical samples of instant HPV.
The Polymerase Chain Reaction (PCR) is one of the most commonly used nucleic acid detection methods, and is used as a basic nucleic acid detection tool by almost all laboratories involved in biology, detection and diagnosis. Based on traditional PCR (tPCR), quantitative PCR (qPCR) has been derived and widely used for DNA detection and diagnosis. In addition, recently developed digital pcr (dpcr) has shown great potential and advantages as a clinical detection tool. In application, the main problems faced by the PCR technology are the design of specific PCR primers and the non-specific amplification caused by the weak specificity of the primers; these problems make PCR assays susceptible to false positives. As described above, CRISPR systems, particularly cas9 systems, have specific recognition and cleavage ability of target DNA sequences, even single base discrimination ability. Thus, the combination of CRISPR and PCR technologies provides new opportunities for developing new nucleic acid detection and typing techniques. The technologies have high specificity of CRISPR technology and high sensitivity of PCR technology, and are more advantageous in DNA detection and genotyping.
Disclosure of Invention
The purpose of the invention is as follows: the problems existing in the prior art are solved, and meanwhile, the difference and the improvement between the technologies are reflected in order to conveniently distinguish the ctPCR1.0 (bioxiv: DOI: https:// doi.org/10.1101/236588) and the ctPCR2.0(Anal Bioanal Chem,2018, DOI:10.1007/s 00216-018-. The invention provides a CRISPR-based DNA detection and typing method, namely a novel CRISPR typing PCR method, which is named as ctPCR3.0, namely a CRISPR typing PCR method 3.0(ctPCR3.0), and is a rapid, homogeneous (homogeneous), low-cost and sensitive CRISPR-based PCR method, and can effectively carry out specific detection and typing on target DNA. The ctPCR3.0 is a homogeneous detection technology, namely the detection can be completed only by one PCR amplification step, the specific recognition and cutting characteristics of the CRISPR technology to DNA are utilized, the target DNA can be simply, homogeneously, rapidly and sensitively subjected to specific detection and typing, and the method is a novel DNA detection method with high specificity and sensitivity.
The invention also provides application of the CRISPR typing PCR method.
The technical scheme is as follows: in order to achieve the above object, a method of CRISPR typing PCR (CRISPR-typing PCR, ctPCR) according to the present invention comprises the following steps:
(1) establishing CRISPR typing PCR reaction: adding a CRISPR-associated nuclease, sgRNA of a target DNA and a conventional PCR reaction reagent into a PCR reaction system to establish a CRISPR typing PCR reaction system;
(2) run CRISPR typing PCR program: after a CRISPR typing PCR reaction system is established, a short-time constant-temperature incubation program is added before a PCR reaction program, and then a PCR amplification program is started.
Wherein the CRISPR-associated nuclease of step (1) comprises Cas9 protein, and other CRISPR-associated nucleases similar to Cas 9; the invention is mainly exemplified by Cas9 protein, Cas9 can be replaced by other CRISPR-associated nucleases similar to Cas9, such as Cpf1, or other CRISPR-associated nucleases.
The sgRNA of the target DNA in the step (1) is a guide RNA matched with the CRISPR-associated nuclease, and the sgRNA of the target DNA can be one sgRNA or a plurality of sgRNAs. The sgRNA is used for guiding the Cas9 protein to target a target DNA, and can also be replaced by a guide RNA matched with other CRISPR-associated nucleases, such as Cpf1 matched guide RNA. Wherein the number of sgrnas added to the ctPCR reaction is such that efficient cleavage of the target DNA by Cas9/sgRNA is ensured.
Wherein, the conventional PCR reaction reagent in the step (1) comprises a common PCR reaction reagent, a fluorescent quantitative PCR reaction reagent and a digital PCR reaction reagent.
Preferably, the conventional PCR reagent in step (1) is a quantitative PCR reagent. When the quantitative PCR is used for realizing the ctPCR detection, the advantages of real-time detection process, rapidness and low cost are achieved. Furthermore, inexpensive fluorescent dye methods (e.g., SybrGreen-containing quantitative PCR mixes) can be used in quantitative PCR. In the embodiment of the invention, the conventional common PCR reaction premix and the quantitative PCR premix are compatible with the cutting reaction of Cas9/sgRNA on DNA, that is, Cas9/sgRNA can realize assembly and cutting on target DNA in the PCR premix, that is, the PCR premix does not influence the assembly of Cas9/sgRNA and the cutting on the target DNA, which is an important discovery and innovation point of the invention.
Wherein, the PCR primer in the conventional PCR reaction reagent in the step (1) can be a single sequence primer or a degenerate sequence primer; the primers used in the CRISPR typing PCR method are a pair of primers capable of carrying out PCR amplification on a DNA fragment containing a target DNA sequence from a DNA sample to be detected.
Wherein the CRISPR typing PCR program of step (2) is run: comprising a short constant temperature incubation period added before the conventional PCR reaction and a conventional PCR reaction. Wherein the short-time constant-temperature incubation program added before the conventional PCR reaction program means that the ctPCR reaction system constructed in the step (1) is firstly kept at a certain constant temperature for a certain time, for example, at 37 ℃ for 30 minutes; other temperatures and times are also possible, and the purpose of the procedure that a constant temperature is maintained for a certain time is to allow the CRISPR-associated nuclease and sgRNA to assemble into a complex and cleave the target DNA in the CRISPR typing PCR reaction, as long as the time and temperature are sufficient for the above purpose, such as Cas9 and sgRNA to assemble into a Cas9/sgRNA complex and cleave the target DNA. This cleavage results in a decrease in PCR template molecules, which is reflected in an increase in Ct values in quantitative PCR assays. The increase of Ct value in the ctPCR detection caused by the cleavage of the target DNA by Cas9/sgRNA is the judgment basis of the target DNA in the ctPCR detection.
The CRISPR typing PCR method disclosed by the invention is applied to DNA detection and typing.
The CRISPR typing PCR method can be applied to HPV double-stranded DNA biological detection and typing.
The ctPCR method of the present invention is applied to DNA-related biological detection, such as detecting the presence or absence of a certain type of viral DNA in a DNA sample, detecting the presence or absence of a certain disease-related mutation in blood-free DNA (cfDNA), and the like.
The ctPCR method is applied to the biological detection of the double-stranded DNA of the human papilloma virus; such as detection and typing of Human Papilloma Virus (HPV) DNA.
Wherein, the HPV virus comprises various high-risk HPV viruses, in particular HPV16 and HPV 18. In particular, various genotypes of the L1 and E6-E7 genes of Human Papilloma Virus (HPV), and the like. The invention only uses HPV as an experimental material to verify the feasibility of the ctPCR3.0 method. The method can also be used to detect other DNA. The invention adopts HPV DNA as a DNA target for ctPCR3.0 detection. The result shows that ctPCR3.0 can detect and type HPV DNA; the ctPCR3.0 can detect HPV16 and HPV18DNA in the cervical cancer cell genome DNA (gDNA); ctpcrr 3.0 was found to detect 10 HPV subtypes (16, 18, 33, 35, 45, 51, 52, 56, 58 and 59) in cervical cancer detection clinical samples.
The method for detecting sgRNA of various high-risk HPV DNA added in HPV by using CRISPR typing PCR is characterized in that the nucleic acid sequence of the sgRNA of various high-risk HPV DNA is shown in SEQ ID NO. 1-24. In the application of the ctPCR3.0 to detect HPV, two sgRNAs are designed and used aiming at the L1 gene of each HPV subtype, and SEQ ID NO.1-24 are respectively: 16L1 a: TTAAGGAGTACCTACGACAT, respectively; 16L1 b: GTATCTTCTAGTGTGCCTCC, respectively; 18L1 a: TGCTGCACCGGCTGAAAATA, respectively; 18L1 b: GCATCATATTGCCCAGGTAC, respectively; 33L1 a: CTGAGAGGTAACAAACCTAT, respectively; 33L1 b: AAGGAAAAGGAAGACCCCTT, respectively; 35L1 a: ACACAGACATATTTGTACTA, respectively; 35L1 b: TCTTTAGGTTTTGGTGCACT, respectively; 45L1 a: GGGTCATATGTACTTGGCAC, respectively; 45L1 b: ACGATATGTATCCACCAAAC, respectively; 51L1 a: ATCCTACCATTCTTGAACAG, respectively; 51L1 b: ACAGGCTAAGCCAGATCCTT, respectively; 52L1 a: GGAATACCTTCGTCATGGCG, respectively; 52L1 b: CAGTTGTTTTGTCACAGTTG, respectively; 56L1 a: TATTGGGTTATCCCCGCCAG, respectively; 56L1 b: CATATTCCTCCACATGTCTA, respectively; 58L1 a: GCTACGAGTGGTATCAACCA, respectively; 58L1 b: AATGACATATATACATACTA, respectively; 59L1 a: TAAGGGTCCTGTTTAACTGG, respectively; 59L1 b: CTGGTAGGTGTGTATACATT, respectively; 16E6 a: GATTCCATAATATAAGGGGT, respectively; 16E7 b: GAGGAGGAGGATGAAATAGA, respectively; 18E6 a: GTGCTGCAACCGAGCACGAC, respectively; 18E7 b: CGAGCAATTAAGCGACTCAG are provided. The above sequences are all in the 5 'to 3' direction.
Since the L1 gene of Human Papilloma Virus (HPV) has been widely used for detecting and identifying HPV subtypes. In the invention, firstly, aiming at 10 high-risk types of HPV, namely HPV16, 18, 33, 35, 45, 51, 52, 56, 58 and 59, a pair of sgRNAs is designed respectively and is used for detecting L1 genes of the 10 high-risk types of HPV. With these sgRNAs and the universal primers SEQ ID NO.25-26, MY09(5 '-CGTCC MARRG GAWAC TGATC-3') and MY11(5 '-GCMCA GGGWC ATAAY AATGG-3'), which have been reported to amplify the HPV L1 region (where M is A or C; R is A or G; W is A or T; Y is C or T), the L1 genes of 10 high-risk HPVs were detected by the ctPCR3.0 method based on fluorescent quantitative PCR. The result shows that the ctPCR3.0 can effectively detect 10 high-risk types; shows the feasibility and application value of ctPCR3.0 in DNA detection and typing.
The deletion of L1DNA sometimes occurs during integration of the HPV gene into the host cell genome, possibly resulting in the omission of HPV detection. Therefore, the detection of the oncogene E6/E7 is increasingly emphasized in the detection of HPV, since E6-E7 are not deleted when HPV is integrated into human genomic DNA, whereas partial deletion of the L1 gene may occur. Therefore, detection of the E6-E7 gene can prevent omission.
Therefore, in the invention, a pair of sgrnas targeting the E6-E7 genes are also designed and used for two high-risk types of HPV, i.e., HPV16 and HPV 18; using these sgRNAs, HPV16 and HPV18DNA were detected in three human cervical cancer cell lines, HeLa, SiHa and C-33a, using the method proposed by the present invention. The results showed that HPV18 and 16 were successfully detected in HeLa and SiHa cells, respectively; however, two HPVs were not detected in C-33a cells. This is consistent with the fact that HeLa is an HPV18 positive cell, SiHa is an HPV16 positive cell and C-33a is an HPV negative cell.
In the invention, when detecting E6-E7 genes of HPV16 and 18, a pair of degenerate primers designed by the invention are used, namely E67-6F (5 '-AAGGG MGTAAC CGAAA WCGGT-3') and E67-7R (5 '-GTACC TKCWG GATCA GCCAT-3'), wherein M is A or C; w is A or T; k is G or T.
Since Cas9 endonuclease has a large number of off-target binding sites, cleavage can occur at some mismatched positions. Off-targeting is a bottleneck for the application of the CRISPR-Cas9 system in genome-wide, in particular for gene therapy and clinical applications. Although Cas9 has many off-targets in the genome-wide range, there should be very few or no off-target sites on small DNA fragments. In order to ensure the specificity of the ctpcr3.0 method, a pair of sgrnas is designed and used for each HPV subspecies. The results show that ctpcrr 3.0 can be detected: (1) the L1 genes of 10 HPV subtypes (16, 18, 33, 35, 45, 51, 52, 56, 58 and 59) cloned in plasmids; (2) HPV16 and the L1 gene and E6-E7 gene of HPV18 in cervical cancer cell genome DNA (gDNA); (3) cervical cancer detects the L1 gene of 10 HPV subtypes (16, 18, 33, 35, 45, 51, 52, 56, 58 and 59) in clinical samples.
Has the advantages that: compared with the prior art, the invention has the following advantages:
the invention develops a novel CRISPR-based DNA detection and typing method, namely CRISPR-typing PCR (ctPCR), which is named ctPCR3.0 and represents 3.0 version of Cas9/sgRNA typing PCR. The method is a rapid, homogeneous, cheap and sensitive CRISPR-based PCR method, and can effectively perform specific detection and typing on target DNA. The invention successfully detects HPV genes by using a ctPCR3.0 method, (1) L1 genes of 10 HPV subtypes (16, 18, 33, 35, 45, 51, 52, 56, 58 and 59) cloned in plasmids, (2) L16 genes and L1 genes and E6-E7 genes of HPV18 in cervical cancer cell genome DNA (gDNA), and (3) L1 genes of 10 HPV subtypes (16, 18, 33, 35, 45, 51, 52, 56, 58 and 59) in cervical cancer detection clinical samples, and fully verifies the method. In conclusion, the invention develops a new method, ctPCR3.0, which has high specificity, is rapid and can detect and type DNA in a homogeneous phase. In the case of a sample with DNA detection, the entire detection process of ctPCR3.0 can be completed within 2 hours by means of a fluorescence quantitative PCR instrument which has been already popularized.
The invention utilizes the specificity recognition cutting characteristic of the CRISPR technology to DNA, can simply, quickly and sensitively carry out specificity detection and typing on the target DNA, successfully avoids the key bottleneck problems of nucleic acid hybridization, specificity PCR primer design and the like in the field of nucleic acid detection and typing at present, and has the most obvious advantage of ctPCR3.0 being homogeneous detection.
Drawings
FIG. 1 is a schematic diagram of the principle and process for ctPCR3.0 detection and typing of DNA molecules; the positions of sgrnas and PCR primers used when ctpcr3.0 is used to detect HPV are indicated in fig. 1; when the ctPCR3.0 is detected by using the fluorescent quantitative PCR, the reaction time required by the two programs is as follows: (1) establishing a ctPCR reaction; (2) running a ctPCR program; the ctPCR reaction comprises a Cas9 protein, sgRNA targeting a target DNA and a conventional PCR reaction reagent; the ctPCR program comprises a short-time constant-temperature incubation program added before the conventional PCR reaction program and a conventional PCR reaction program;
FIG. 2 is a schematic diagram of the Cas9/sgRNA complex cleaving 10 HPV subtypes HPV L1 plasmid DNA and ctPCR3.0 detecting HPV16 and HPV18L1 plasmid DNA; (A) cas9/sgRNA cuts 10 HPV L1 plasmid DNAs, 10 pairs of specific sgRNAs are designed aiming at 10 subtypes of HPV L1 genes, and the sgRNAs respectively cut corresponding HPV L1 plasmid DNAs after being combined with Cas 9; negative control: (1) sgRNA of HPV16 complexed with Cas9 for cleavage of HPV18L1 plasmid DNA; (2) sgRNA of HPV18 complexed with Cas9 for cleavage of HPV16L1 plasmid DNA; (3) uncleaved HPV16 and HPV18L1 plasmid DNA; (B) ctpcrr 3.0 detects HPV16 plasmid DNA; (C) ctpcr3.0 detects HPV18L1 DNA;
FIG. 3 is a schematic diagram of the detection of 10 HPV subtypes L1 plasmid DNA with ctPCR3.0; in FIG. 3, there are 10 subtypes of HPV (high risk types: 16, 18, 33, 35, 45, 51, 52, 56, 58 and 59) L1 plasmid DNA, and sgRNA of 10 subtypes of HPV is complexed with Cas9 to cleave 10 subtypes of HPV plasmid DNA respectively;
FIG. 4 is a schematic diagram of detection of L1 and E6-E7 genes of HPV18 and 16 in cells using ctPCR3.0; HeLa or SiHa gDNA was detected in FIG. 4, and C-33a gDNA was used as a negative control (A) the HPV18L1 gene in HeLa cells was detected with ctPCR3.0; (B) detecting the HPV16L1 gene in SiHa cells by ctPCR3.0; (C) detecting HPV18E6-E7 gene in HeLa cells with ctPCR3.0; (D) detecting the HPV16E6-E7 gene in SiHa cells by ctPCR3.0;
FIG. 5 is a schematic of detection of HPV (first batch) in eight clinical samples with ctPCR3.0; in the first clinical samples, HPV was found in six clinical samples (accession numbers: 1-6), while HPV was not found in the other two clinical samples, samples 1-6 were HPV16, 16, 18, 33, 51 and 59, respectively;
FIG. 6 is a schematic of HPV detection in 8 clinical samples with ctPCR3.0 (second lot); in the second clinical sample, HPV was found in 6 clinical samples (accession numbers: 1-6), and not in the other two clinical samples, samples 1-6 were respectively HPV16, 16, 35, 52, 56 and 58;
FIG. 7 is a schematic of detection of HPV in 10 clinical samples (third batch) with ctPCR3.0; in the third clinical sample, HPV was found in 8 clinical samples (accession numbers: 1-8), HPV was not found in the other two clinical samples, and HPV16, 18, 33, 45, 52, 56 and 58 were found in samples 1-8, respectively.
Detailed Description
The invention is further illustrated by the following figures and examples.
Example 1
The principle and the flow chart of ctpcr3.0 detection and typing of DNA molecules are shown in fig. 1. Schematic representation of ctpcr3.0 detection of DNA molecules (fig. 1). The method comprises the following steps of detecting target DNA through one-step homogeneous phase: the detected DNA sample was first cleaved by a pair of Cas9/sgRNA complexes, followed by qPCR with a pair of universal primers. All assay components (DNA to be assayed, Cas9 protein, sgRNA, and qPCR reagents) were pre-mixed in one PCR tube. The whole detection process is carried out by adding a constant temperature incubation time (37 ℃, 30 minutes) before the ordinary PCR procedure. In the isothermal incubation step, Cas9 nuclease simultaneously cleaves DNA samples after complexing with a pair of sgrnas (sgRNA and b), respectively. Cas 9/sgRNA-specific cleavage of the target DNA will result in an increase in Ct values in qPCR amplification.
The positions of the L1 and E6/E7 genes of target DNA HPV16 and HPV18, and PCR primers and sgRNAs designed and used for the genes are shown in figure 1. This schematic is helpful for understanding the experiments in examples 2-5 of the present invention.
Example 2
Cleavage of HPV plasmids with Cas9/sgRNA and discrimination of HPV16 and 18 with ctPCR3.0
The experimental method comprises the following steps:
preparation of sgRNA:
preparation of sgRNA in vitro transcription template: PCR 1: based on the backbone portion of sgRNA, a pair of primers (F1 and R shown in table 1) was first designed for PCR. PCR reaction (30. mu.L): 2 μ L F1 (Table 1), 2 μ L R (Table 1), 15 μ L2 XPrimestar(TAKARA) with H2O replenished the volume to 30 μ L. PCA reaction protocol: 2 minutes at 95 ℃; 7 cycles: 95 ℃ for 15 seconds and 72 ℃ for 1 minute. Then, the fragment was electrophoresed with 1.5% agarose gel 100V for 40 minutes, recovered and purified with a gel recovery kit (Axygen), dissolved in 25. mu.L of the eluate, and its DNA concentration and purity were measured with a Nanodrop2000 spectrophotometer, and the fragment was named fragment 1 and stored at-20 ℃ for future use. PCR 2: PCR amplification was performed using fragment 1 as template and F2 and Sg-R as primers. PCR reaction (50. mu.L): 2 μ L fragment 1, 1 μ L F2, 1 μ L Sg-R, 25 μ L2 XPrimestar (TAKARA), 20 μ L H2And O. PCA reaction protocol: 2 minutes at 95 ℃; 30 cycles: 15 seconds at 95 ℃, 30 seconds at 60 ℃ and 1 minute at 72 ℃; 72 ℃ for 2 minutes. After completion of PCR, the fragment was directly recovered with a PCR cleaning kit (Axygen), dissolved in 25. mu.L of an eluate, named fragment 2, and the DNA concentration and purity were measured with a Nanodrop2000 spectrophotometer and stored at-20 ℃ until use. PCR 3: PCR was performed using fragment 2 as template and F3 (Table 1) and Sg-R (Table 1) as primers. PCR reaction (50. mu.L): 2 μ L fragment 2, 1 μ L F3 (Table 1), 1 μ L Sg-R (Table 1), 25 μ L2 XPrimestar (TAKARA), 20 μ L H2And O. PCA reaction protocol: 2 minutes at 95 ℃; enter 30 cycles: 15 seconds at 95 ℃, 30 seconds at 60 ℃ and 1 minute at 72 ℃; 72 ℃ for 2 minutes. After completion of PCR, the fragment was directly recovered with a PCR cleaning kit (Axygen), dissolved in 25. mu.L of an eluate, named T7-sgRNA transcription template, and the DNA concentration and purity thereof were measured with a Nanodrop2000 spectrophotometer and stored at-20 ℃ for future use. The oligonucleotide sequences of the in vitro transcription templates used for preparing sgrnas of this example include F1, R, Sg-R and each of F2 and F3 is shown in SEQ ID nos. 29-79.
sgRNA in vitro transcription preparation: in vitro transcription (H used in this procedure) was performed according to the reference system and amounts in the purchased T7RNA polymerase (T7RNA Pol; NEB) instructions2O, EP tubes, tips, etc. were subjected to RNase treatment), and the corresponding systems (20. mu.L) are shown in the following table: 0.2-1 μ g T7-sgRNA transcription template, 2 μ L T7RNA Pol, 2 μ L T7RNA Pol buffer, 1 μ L rNTP (NEB), using H2O made up the volume to 20. mu.L. And (3) placing the mixed system in a constant-temperature water bath kettle at 37 ℃ for overnight reaction.
Extracting and purifying sgRNA: RNA was extracted using Trizol (Invitrogen) reagent. The in vitro transcription reaction was first added overnight to 1mL Trizol and blown several times with a lance tip. The lysate was transferred to a 1.5mL centrifuge tube and allowed to stand at room temperature for 5 minutes. Chloroform was added in an amount of 0.2mL of chloroform/mL of Trizol, the vial cap was closed, shaken vigorously for 15 seconds, allowed to stand at room temperature for 5 minutes, and centrifuged at 4 ℃ and 12000g for 15 minutes. The upper phase was transferred to a clean centrifuge tube, isopropanol (0.5mL/mL Trizol) was added, the mixture was gently inverted and mixed several times, left at room temperature for 10 minutes, and centrifuged at 12000g for 10 minutes. The supernatant was decanted, and 75% ethanol (1mL/mL Trizol) was added and mixed well, followed by centrifugation at 7500g for 5 minutes at 4 ℃. Removing the supernatant, standing the precipitate at room temperature for 5-10 minutes, naturally drying the precipitate (not completely drying the precipitate), and adding 30 mu L of DEPC water to dissolve the RNA; 260/280 ratios were determined and RNA concentrations were determined using an ultraviolet spectrophotometer, and 1. mu.g was run on a 1.5% agarose gel.
The sgrnas prepared in example 2 were also used in the experiments of examples 3 to 5 in the present invention.
TABLE 1 oligonucleotide sequences for the preparation of in vitro transcription templates for sgRNAs (SEQ ID NO29-79 in sequence from top to bottom)
A total of 10 pairs of sgRNAs (sgRNAa and sgRNAb) were present in HPV of 10 subtypes (table 2). Plasmid DNA (200ng) of 10 subtypes of HPV (16, 18, 33, 35, 45, 51, 52, 56, 58 and 59) was cleaved after binding Cas9 with each sgRNA pair, respectively. Recombinant Cas9 protein was purchased from New England Biolabs (NEB). Cas9 cleavage reaction (30 μ L): 15 μ L of 2 XSSYBR Green Master Mix (Yeasen), 1 μ M Cas9 Nuclease (NEB), 300nM sgRNA (Table 2) and 300nM sgRNA (Table 2). The Cas9 reaction was first incubated at 25 ℃ for 10 minutes. Then 200ng of substrate DNA (plasmid DNA) was added to the Cas9 reaction and incubated at 37 ℃ for 20 minutes. Finally, Cas9 was inactivated at 65 ℃ for 10 min. Detection was performed by electrophoresis on a 2% agarose gel.
HPV plasmid DNA (2ng) was cleaved by sgRNAs/Cas9 nuclease and directly entered the qPCR reaction. ctpcrr 3.0 reaction (30 μ L): 15 μ L of 2 XSSYBR Green Master Mix (Yeasen), 1 μ M Cas9 Nuclease (NEB), 300nM sgRNA (Table 2), 500nM L1-MY09 (Table 3), 500nM L1-MY11 (Table 3), and 2ng HPV plasmid DNA. The operation scheme is as follows: 30 minutes at 37 ℃, 10 minutes at 95 ℃, 15 seconds at 95 ℃ for 40 cycles, 30 seconds at 58.5 ℃ and 45 seconds at 72 ℃. The reaction was performed on a real-time PCR set-up StepOne plus (ABI).
The experimental results are as follows:
various sgrnas for the experiment of the present invention can be prepared by PCR amplification and in vitro transcription of the sgRNA transcription template, and the sequences of the sgrnas, and corresponding HPV subtypes and genes are shown in table 2. These sgrnas were used in experiments in experimental examples 2 to 5 of the present invention. Note that sgrnas in table 2 are not written in the form of RNA sequences, but in the form of DNA sequences, which are RNA sequences by replacing T in the sequences in the table with U in order to facilitate alignment with DNA sequences.
TABLE 2 sgRNA sequences and the corresponding HPV subtypes and genes (SEQ ID NO1-24 from top to bottom)
TABLE 3 PCR primers for CTPCR detection of HPV (SEQ ID NO.25-28 from top to bottom)
| Primer name | Sequences (5 'to 3') |
| L1-MY09 | CGTCCMARRGGAWACTGATC |
| L1-MY11 | GCMCAGGGWCATAAYAATGG |
| E67-6F | AAGGGMGTAACCGAAAWCGGT |
| E67-7R | GTACCTKCWGGATCAGCCAT |
Each of the 10 HPV L1 plasmid DNAs had a pair of specific sgrnas (sgRNA and sgRNA) (table 2), and these 10 pairs of sgrnas were used to cleave 10 HPV L1 plasmid DNAs, respectively, after binding to Cas 9. Negative control: (1) sgRNA of HPV16 binds to Cas9 for cleavage of HPV18L1 plasmid DNA; (2) sgRNA of HPV18 binds to Cas9 for cleavage of HPV16L1 plasmid DNA; (3) uncleaved HPV16 and HPV18L1 plasmid DNA. After 30min of cleavage, the original DNA was completely invisible in the agarose gel (fig. 2A), indicating that the cleavage efficiency of Cas9 was high enough for the next experiment. Ctpcrr 3.0 was then used to distinguish the L1 genes of HPV16 and 18.
HPV16 and 18L1 genes cloned in plasmids were first tentatively tested with ctPCR3.0. HPV16 and 18L1 genes serve as qPCR amplification substrates, and if they are cleaved, the Ct value of qPCR will increase. To preliminarily verify the specificity of the ctpcrr 3.0 assay, the L1 genes of HPV16 and 18 were cross-acted with the sgrnas of HPV16 and 18 in the ctpcrr 3.0 assay. The results show that LI genes of two HPV subtypes can be well detected with ctpcrr 3.0, and L1 genes of HPV16 and 18 can be well distinguished (fig. 2B and 2C).
Example 3
Detection of L1 Gene in HPV subtype plasmids Using ctPCR3.0
The experimental method comprises the following steps:
HPV plasmid DNA (2ng) was cleaved by sgRNAs/Cas9 nuclease and directly entered the qPCR reaction. ctpcrr 3.0 reaction (30 μ L): 15 μ L of 2 XSSYBR Green Master Mix (Yeasen), 1 μ M Cas9 Nuclease (NEB), 300nM sgRNA (Table 2), 500nM L1-MY09 (Table 3), 500nM L1-MY11 (Table 3), and 2ng HPV plasmid DNA. The operation scheme is as follows: 30 minutes at 37 ℃, 10 minutes at 95 ℃, 15 seconds at 95 ℃ for 40 cycles, 30 seconds at 58.5 ℃ and 45 seconds at 72 ℃. The reaction was performed on a real-time PCR set-up StepOne plus (ABI).
The experimental results are as follows:
to further verify the specificity of ctpcrr 3.0. There are 10 subtypes of HPV (high risk: 16, 18, 33, 35, 45, 51, 52, 56, 58 and 59) L1 plasmid DNA, and 10 pairs of sgRNAs were separately combined with Cas9 and each subtype of HPV plasmid DNA was cleaved (37 ℃, 30 min). Cas9 protein was then inactivated at 95 ℃ while the qPCR reaction was turned on. qPCR results showed that ctpcr3.0 successfully distinguished these 10 HPV subtypes from each other (fig. 3). The above results again demonstrate that ctpcrr 3.0 can be used to specifically detect 10 HPV subtypes. ctpcrr 3.0 can also be used to detect other genes.
Example 4
Detection of HPV L1 and E6-E7 genes in cervical cancer cells by ctPCR3.0
The experimental method comprises the following steps:
the ctPCR3.0 reaction system (30. mu.L) consisted of 15. mu.L of gDNA from 2 XSSYBR Green Master Mix (Yeasen), 1. mu.M Cas9 Nuclease (NEB), 300nM sgRNA (Table 2), 500nM L1-MY09 (Table 3) or E67-6F (Table 3), 500nM L1-MY11 (Table 3) or E67-7R (Table 3) and 200ng of various cervical cancer cells. The following operating scheme was used: 30 minutes at 37 ℃, 10 minutes at 95 ℃, 15 seconds at 95 ℃ for 35 cycles, 30 seconds at 58.5 ℃ and 45 seconds at 72 ℃. The reaction was performed on a real-time PCR set-up StepOne plus (ABI).
The experimental results are as follows:
HPV18L1 and E6 genes in HeLa cells and HPV16L1 and E6 genes in SiHa cells were detected by using ctpcrr 3.0. First, 200ng of HeLa or SiHa gDNA was detected and C-33agDNA was used as a negative control. The result shows that the ctpcrr 3.0 can detect that HeLa and SiHa gDNA respectively contain HPV18 and HPV16 genes. In contrast, the HPV18 and HPV16 genes were not detected in C-33a gDNA (FIG. 4). The results indicate that ctpcrr 3.0 can effectively detect and type HPV DNA in HPV-infected cells.
Example 5
Detection of HPV L1 Gene in clinical samples Using ctPCR3.0
The experimental method comprises the following steps:
sgRNA was prepared as in example 1.
ctpcrr 3.0 reaction (30 μ L): 15 μ L of 2 XSSYBR Green Master Mix (Yeasen), 1 μ M Cas9 Nuclease (NEB), 300nM sgRNA (Table 2), 500nM L1-MY09 (Table 3), 500nM L1-MY11 (Table 3), and 20ng DNA. DNA was extracted from cervical mucus exfoliative cells from a total of 26 patients from three clinical specimens. The following operating scheme was used: 30 minutes at 37 ℃, 10 minutes at 95 ℃, 15 seconds at 95 ℃ for 40 cycles, 30 seconds at 58.5 ℃ and 45 seconds at 72 ℃. The reaction was performed on a real-time PCR set-up StepOne plus (ABI). The clinical sample is from Nanjing general Hospital (Nanjing, China). The DNA was extracted with phenol/chloroform and isopropanol in sequence and precipitated with ethanol. Dissolving the purified DNA in ddH2And O and quantitated by spectrometry.
The experimental results are as follows:
finally, the specificity of the ctpcrr 3.0 method was verified by examining clinical samples. A total of 3 clinical specimens (26 cervical mucus exfoliating cells) were tested with ctpcrr 3.0. After Cas9 cleavage, qPCR detection was performed using the universal primer L1-MY 09/11. HPV was found in the first six clinical specimens (accession numbers: 1-6), while no HPV was found in the other two clinical specimens (FIG. 5). Samples 1-6 were HPV16, 16, 18, 33, 51 and 59, respectively. HPV was found in the second six clinical specimens (accession numbers: 1-6), and not in the other two clinical specimens (FIG. 6). Samples 1-6 were HPV16, 16, 35, 52, 56 and 58, respectively. HPV was found in the third eight clinical specimens (accession numbers: 1-8), and not in the other two clinical specimens (FIG. 7). Samples 1-8 were HPV16, 18, 33, 45, 52, 56, and 58, respectively. These results are consistent with the HC2(Digene) detection report of HPV from the nanjing general hospital, the army area of south kyo, indicating the reliability of the ctpcrr 3.0 detection. These data indicate that HPV can be specifically detected in clinical samples by the ctpcr3.0 method.
Sequence listing
<110> university of southeast
<120> CRISPR typing PCR method and application thereof
<160> 79
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ttaaggagta cctacgacat 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ctgagaggta acaaacctat 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
acacagacat atttgtacta 20
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
<210> 13
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
<210> 14
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
<210> 15
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
<210> 16
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
catattcctc cacatgtcta 20
<210> 17
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
<210> 18
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
aatgacatat atacatacta 20
<210> 19
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
<210> 20
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
<210> 21
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
<210> 22
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
<210> 23
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
<210> 24
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
<210> 25
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
cgtccmarrg gawactgatc 20
<210> 26
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
<210> 27
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
aagggmgtaa ccgaaawcgg t 21
<210> 28
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
<210> 29
<211> 53
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttg 53
<210> 30
<211> 52
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
aaaaaaaagc accgactcgg tgccactttt tcaagttgat aacggactag cc 52
<210> 31
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 31
aaaaaaaagc accgactcgg tgccactttt tc 32
<210> 32
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 32
ttaaggagta cctacgacat gttttagagc tagaaatagc aag 43
<210> 33
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 33
ttctaatacg actcactata gttaaggagt acctacgaca tg 42
<210> 34
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 34
gtatcttcta gtgtgcctcc gttttagagc tagaaatagc aag 43
<210> 35
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 35
ttctaatacg actcactata ggtatcttct agtgtgcctc cg 42
<210> 36
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 36
tgctgcaccg gctgaaaata gttttagagc tagaaatagc aag 43
<210> 37
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 37
ttctaatacg actcactata gtgctgcacc ggctgaaaat ag 42
<210> 38
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 38
gcatcatatt gcccaggtac gttttagagc tagaaatagc aag 43
<210> 39
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 39
ttctaatacg actcactata ggcatcatat tgcccaggta cg 42
<210> 40
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 40
ctgagaggta acaaacctat gttttagagc tagaaatagc aag 43
<210> 41
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 41
ttctaatacg actcactata gctgagaggt aacaaaccta tg 42
<210> 42
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 42
aaggaaaagg aagacccctt gttttagagc tagaaatagc aag 43
<210> 43
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 43
ttctaatacg actcactata gaaggaaaag gaagacccct tg 42
<210> 44
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 44
acacagacat atttgtacta gttttagagc tagaaatagc aag 43
<210> 45
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 45
ttctaatacg actcactata gacacagaca tatttgtact ag 42
<210> 46
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 46
tctttaggtt ttggtgcact gttttagagc tagaaatagc aag 43
<210> 47
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 47
ttctaatacg actcactata gtctttaggt tttggtgcac tg 42
<210> 48
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 48
gggtcatatg tacttggcac gttttagagc tagaaatagc aag 43
<210> 49
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 49
ttctaatacg actcactata ggggtcatat gtacttggca cg 42
<210> 50
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 50
acgatatgta tccaccaaac gttttagagc tagaaatagc aag 43
<210> 51
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 51
ttctaatacg actcactata gacgatatgt atccaccaaa cg 42
<210> 52
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 52
atcctaccat tcttgaacag gttttagagc tagaaatagc aag 43
<210> 53
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 53
ttctaatacg actcactata gatcctacca ttcttgaaca gg 42
<210> 54
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 54
acaggctaag ccagatcctt gttttagagc tagaaatagc aag 43
<210> 55
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 55
ttctaatacg actcactata gacaggctaa gccagatcct tg 42
<210> 56
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 56
ggaatacctt cgtcatggcg gttttagagc tagaaatagc aag 43
<210> 57
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 57
ttctaatacg actcactata gggaatacct tcgtcatggc gg 42
<210> 58
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 58
cagttgtttt gtcacagttg gttttagagc tagaaatagc aag 43
<210> 59
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 59
ttctaatacg actcactata gcagttgttt tgtcacagtt gg 42
<210> 60
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 60
tattgggtta tccccgccag gttttagagc tagaaatagc aag 43
<210> 61
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 61
ttctaatacg actcactata gtattgggtt atccccgcca gg 42
<210> 62
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 62
catattcctc cacatgtcta gttttagagc tagaaatagc aag 43
<210> 63
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 63
ttctaatacg actcactata gcatattcct ccacatgtct ag 42
<210> 64
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 64
gctacgagtg gtatcaacca gttttagagc tagaaatagc aag 43
<210> 65
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 65
ttctaatacg actcactata ggctacgagt ggtatcaacc ag 42
<210> 66
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 66
aatgacatat atacatacta gttttagagc tagaaatagc aag 43
<210> 67
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 67
ttctaatacg actcactata gaatgacata tatacatact ag 42
<210> 68
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 68
taagggtcct gtttaactgg gttttagagc tagaaatagc aag 43
<210> 69
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 69
ttctaatacg actcactata gtaagggtcc tgtttaactg gg 42
<210> 70
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 70
ctggtaggtg tgtatacatt gttttagagc tagaaatagc aag 43
<210> 71
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 71
ttctaatacg actcactata gctggtaggt gtgtatacat tg 42
<210> 72
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 72
gattccataa tataaggggt gttttagagc tagaaatagc aag 43
<210> 73
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 73
ttctaatacg actcactata ggattccata atataagggg t 41
<210> 74
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 74
gaggaggagg atgaaataga gttttagagc tagaaatagc aag 43
<210> 75
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 75
ttctaatacg actcactata ggaggaggag gatgaaatag a 41
<210> 76
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 76
gtgctgcaac cgagcacgac gttttagagc tagaaatagc aag 43
<210> 77
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 77
ttctaatacg actcactata ggtgctgcaa ccgagcacga c 41
<210> 78
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 78
cgagcaatta agcgactcag gttttagagc tagaaatagc aag 43
<210> 79
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 79
ttctaatacg actcactata gcgagcaatt aagcgactca g 41
Claims (7)
1. A non-diagnostic CRISPR typing PCR method comprising the steps of:
(1) establishing CRISPR typing PCR reaction: adding CRISPR-associated nuclease, sgRNA of target DNA and a PCR reaction reagent into a PCR reaction system to establish a CRISPR typing PCR reaction system;
(2) run CRISPR typing PCR program: after a CRISPR parting PCR reaction system is established, adding a short-time constant-temperature incubation program before a PCR reaction program, and then starting a PCR amplification program; the short-time constant-temperature incubation procedure is added before the PCR reaction procedure, namely the CRISPR typing PCR reaction system constructed in the step (1) is kept at the constant temperature of 37 ℃ for 30min, wherein the constant temperature of 37 ℃ is the temperature and the time for assembling CRISPR related nuclease and a pair of sgRNAs into a compound and cutting target DNA in the CRISPR typing PCR reaction.
2. The method of CRISPR typing PCR according to claim 1 wherein said CRISPR-associated nuclease of step (1) comprises Cas9 protein, or CRISPR-associated nuclease Cpf1 similar to Cas 9.
3. The CRISPR typing PCR method according to claim 1 or 2, characterized in that the sgRNA targeting the target DNA of step (1) is a CRISPR-associated nuclease-matched guide RNA.
4. The method of CRISPR typing PCR according to claim 1, wherein said PCR reaction reagent of step (1) is a general PCR reaction reagent, a fluorescent quantitative PCR reaction reagent or a digital PCR reaction reagent.
5. The method of CRISPR typing PCR according to claim 4, wherein said PCR reaction reagent of step (1) is a fluorescent quantitative PCR reaction reagent.
6. The CRISPR typing PCR method according to claim 1, wherein PCR primers are included in the PCR reaction reagent of step (1), and the PCR primers are single sequence primers or degenerate sequence primers; the primers are a pair of primers which are obtained by carrying out PCR amplification on a DNA fragment containing a target DNA sequence from a DNA sample to be detected.
7. Use of the CRISPR typing PCR method of claim 1 in DNA detection and typing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810271385.3A CN108486234B (en) | 2018-03-29 | 2018-03-29 | CRISPR (clustered regularly interspaced short palindromic repeats) typing PCR (polymerase chain reaction) method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810271385.3A CN108486234B (en) | 2018-03-29 | 2018-03-29 | CRISPR (clustered regularly interspaced short palindromic repeats) typing PCR (polymerase chain reaction) method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108486234A CN108486234A (en) | 2018-09-04 |
| CN108486234B true CN108486234B (en) | 2022-02-11 |
Family
ID=63316867
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810271385.3A Active CN108486234B (en) | 2018-03-29 | 2018-03-29 | CRISPR (clustered regularly interspaced short palindromic repeats) typing PCR (polymerase chain reaction) method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108486234B (en) |
Families Citing this family (28)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150044192A1 (en) | 2013-08-09 | 2015-02-12 | President And Fellows Of Harvard College | Methods for identifying a target site of a cas9 nuclease |
| US9359599B2 (en) | 2013-08-22 | 2016-06-07 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US9388430B2 (en) | 2013-09-06 | 2016-07-12 | President And Fellows Of Harvard College | Cas9-recombinase fusion proteins and uses thereof |
| US9340799B2 (en) | 2013-09-06 | 2016-05-17 | President And Fellows Of Harvard College | MRNA-sensing switchable gRNAs |
| US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
| WO2016022363A2 (en) | 2014-07-30 | 2016-02-11 | President And Fellows Of Harvard College | Cas9 proteins including ligand-dependent inteins |
| US20190225955A1 (en) | 2015-10-23 | 2019-07-25 | President And Fellows Of Harvard College | Evolved cas9 proteins for gene editing |
| KR102547316B1 (en) | 2016-08-03 | 2023-06-23 | 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 | Adenosine nucleobase editing agents and uses thereof |
| AU2017308889B2 (en) | 2016-08-09 | 2023-11-09 | President And Fellows Of Harvard College | Programmable Cas9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| KR20240007715A (en) | 2016-10-14 | 2024-01-16 | 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 | Aav delivery of nucleobase editors |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| EP3592777A1 (en) | 2017-03-10 | 2020-01-15 | President and Fellows of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| WO2019023680A1 (en) | 2017-07-28 | 2019-01-31 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (pace) |
| WO2019139645A2 (en) | 2017-08-30 | 2019-07-18 | President And Fellows Of Harvard College | High efficiency base editors comprising gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| CA3130488A1 (en) | 2019-03-19 | 2020-09-24 | David R. Liu | Methods and compositions for editing nucleotide sequences |
| CN110596384B (en) * | 2019-10-12 | 2022-08-12 | 南京黎明生物制品有限公司 | Human papilloma virus 6 type and 11 type immunoassay kit prepared based on Cas protein and gRNA compound |
| CN110923314B (en) * | 2019-12-30 | 2023-04-28 | 广州白云山拜迪生物医药有限公司 | Primer for detecting SNP locus rs9263726, crRNA sequence and application thereof |
| GB2614813A (en) | 2020-05-08 | 2023-07-19 | Harvard College | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| CN112029838B (en) * | 2020-07-23 | 2022-07-12 | 东南大学 | CRISPR/Cas9 typing PCR method for DNA homogeneous phase detection and application thereof |
| CN112111605A (en) * | 2020-09-21 | 2020-12-22 | 中山大学附属第一医院 | Detection kit for HPV based on CRISPR-Cas12a and G quadruplex-heme |
| US20240076712A1 (en) * | 2021-01-08 | 2024-03-07 | Wuhan University | Compositions and methods for instant nucleic acid detection |
| CN115873991B (en) * | 2022-11-02 | 2024-03-01 | 中创科瑞(北京)生物科技有限公司 | Block crRNA, function enabling crRNA to switch and control binding with Cas12a and function verification method thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103981256A (en) * | 2014-04-15 | 2014-08-13 | 中国人民解放军疾病预防控制所 | Salmonella CRISPR (clustered regularlay interspaced short palindromic repeats) sequencing typing method |
-
2018
- 2018-03-29 CN CN201810271385.3A patent/CN108486234B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103981256A (en) * | 2014-04-15 | 2014-08-13 | 中国人民解放军疾病预防控制所 | Salmonella CRISPR (clustered regularlay interspaced short palindromic repeats) sequencing typing method |
Non-Patent Citations (5)
| Title |
|---|
| Allele-Specific Quantitative PCR for Accurate, Rapid, and Cost-Effective Genotyping;Lee, HB等;《HUMAN GENE THERAPY》;20160630;第27卷(第6期);第425-435页 * |
| CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method;Qiao Wang等;《bioRxiv》;20171219;第5页和表2-3 * |
| Detecting and typing target DNA with a novel CRISPR-typing PCR (ctPCR) technique;Zhang, BB等;《ANALYTICAL BIOCHEMISTRY》;20181115;第561卷;第37-46页 * |
| 基于CRISPR序列的沙门氏菌分子分型方法的建立;庄孝飞;《中国优秀硕士学位论文全文数据库 工程科技I辑》;20160215;B024-90 * |
| 基于CRISPR的均相核酸检测新方法研究;吴琳;《中国优秀硕士学位论文全文数据库 医药卫生科技辑》;20200615;E060-302 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108486234A (en) | 2018-09-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108486234B (en) | CRISPR (clustered regularly interspaced short palindromic repeats) typing PCR (polymerase chain reaction) method and application thereof | |
| CN107828874B (en) | DNA detection and typing method based on CRISPR and application thereof | |
| CN108192956B (en) | Cas9 nuclease-based DNA detection and analysis method and application thereof | |
| EP4202064A1 (en) | Kit and method for isothermal rapid detection of sars-cov-2 virus nucleic acid | |
| Kostyusheva et al. | CRISPR-Cas systems for diagnosing infectious diseases | |
| WO2020042901A1 (en) | Crispr-cas-based isothermal method for detecting nucleic acid and kit | |
| Josefsson et al. | Detection and quantitation of human papillomavirus by using the fluorescent 5′ exonuclease assay | |
| CN111575351B (en) | DNA detection method based on CRISPR/Cas9 and application thereof | |
| WO2022257659A1 (en) | Crispr/cas system-based sars-cov-2 double-target rapid detection method and kit | |
| WO2016046635A1 (en) | Methods for characterizing human papillomavirus associated cervical lesions | |
| JP2008524990A (en) | Detection of human papillomavirus | |
| CN112375847B (en) | Hepatitis B virus genotyping detection method based on CRISPR/Cas13a system | |
| CN107354239B (en) | Multiplex fluorescence quantitative PCR method and kit for detecting EB virus | |
| CN113046475B (en) | Primer composition and kit for rapidly detecting mutant novel coronavirus | |
| CN113508182B (en) | Assay for detection of Human Papillomavirus (HPV) | |
| Michael et al. | Bead-based multiplex genotyping of 58 cutaneous human papillomavirus types | |
| CN112029838B (en) | CRISPR/Cas9 typing PCR method for DNA homogeneous phase detection and application thereof | |
| CN115335536A (en) | Compositions and methods for point-of-care nucleic acid detection | |
| CN111363842B (en) | Sequence, kit, method and application for rapidly detecting aspergillus fumigatus | |
| TW201321520A (en) | Method and system for virus detection | |
| WO2023207909A1 (en) | Crispr-based nucleic acid detection kit and use thereof | |
| WO2022257663A1 (en) | Method and kit for detecting and screening n501y mutation in covid-19 | |
| WO2003057927A2 (en) | Detection of human papillomavirus e6 mrna | |
| CN106191314B (en) | LAMP detection kit, detection method and application of DNA virus | |
| CN112662817B (en) | Primer probes, target combinations, kits and methods for detecting Latinovirus, Mobala virus and Mopeya virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |