CN111575351B - DNA detection method based on CRISPR/Cas9 and application thereof - Google Patents

Abstract

The invention discloses a DNA detection method based on CRISPR/Cas9 and application thereof, the method comprises the steps of incubating a DNA molecule to be detected and a pair of dCas9-sgRNA at room temperature to form a dCas9-sgRNA-DNA-dCas9-sgRNA compound, capturing the compound on the surface of a solid phase matrix by using a capture sequence on the sgRNA, capturing a signal reporter molecule, and realizing the detection of the target DNA molecule. The method can quickly and simply realize the detection of the DNA molecules with low femtomolar level without complicated and time-consuming links such as nucleic acid amplification, nucleic acid hybridization and the like in the traditional nucleic acid detection. The invention successfully avoids the key bottleneck problems of nucleic acid hybridization, amplification and the like in the field of nucleic acid detection and typing at present, realizes visualized and ultrasensitive DNA rapid detection, and has extremely wide application value in the field of nucleic acid detection.

Description

DNA detection method based on CRISPR/Cas9 and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a DNA detection method based on CRISPR/Cas9 and application thereof.

Background

DNA detection and genotyping have long been important for basic research, various detection and diagnostic applications. Therefore, DNA detection and genotyping techniques have been receiving much attention, thereby promoting the development of such techniques. In conclusion, there are mainly three types of DNA detection and genotyping techniques that are widely used. The first is a variety of techniques based on the Polymerase Chain Reaction (PCR). PCR is the most commonly used technique for DNA detection and genotyping. PCR-based DNA detection and genotyping relies mainly on the design of specific primers and multiplex PCR amplification. PCR detection can be achieved by traditional PCR (tpcr), quantitative PCR (qpcr), and recently developed digital PCR. Q-PCR is highly popular in almost all research, detection and diagnostic laboratories because of its obvious advantages, such as real-time detection and high sensitivity. More accurate digital PCR has now been developed with great potential and advantages as a clinical testing tool. However, PCR techniques are limited to multiplex amplification and highly specific primers when used to distinguish between highly related genotypes. In addition to PCR, various DNA hybridization techniques such as DNA microarray are widely used for detecting and typing DNA. However, due to its expensive equipment, complicated detection procedures and inevitable nonspecific hybridization, the DNA microarray technology cannot become a conventional DNA detection and genotyping tool like PCR. DNA sequencing is another effective DNA detection and genotyping technique. Particularly with the advent of Next Generation Sequencing (NGS) technology, more and more DNA sequencing tools are available for NGS platforms such as Illumina NovaSeq. However, they are still not as useful for routine research, detection and diagnosis as PCR due to the need for expensive equipment and chemicals. In addition, in recent years, various isothermal amplification techniques for nucleic acids have been developed for nucleic acid detection, such as Rolling Circle Amplification (RCA), Recombinase Polymerase Amplification (RPA), Multiple Displacement Amplification (MDA), loop-mediated isothermal amplification (LAMP), nucleic acid sequence-dependent amplification (NASBA), helicase-dependent amplification (HDA), Nicking Enzyme Amplification Reaction (NEAR), etc., but these techniques all rely on a diverse amplification procedure for a target nucleic acid to detect the nucleic acid.

Ishino et al first discovered Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs) in the genome of escherichia coli (e.coli) in 1987 and was defined by Jansen et al as CRISPRs in 2002. Currently, known CRISPR systems comprise three different types (types I, II and III). Type I and III systems consist of multiple Cas proteins, whereas type II systems require only one Cas protein Cas 9. Cas9 is associated with CRISPR-associated rna (crrna) and trans-activated crrna (tracrrna). The Cas9 nuclease can be activated by TracrRNA, which is complementary to the 20 nucleotide sequence of the target DNA. The latter therefore determines the specificity of the CRISPR-Cas9 system. The crRNA-guided Cas9 nuclease can bind to target DNA adjacent to a Primitive Adjacent Motif (PAM) and cleave the target DNA three bases upstream of the PAM sequence (NGG). The integration of tracrRNA and crRNA into one single guide rna (sgrna) greatly simplifies the application of type II CRISPR systems. Cas9 was guided by the sgRNA to cleave the target DNA. Currently, the CRISPR-Cas9 system is widely used in the field of genome editing by many researchers due to its simplicity and high efficiency. In addition, dCas9(dead Cas9) is formed by modifying Cas9, nuclease activity is lost, a gene transcription Activation Domain (AD) or a gene transcription Inhibition Domain (ID) is reserved, and dCas9(dead Cas9) is widely applied to endogenous gene expression regulation as a novel artificial transcription factor.

Although Cas9/sgRNA has been widely used for gene editing and regulation, it has not been fully explored for use in the field of nucleic acid detection. By virtue of high specificity of DNA recognition and cutting ability (capable of distinguishing single base), Cas9/sgRNA and other CRISPR-associated nucleases (such as Cpf1 and the like) have great potential in DNA detection and typing. More recently, the CRISPR-Cas9 system has been used to detect Zika virus and to be able to type both us and african Zika viruses. Given the high specificity of the tools of CRISPR, CRISPR-Cas9 can achieve single base resolution in differentiating viral strains, allowing typing detection of orthologous bacteria and viruses at the single base level. Recently the CRISPR system (Cas13 a/C2C2 of type III) has been applied to the detection of Zika virus and has an ultra high sensitivity (amount of virus particles as low as 2 aM). These studies indicate that CRISPR systems have great potential and advantages for the development of nucleic acid detection techniques. However, in the currently reported Cas 9-based nucleic acid detection methods, the RNA to be detected is firstly subjected to reverse transcription to form single-stranded DNA, then double-stranded DNA is generated, and then the Cas9/sgRNA system is used for cutting the double-stranded DNA to achieve the purpose of RNA typing. Thus, the Cas9/sgRNA system has not been fully developed for detection and typing of nucleic acids at present.

Based on the sequence-specific cleavage function of the CRISPR system on nucleic acid molecules, the application of the CRISPR system in the field of nucleic acid detection is being developed gradually. In addition to the Cas9 enzyme, applications of other Cas proteins have also demonstrated application value in the field of nucleic acid detection in CRISPR systems. For example, Cas13a (also called C2C2) of the type III CRISPR system has recently been applied to the detection of Zika virus and has an ultra-high sensitivity (the amount of virus particles is as low as 2aM) (this method is named Sherlock) (Science 2017; 356: 438-. However, Sherlock technology can only be used for detecting RNA because it relies on cas13a enzyme which can only cut RNA; if the DNA needs to be detected, a recombinase amplification (RPA) technology is needed to be used for carrying out isothermal amplification on the DNA, a T7 promoter sequence is introduced at the tail end of an amplification product through a primer during amplification, then in-vitro transcription is carried out to generate RNA, then the RNA is subjected to Cas13a specific cleavage, and further the non-specific cleavage activity of the Cas13a on the single-stranded RNA is activated to achieve the purpose of detecting the DNA. The detection technology depends on recombinase amplification and in vitro transcription, and although the detection technology is favorable for improving the sensitivity of detection, the detection process is complicated and the cost is high. Furthermore, based on the property that Cas12a (also referred to as Cpf1) specifically cleaves target double-stranded DNA (dsDNA) followed by non-specific single-stranded DNA (ssDNA), a new technique for detecting target DNA molecules (this method is named Detectr) was developed (Science 2018; 360: 436-439). The Detectr technology can detect amole-grade molecules and has high sensitivity, but like Sherlock, the Detectr also depends on a nucleic acid isothermal amplification process, and is high in cost and time-consuming. Another nucleic acid detection technique similar to Detectr based on Cas12a was named HOLMES (Cell Research 2018; 28: 491-493; Cell Discovery 2018; 4: 20). A similar principle is also proposed for Cas12 b-based HOLMESv2(HOLMES2.0) technology (ACS Synth. biol.2019; 8:2228-2237) that exploits the ssDNA lateral cleavage activity of Cas12 b. The HOLMESv2 technique also relies on an isothermal nucleic acid amplification technique, LAMP or asymmetric pcr (asymmetric pcr) amplification technique. These studies show that the CRISPR system has great potential and advantages when used for developing nucleic acid detection technology, but at present, there exist various nucleic acid amplification technologies, and DNA or RNA needs to be subjected to pre-amplification such as reverse transcription, in vitro transcription, PCR amplification, RPA amplification, LAMP amplification, asymmetric PCR amplification, and the like, so that the CRISPR system can be used for specific cleavage of various Cas proteins (Cas13a, Cas12a, Cas12b) and grnas and non-specific cleavage (signal amplification) detection of fluorescent reporter molecules.

Disclosure of Invention

The purpose of the invention is as follows: aiming at the problems in the prior art, the invention provides a DNA Detection method based on CRISPR/Cas9, which is called CADD for short, namely CRISPR/Cas9 Assisted DNA Detection (CRISPR/Cas9-Assisted DNA Detection). The method can complete DNA detection through three steps, and the DNA detection method of CRISPR/Cas9 can realize the detection of DNA molecules with low to femtomolar (fM) level without complicated procedures such as enzyme reaction, amplification, high-temperature hybridization and the like; in addition, the method realizes efficient DNA molecular typing without traditional procedures such as traditional nucleic acid specific amplification (such as PCR, RPA and the like), high-temperature hybridization (such as chip hybridization), sequencing and the like.

The invention also provides applications of the DNA detection method based on CRISPR/Cas9, including applications in various DNA molecule detection, particularly applications in detection of papilloma virus (HPV).

The technical scheme is as follows: in order to achieve the above object, the DNA detection method based on CRISPR/Cas9 according to the present invention comprises the following steps:

(1) incubating the DNA molecule to be detected with a pair of dCas9-sgRNA at room temperature to form a dCas9-sgRNA-DNA-dCas9-sgRNA compound;

(2) capturing a dCas9-sgRNA-DNA complex to the surface of a solid phase substrate by using a capture sequence on the sgRNA of one dCas 9-sgRNA;

(3) the signal reporter was captured using a capture sequence on the sgRNA of another dCas 9-sgRNA.

Wherein the pair of dCas9-sgRNA in step (1) refers to two dCas9-sgRNA complexes, namely dCas9-sgRNA a and dCas9-sgRNA b; wherein the sgRNA and the sgRNA have different 5 'end target DNA binding sequences and 3' end capture sequences respectively.

Wherein sgRNA means single-guide RNA (single-guide RNA); it differs from the conventional sgRNA in that its 3' end contains a capture sequence, which is a capture sgRNA.

Among them, dCas9 is inactivated Cas9 (inactivated Cas9), and this Cas9 protein loses activity of cutting DNA, but can bind to sgRNA and target-bind to DNA.

Preferably, the preferred sequence of the 3' capture sequence of the sgrna is (SEQ ID No.1) 5'-CGGAA CCTTA CGAAT ACCAG ATGC-3'; the preferred sequence of the capture sequence at the 3' end of the sgRNA is (SEQ ID NO.2) 5'-TACTT CATGT TACAG ACGAC TCCCA C-3' or (SEQ ID NO.3) 5'-ATCTA GTGGA ACCTC AAACA TACC-3'.

Wherein, the target DNA binding sequences of the 5' ends of the sgRNAi and the sgRNAb are both sequences with the length of 20 bp; wherein, when detecting papillomavirus DNA molecules, the preferred sequence of the target DNA binding sequence of the 5' ends of the sgRNA a and the sgRNA b is the sequence described in the description sequence list 1.

Wherein the 5 'end target DNA binding sequences of the sgRNA and the sgRNA are both 20bp long sequences and have the functions of guiding dCas9-sgRNA complex to be bound with target DNA through hybridization with the target DNA to form dCas9-sgRNA-DNA-dCas9-sgRNA complex, and the 5' end target DNA binding sequences of the sgRNA and the sgRNA are shown in SEQ ID NO.4-37 respectively.

Sequence Listing 1, sgRNA sequences targeting 15 hrHPV DNAs, T7 RNA polymerase DNA and TERT promoter (SEQ ID NO.4-37 in order)

Wherein, the method of the invention can detect any target DNA, when detecting papillomavirus DNA molecules, the preferred sequence of the target DNA binding sequence of 5' end of sgRNA a and sgRNA is a pair of the sequence SEQ ID NO.4-33 in the description sequence list 1; when detecting the DNA of the Escherichia coli T7 RNA polymerase, the optimal sequences of the 5' end target DNA binding sequences of the sgRNA and the sgRNA are respectively the sequences SEQ ID NO.34-35 in the sequence table 1; when detecting mutant TERT promoter DNA, the preferred sequences of the target DNA binding sequences of 5' ends of sgRNA and sgRNAb are respectively SEQ ID NO.36-37 of the sequence table 1.

Wherein, the step (2) of capturing the dCas9-sgRNA-DNA complex to the surface of the solid phase matrix by using the capture sequence on the sgRNA means that the dCas9-sgRNA-DNA-dCas9-sgRNA complex can be captured to the surface of a solid phase matrix by using the capture sequence at the 3' end of the sgRNA.

Preferably, the solid phase matrix in step (2) includes various solid phase matrices, such as various microspheres (beads) (e.g., magnetic microspheres, encoded microspheres, polymer microspheres, etc.), microporous plates, glass sheets, nanoparticles (e.g., nanogold), and the like; the surface of the solid phase matrix is fixed with capture oligonucleotide; wherein the sequence of the capture oligonucleotide is base complementary to the 3' capture sequence of the sgRNAa; preferably, the capture oligonucleotide has the sequence (SEQ ID NO.38)5'-GCATC TGGTA TTCGT AAGGT TCCG-3'.

Wherein the capturing of the signal reporter molecule by the capture sequence on the sgRNA in step (3) means that the signal reporter molecule is captured to the dCas9-sgRNA-DNA-dCas9-sgRNA complex by the capture sequence at the 3' end of the sgRNA.

Preferably, the signal reporter molecule in the step (3) is hairpin 1 of hybrid chain reaction; wherein the Hybridization Chain Reaction (HCR) consists of two DNA molecules of Hairpin 1(Hairpin 1) and Hairpin 2(Hairpin 2); wherein the 3' capture sequence (SEQ ID No.39) 5'-TACTT CATGT TACAG ACGAC TCCCA C-3' of sgRNAb can open hairpin 1 by hybridization; the opened hairpin 1 can be crossed with the hairpin 2, and the hairpin 2 is opened; the opened hairpin 2 can be hybridized with the hairpin 1 to open the hairpin 1; so circulating, and forming a continuously prolonged DNA chain; preferably, the 3' end of the hairpin 1 has the sequence (SEQ ID NO.40) 5'-G TGGGA GTCGT CTGTA ACATG AAGTA-3'.

Wherein, hairpin 1 or hairpin 2 or both of the hybrid chain reaction are marked by fluorescent molecules and used for reporting detection signals; wherein, hairpin 1 or hairpin 2 of the hybrid chain reaction can also be double-labeled with a quenching group and a fluorescent molecule to prepare a Molecular Beacon (MB).

Preferably, the signaling reporter molecule in step (3) is a biotin-labeled oligonucleotide, wherein the sequence of the biotin-labeled oligonucleotide is base-complementary to the 3' -capture sequence of the sgrna; preferably, the biotin-labeled oligonucleotide has the sequence (SEQ ID NO.41)5'-TTTTT TGGTA TGTTT GAGGT TCCAC TAGAT-3'.

Wherein, the biotin molecule of the biotin-labeled oligonucleotide can be combined with an enzyme-labeled streptavidin (streptavidin) molecule, wherein the enzyme is preferably Horse Radish Peroxidase (HRP) which can generate a pigment molecule by catalyzing a substrate and is used for reporting a detection signal by detecting a light absorption value; preferably, the substrate is 3,3',5,5' -Tetramethylbenzidine (TMB).

Preferably, the signaling reporter molecule can also be a nanoparticle-labeled oligonucleotide; the nanoparticles include nanogold (AuNPs), Quantum Dots (QDs), and the like; wherein the sequence of the nanoparticle label-derived oligonucleotide is base complementary to the 3' capture sequence of the sgrna; preferably, the sequence of the oligonucleotide in which the nanoparticle is labeled is (SEQ ID NO.41)5'-TTTTT TGGTA TGTTT GAGGT TCCAC TAGAT-3'.

Preferably, the 3' capture sequence of the sgRNA can also be designed into other signal reporting structures, such as RNA Mango structure, MS2 structure, rolling circle primer, Cas13a-sgRNA target, and the like.

By using the technical principle of the invention, the dCas9 can be replaced by other Cas proteins to realize the detection of DNA or RNA, and the detection of RNA can be realized by replacing dCas9 by Cas13a or dCas13 a.

The DNA detection method based on CRISPR/Cas9 is applied to preparation of detection reagents for detecting various DNA molecules. The DNA detection method of the invention can be applied to qualitative and quantitative detection of various DNA molecules.

The DNA detection method based on CRISPR/Cas9 is applied to the preparation of a detection reagent for detecting DNA molecules of papilloma viruses, and can be applied to the qualitative and quantitative detection of DNA molecules of papilloma viruses (HPV); wherein the 5' end target DNA binding sequence of the sgRNA for detecting 15 high-risk papilloma viruses is shown as a sequence SEQ ID NO.4-33 in a sequence table 1.

Wherein the 15 high-risk papillomaviruses refer to HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, HPV68 and HPV 73.

The method can be demonstrated by taking any DNA as a detection material and also taking HPV DNA as a material. In addition, the DNA detection method based on CRISPR/Cas9 provided by the invention designs and proves a set of sgRNAs targeting hrHPV, and basically develops a new technical method for detecting clinical samples of ready-to-use HPV.

Has the advantages that: compared with the prior art, the invention has the following advantages:

the invention develops a novel DNA detection method based on CRSIPR/Cas 9. The method can simply, quickly and super sensitively carry out specific detection and typing on the target DNA molecules. The invention utilizes the specific binding property of the Cas9-sgRNA compound to the target DNA, successfully avoids the key bottleneck problems of DNA hybridization, amplification and the like in the field of DNA detection and typing at present, and realizes the visual, high-specificity and high-sensitivity rapid DNA detection. The novel DNA detection method based on CRSIPR/Cas9 provided by the invention is completely different from the principles of various nucleic acid detection methods (such as Sherlock, Decctector and HOLMES) based on CRISPR systems reported at present in detection principle, and has the most remarkable advantages of being independent of pre-amplification (in vitro transcription, RPA, LAMP and the like) of nucleic acid samples to be detected and independent of enzyme reactions (such as DNA polymerase reaction, Cas protein nucleic acid cleavage reaction and the like). The novel DNA detection method provided by the invention has wide application value in the field of nucleic acid detection.

The novel DNA detection method based on CRSIPR/Cas9 provided by the invention can realize the report of detection signals by a very flexible signal reporting mode. The invention demonstrates CADD methods of three signal reporting modes by examples, which are Beads-HCR CADD, Beads-ELISA CADD and DNA-Bind-ELISA CADD respectively. In the three signal reporting modes, a signal output mode of CADD detection is respectively used for microsphere hybrid chain reaction (Beads-HCR), microsphere enzyme-linked immunosorbent assay (Beads-ELISA) and DNA binding ELISA (DNA-Bind-ELISA). In Beads-HCR, using a fluorescence-labeled HCR hairpin molecule to report a detection signal; in the Beads-ELISA and in the DNA-Bind-ELISA, color reaction was observed by streptavidin-conjugated HRP catalyzed TMB to report the detection signal. Among them, ELISA is an abbreviation of enzyme linked immunosorbent assay in English.

In conclusion, the method can rapidly and simply realize the detection of the DNA molecules with low to femtomolar level without complex and time-consuming links such as nucleic acid amplification, nucleic acid high-temperature hybridization and the like in the traditional nucleic acid detection. The invention utilizes the specificity recognition and combination characteristics of the Cas9-sgRNA compound on DNA molecules, successfully avoids the key bottleneck problems of nucleic acid hybridization, amplification and the like in the field of nucleic acid detection and typing at present, realizes the visual and ultrasensitive rapid DNA detection, and has extremely wide application value in the field of nucleic acid detection. The DNA detection method based on CRISPR/Cas9 can be applied to the preparation of detection reagents for detecting various DNA molecules and also can be applied to the preparation of detection reagents for detecting DNA molecules of papilloma viruses.

Drawings

FIG. 1 is a schematic diagram of the principle of the Beads-HCR CADD, A: schematic diagram of the Beads-HCR CADD. dCas9, dCas9 protein; sgRNA, guide RNA; beads, microspheres; capture; hairpin, Hairpin; target DNA, Target DNA; mix, mixing; bind, Bind; HCR, Hybridization Chain Reaction (Hybridization Chain Reaction); FAM, fluorescein; beads @ FAM, microspheres attached to FAM molecules. B: liquid phase detection of HCR reaction. Initiator, Initiator; initiator oligo, Initiator oligonucleotide. C: adding sgRNA, sgRNA (initiator) and initiator oligo into HCR reaction solution containing Hairpin 1 and Hairpin 2, and detecting reaction products by agarose gel electrophoresis; a reaction without the initiator oligo (no initiator oligo) was used as a negative control. The right side of the electrophoresis chart is the secondary structure of the Hairpin 1 and the Hairpin 2, and the lower side is the sequence and the fluorescence modification of the Hairpin 1 and the Hairpin 2.

FIG. 2 shows the detection of T7 polymerase DNA using the Beads-HCR CADD. A and B: different concentrations of T7 polymerase DNA were detected using the Beads-HCR CADD. A: beads fluorescence images; b: and (5) quantitatively analyzing results of the Beads fluorescence. A linear relationship between DNA concentration and fluorescence signal exists between 100pM and 10 fM. C-D: genomic DNA (gDNA) of both BL21 and DH 5. alpha. bacteria was detected at different concentrations using the Beads-HCR CADD. C: beads fluorescence images; d: and (5) quantitatively analyzing results of the Beads fluorescence. Each field shows bright field and fluorescent images.

FIG. 3 is the detection of TERT promoter DNA using Beads-HCR CADD. A: beads fluorescence images; b: and (5) quantitatively analyzing results of the Beads fluorescence.

FIG. 4 shows the detection of HPV16 DNA using the Beads-HCR CADD. A and B: different concentrations of HPV16 DNA were detected using the Beads-HCR CADD. The sgRNA used targets HPV 16. A: beads fluorescence images; b: and (5) quantitatively analyzing results of the Beads fluorescence. A linear relationship between DNA concentration and fluorescence signal exists between 100pM and 10 fM. C and D: detection of HPV16 and HPV18 DNA (pMD-HPV16 and pMD-HPV18) was performed using the Beads-HCR CADD. C: beads fluorescence images; d: and (5) quantitatively analyzing results of the Beads fluorescence. The sgRNA used targets the sgRNA of HPV16 and HPV18 (sgRNA16 and sgRNA 18). sgRNA cocktail) is an equimolar mixture of sgrnas targeting 15 hrHPV.

FIG. 5 shows the detection of DNA of cervical cancer cell line by Beads-HCR CADD. A: beads fluorescence images; b: and (5) quantitatively analyzing results of the Beads fluorescence. Extracting genome DNA (gDNA) of three cervical cancer cell strains, and detecting three gDNA samples by sgRNA targeting HPV16 and HPV18 respectively.

FIG. 6 shows detection of HPV DNA using Beads-HCR CADD. A and B: detection of HPV16 and HPV18 DNA was performed using the Beads-HCR CADD. The sgRNA used was sgRNA and sgRNA that targeted 15 hrHPV. A: various sgrnas detect Beads fluorescence images of pMD-HPV 16; b: the result of the Beads fluorescence quantitative analysis of pMD-HPV18 detected by various sgRNAs. C-D: the Beads-HCR CADD was used to detect pMD-HPV16 and pMD-HPV 18. C: beads fluorescence images; d: and (5) quantitatively analyzing results of the Beads fluorescence.

FIG. 7 shows HPV DNA detection using Beads-HCR CADD. The DNA of 15 hrHPV were detected using the Beads-HCR CADD. The sgRNA used was sgRNA and sgRNA that targeted 15 hrHPV. A: beads fluorescence images; only the fluorescence images of each DNA detected by its corresponding sgRNA and sgRNAct are shown. B-C: and (3) detecting the result of the quantitative analysis of the fluorescence of the Beads of various HPV DNAs by various sgRNAs. B: quantitative analysis of Beads fluorescence images of each HPV DNA detected by its corresponding sgRNA (left) and sgRNAct (right). C: quantitative analysis of Beads fluorescence images detected by various sgrnas for each HPV DNA. D: results of quantitative analysis (mean fluorescence intensity heatmap) of Beads fluorescence images detected by various sgrnas for each HPV DNA. Both panels C and D show that each HPV DNA was detected by its corresponding sgRNA and sgRNA only, while no fluorescence signal was detected by the other sgrnas.

FIG. 8 is a first HPV clinical sample tested with the Beads-HCR CADD. Beads-HCR CADD was used to test 15 hrHPV infections in 31 clinical samples. The sgRNA used was sgRNA and sgRNA that targeted 15 hrHPV. A: beads fluorescence images; only fluorescence images of sample 36 detected by the various sgrnas are shown (right side is an enlarged view of the sgRNAct detected sample). B: results of quantitative analysis of Beads fluorescence images (mean fluorescence intensity heatmap) for detection of HPV infection in 31 clinical samples by various sgrnas. C: comparison of the results of PCR and CADD detection of HPV infection in 31 clinical samples. PCR detection is finished by a general hospital in the east war zone; hrHPV: high risk HPV; PCR-rd: HPV45 in samples 2 and 37 and HPV59 in sample 11 were again detected by specific PCR amplification.

FIG. 9 shows the re-detection of HPV45 in samples 2 and 37 and HPV59 infection in sample 11 by specific PCR amplification. A pair of HPV45 and HPV59 specific primers were designed to amplify different DNA samples (templates), respectively.

FIG. 10 shows the detection of HPV16 DNA using Beads-ELISA CADD. A: the principle of the Beads-ELISA CADD is shown schematically. B: different concentrations of HPV16 DNA were detected with Beads-ELISA CADD. The sgRNA used targets HPV16(sgRNA 16). The pictures show imaging of a TMB developed microplate. Each column is four repeats. C: quantitative analysis of TMB color development absorbance. A linear relationship between DNA concentration and absorbance exists between 100pM and 1 fM. D: absorption spectra measured with a microplate.

FIG. 11 is detection of HPV DNA using Beads-ELISA CADD. The DNA of 15 hrHPV were detected using Beads-ELISA CADD. The sgRNA used was sgRNA and sgRNA that targeted 15 hrHPV. A: Beads-ELISA microplate image; images of Beads-ELISA microplates with each HPV DNA detected by a variety of sgRNAs are shown. B: results of quantitative analysis of absorbance of Beads-ELISA microplates in A (heat map). C: DNA samples formed from a mixture of two different HPV DNAs were detected with different sgrnas. The images of the Beads-ELISA microplates are shown. D: results of quantitative analysis of the absorbance of the Beads-ELISA microplates in C (heat map). E: clinical samples of HPV were tested with Beads-ELISA CADD (for specificity). The right-hand table shows the DNA samples (text) in each well and the sgRNAs used (color: dark grey for sgRNA; light grey for sgRNA sp; sgRNA sp indicates the specific sgRNA, i.e.the sgRNA for detection of a certain HPV, of the same type as the DNA samples in the same column).

FIG. 12 shows the detection of HPV16 DNA using DNA-Bind-ELISA CADD. A: schematic representation of DNA-Bind-ELISA CADD. B: different concentrations of HPV16 DNA were detected using DNA-Bind-ELISA CADD. The sgRNA used targets HPV16(sgRNA 16). The pictures show imaging of a TMB developed microplate. Each column is three replicates. C: quantitative analysis of TMB color development absorbance. A linear relationship between DNA concentration and absorbance exists between 100pM and 1 fM.

FIG. 13 is a second HPV clinical sample tested with DNA-Bind-ELISA CADD. DNA-Bind-ELISA CADD was used to detect infection of 15 hrHPV in 33 clinical samples. The sgRNA used was sgRNA and sgRNA that targeted 15 hrHPV. A: imaging the DNA-Bind-ELISA micropore plate; pMD-HPVct is a mixture containing 15 plasmids (pMD-HPV 16-pMD-HPV 73) and is used as a positive control; empty plasmid pMD served as negative control. B: DNA-Bind-ELISA absorbance quantitative analysis results (heat maps) of HPV infection in 33 clinical samples were detected by each sgRNA. C: comparison of the results of PCR and CADD detection of HPV infection in 33 clinical samples. PCR detection is finished by a general hospital in the east war zone; hrHPV: high risk HPV; recaDD: the 5 samples were again tested for HPV infection using DNA-Bind-ELISA CADD. D and E: the 5 samples were again tested for HPV infection using DNA-Bind-ELISA CADD. D: imaging the DNA-Bind-ELISA micropore plate; e: DNA-Bind-ELISA Absorbance quantification assay results (heat map).

Detailed Description

The invention is further illustrated by the following figures and examples.

Example 1

Detection of E.coli T7 RNA polymerase by Beads-HCR CADD

1.1, experimental method:

1.1.1 preparation of sgRNA in vitro transcription template by PCR amplification method

Chop-Chop using online sgRNA design software (http://chopchop.cbu.uib.no/) For each DNA molecule to be tested, a pair of sgrnas, named sgRNA a for binding to a Capture oligonucleotide (Capture 1c) immobilized on the surface of a magnetic bead or a microwell plate and sgRNA for binding to an oligonucleotide of a Capture reporter molecule, were designed using hg19 as a reference genome (fig. 1A, fig. 10A, fig. 12A). And synthesizing a PCR primer according to a design result, and using the PCR primer to prepare a DNA template of the sgRNA by using an in vitro transcription method through PCR amplification. In example 1, a pair of sgrnas (table 1.1) was designed for T7 RNA polymerase DNA to be tested, and corresponding PCR primers (table 1.2) were designed.

TABLE 1.1 sgRNA targeting T7 RNA polymerase DNA (SEQ ID NO.34-35 in order)

TABLE 1.2 PCR primers for preparing T7 RNA polymerase sgRNA in vitro transcription template

Primer name	Sequence (5 '-3')
		F1	GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTG
Ra	AAAAAAAAGCATCTGGTATTCGTAAGGTTCCGCACCGACTCGGTGCCACTTTTTC
		Rb	GTGGGAGTCGTCTGTAACATGAAGTAGCACCGACTCGGTGCCACTTTTTC
sgRa	AAAAAAAAGCATCTGGTATTCGTAAGGTTC
		sgRb	GTGGGAGTCGTCTGTAACATGAAGTAG
T7_a_F2	CTGCGGTTGAAGCAATGAACGTTTTAGAGCTAGAAATAGCAAG
		T7_a_F3	TTCTAATACGACTCACTATAGCTGCGGTTGAAGCAATGAAC
T7_b_F2	CCCACACTACAGTCTTACGAGTTTTAGAGCTAGAAATAGCAAG
		T7_b_F3	TTCTAATACGACTCACTATAGCCCACACTACAGTCTTACGA

All primers were dissolved in ultrapure water and diluted to 10. mu.M. The double-stranded DNA fragment with the T7 promoter sequence 5' was amplified by three PCR using the oligonucleotides listed in table 1.2 as a DNA template for sgRNA preparation by in vitro transcription. The specific process is as follows: a first PCR (PCR1) was performed with F1 and R (Ra or Rb) (7 cycles). A second PCR (30 cycles) was performed using the product of the first PCR as template, with all sequences in table 2 with F2 and sgR (sgRa or sgRb) as primers (PCR 2); a third PCR (30 cycles) was performed using the product of the second PCR as template, all sequences with F3 in table 2 and sgR (sgRa or sgRb) as primers (PCR 3). The PCR1 reaction system (50. mu.L) was: 1 is prepared from

HS (Premix; # R040A; Takara), 0.2. mu. M F1, 0.1. mu. M R. The PCR1 reaction program was: 3 minutes at 95 ℃; 5-10 cycles: 95 ℃ for 20 seconds, 58 ℃ for 15 seconds and 72 ℃ for 40 seconds; 5 minutes at 72 ℃. The PCR2 reaction system (50. mu.L) was: 1 is prepared from

HS (Premix; # R040A; Takara), 0.2. mu. M F2, 0.2. mu.M sgR and 5-10 ng of PCR1 reaction product. The PCR2 reaction program was: 3 minutes at 95 ℃; 25 cycles: 95 ℃ for 20 seconds, 58 ℃ for 15 seconds and 72 ℃ for 40 seconds; 5 minutes at 72 ℃. The PCR3 reaction system is as follows: 1 is prepared from

HS (Premix; # R040A; Takara), 0.2. mu. M F3, 0.2. mu.M sgR, 5ng of PCR2 reaction product. The PCR3 reaction program was: 3 minutes at 95 ℃; 28-30 cycles: 95 ℃ for 20 seconds, 58 ℃ for 15 seconds and 72 ℃ for 40 seconds; 5 minutes at 72 ℃. The PCR reaction program was performed on a PCR instrument Mastercycler Pro (Eppendorf). After the PCR1 reaction is finished, the reaction product is subjected to agarose gel electrophoresis, and after gel cutting and recovery, the obtained amplification product is used as a template for the next round of PCR. After completion of PCR2 and PCR3, the reaction solution was purified by PCR using a PCR clean recovery Kit (EasyPure PCR Purification Kit, Transgen).

1.1.2 preparation of sgRNA by in vitro transcription

The purified sgRNA transcription template with the T7 promoter sequence was transcribed in vitro by incubation with T7 RNA polymerase (New England Biolabs) overnight at 37 ℃. The transcription reaction system (20. mu.L) was: 50U T7 RNA polymerase (M0251S; NEB), 1 XT 7 RNA polymerase buffer (NEB), 2mM rNTP (each; NEB) and 1000ng DNA template. Mixing in vitro transcribed RNA with Trizol solution, extracting RNA product with chloroform and isopropanol, precipitating with ethanol, dissolving purified RNA in DEPC water, diluting each sgRNA to working concentration of 300nM after quantification, subpackaging, and freezing at-80 deg.C for use. A pair of sgrnas (sgRNA and sgRNA) each having a 5 '20 bp specific sequence binding to the target DNA and a 3' capture sequence was prepared for each target DNA.

The sgRNA prepared in example 1 was used to detect T7 RNA polymerase DNA, wherein the 5' -end target DNA binding sequences of sgRNA and sgRNA are shown in table 1.1; the 3' capture sequences of sgRNAa and sgRNAb were 5'-CGGAA CCTTA CGAAT ACCAG ATGC-3' and 5'-TACTT CATGT TACAG ACGAC TCCCA C-3', respectively.

1.1.3 preparation of hybrid Strand reaction (HCR) hairpins

FAM-hairpin-1(5'-FAM-ACAGA CGACT CCCAC ATTCT CCAGG TGGGA GTCGT CTGTA ACATG AAGTA-3') and FAM-hairpin-2(5'-CTGGA GAATG TGGGA GTCGT CTGTT ACTTC ATGTT ACAGA CGACT CCCAC-FAM-3') oligonucleotides were synthesized. Meanwhile, oligonucleotide Initiator (5'-TACTT CATGT TACAG ACGAC TCCCA C-3') is synthesized for detecting the preparation effect of hairpin-1 and FAM-hairpin-2 in liquid phase. 5 XTE buffer (50mM Tris-HCl, pH8.0, 5mM EDTA) was prepared for use. The above oligonucleotides were dissolved in 100. mu.M aqueous solution using TE buffer (10mM Tris-HCl, pH8.0, 1mM EDTA) as a stock solution. The working solution concentration of FAM-hairpin-1 and FAM-hairpin-2 was 10. mu.M. When preparing HCR hair clasp body (hairpin), respectively taking 30 μ L FAM-hairpin-1 and FAM-hairpin-2, placing into two EP tubes, heating to 95 deg.C, maintaining for 5 min, naturally cooling to room temperature, and storing at 4 deg.C for use. A liquid phase HCR reaction system (20. mu.L) for evaluating the effect of producing hairpin-1 and FAM-hairpin-2 contained 0.2. mu.M FAM-hairpin-1, 0.2. mu.M FAM-hairpin-2, and 30nM Initiator (or sgRNA). After mixing, the mixture was reacted at room temperature for 20 minutes, and then detected by electrophoresis.

1.1.4 preparation of oligonucleotide-modified magnetic beads

The oligonucleotide RE-flashing (5'-Biotin-TTTTT TTGCA TCTGG TATTC GTAAG GTTCC G-3') was chemically synthesized and used as Capture 1 c. The oligonucleotide was dissolved in 100. mu.M aqueous solution using TE buffer as a stock solution. The working solution concentration of the oligonucleotide RE-flashing was 10. mu.M. Magnetic beads (Dynabeads) were coupled with this oligonucleotide^TMM-280 Streptavidin; invitrogen), the beads are first shaken up in a bead storage bottle, and then 1. mu.L of beads are taken out, the amount of the beads taken out is 10. mu.g, and the number of the corresponding beads is about 6 to 7X 10⁵And (4) magnetic beads. 1 XHCR reaction buffer (5mM MgCl)₂0.3M NaCl, 0.1% BSA, 10mM Tris-HCl, pH8.0, 1mM EDTA), washing the magnetic beads twice by magnetic separation, adding 2. mu.L RE-annealing oligonucleotide with the concentration of 10. mu.M, uniformly mixing for 20 minutes at room temperature, washing the magnetic beads for 3 times by using 1 XHCR reaction buffer solution, and placing the coated magnetic beads at 4 ℃ for later use. The DNA-coated magnetic Beads were simply named Beads @ oligo.

1.1.5 preparation of bacterial genomic DNA and T7 RNA polymerase DNA fragments

The two kinds of bacteria of BL21 and DH5a were cultured in LB liquid medium, and 20mL of genomic DNA (gDNA) of two kinds of E.coli of BL21 and DH5a were extracted with a genomic DNA extraction kit (B610423; Shanghai, Ltd.), respectively. As HCR detection substrate after sonication fragmentation was used. T7 RNA polymerase fragment was amplified from BL21 gDNA in a PCR reaction (50. mu.L) of: 1 is prepared from

HS, 0.2. mu. M T7-F, 0.2. mu. M T7-R and 5ng gDNA; PCR processThe sequence is as follows: 5 minutes at 98 ℃; 10 seconds at 98 ℃, 15 seconds at 58 ℃, 1 minute at 72 ℃ and 28 cycles; 72 ℃ for 5 minutes. The amplification product is 651 bp. The fragment was recovered and purified by gel as a substrate for HCR detection. The primer sequence is as follows: 5'-GAGTT CGGCT TCCGT CAACA AGTG-3' (T7-F) and 5'-GTCCA ATTGA GACTC GTGCA ACTG-3' (T7-R).

1.1.6 Beads-HCR detection reaction system and method

Recombinant dCas9 protein (dCas9 nucleic, S. biogenes, M0652, New England Biolabs), RNase inhibitor (RNaseOUT)^TMRecombinant ribonuclear Inhibitor, Invitrogen). Preparation of 5 × HCR reaction buffer: 25mM MgCl₂1.5M NaCl, 0.5% BSA in 5 XTE buffer.

Reaction system for HCR detection: (20. mu.L): 1 xHCR reaction buffer, 15nM sgRNA, 30nM dCas9 protein, 1 ~ 4 x 10⁴Beads @ oligo, DNA sample (specific amount added according to reaction need, see each result figure), 40U rnase inhibitor. Incubate for 15 minutes at room temperature (25 ℃) and spin the mixture through the whole process.

After the reaction, the magnetic beads were magnetically separated and washed 3 times with 1 × HCR reaction buffer. After the last wash to remove the solution, 20. mu.L of the prepared HCR reaction solution was added to the beads. The HCR reaction solution contains: 0.2. mu.M FAM-hairpin-1, 0.2. mu.M FAM-hairpin-2, and 1 XHCR reaction buffer (preparation method: 4. mu.L of 5 XHCR reaction buffer, 0.4. mu.L of 10. mu.M FAM-hairpin-1, 0.4. mu.L of 10. mu.M FAM-hairpin-2, and 15.2. mu.L of water). Reacting at room temperature for 20 minutes, rotating and mixing the whole process uniformly, and keeping the magnetic beads in a suspension state. After the reaction is finished, a cylindrical magnet with the diameter of 0.3mm and the length of 1cm is vertically placed below the center of the glass slide, the distance between the upper surface of the magnet and the glass slide is kept to be about 1cm, then the magnetic bead reaction liquid is dripped on the glass slide after being resuspended, the glass slide is covered by a cover glass, then the glass slide is quickly taken up, and the glass slide is placed on a microscope stage to be static for 1 minute and then is photographed and detected by a fluorescence microscope.

HCR results analysis procedure for magnetic beads: the images taken with the fluorescence microscope were analyzed with the Image pro program. First, the area information of numerous monodisperse magnetic beads under the microscope is counted to find that the average area of the magnetic beads can be considered as 1600, next, all the fluorescence-generating regions are considered as one magnetic bead if the area is smaller than 1600, two magnetic beads are considered between 1600 and 3200, and so on. Next, the average fluorescence intensity multiplied by the area given by Image pro software is divided by the area of the magnetic bead corresponding to the area to obtain the total fluorescence value of the light emitting region, and then the total fluorescence value of all the effective regions is summed and divided by the real total area of the magnetic bead (1600 × number of magnetic beads), and the obtained average value is used as the average fluorescence value of the whole field. And obtaining a corresponding standard curve and an average fluorescence value of each magnetic bead according to each group of experimental results.

1.2, experimental results:

1.2.1 detection principle of Beads-HCR CADD and HCR system verification

FIG. 1A is a schematic diagram reflecting the principle of detection of target DNA by Beads-HCR CADD. After a pair of dCas9-sgRNA (dCas9-sgRNA and dCas 9-sgRNA) is combined with target DNA, a dCas9-sgRNA-DNA complex is grabbed to the surface of microspheres (beads) by using a capture sequence on the sgRNA; after the microspheres are washed only, two kinds of hairpin DNA (hairpin 1 and hairpin 2) for hybrid strand reaction (HCR) are added, and the hybrid strand reaction is initiated by hybridization of the capture sequence of sgRNA and hairpin 1, resulting in the generation of a fluorescent signal on the surfaces of the microspheres. FIG. 1B shows the secondary structures of hairpin 1 and hairpin 2.

To examine whether the designed HCR reaction was feasible, the prepared hairpin 1 and hairpin 2 were tested with sgrna + sgrna, initiator oligo, respectively. As a result, as shown in fig. 1C, it was found that the HCR reaction was initiated only when sgrna was present in the HCR reaction, and it was confirmed that the HCR reaction was initiated by hybridization of the capture sequence of sgrna with hairpin 1. The initiator oligo is a positive control, and it can also hybridize with hairpin 1, initiating the HCR reaction. While no HCR reaction occurred without addition of sgrna to the initiator oligo.

1.2.2 gradient assay of T7 RNA polymerase DNA

T7 RNA polymerase DNA, the gradient range is: 100pM, 10pM, 1pM, 100fM, 10fM, 1fM, 0M. The above different concentrations of T7 RNA polymerase DNA were detected by the Beads-HCR reaction, respectively. The results are shown in FIG. 2, in which FIG. 2A shows fluorescence images of Beads when different concentrations of DNA were detected, and FIG. 2B shows the results of quantitative analysis of the fluorescence of Beads. It can be seen that the Beads-HCR CADD can quantitatively detect the DNA of T7 RNA polymerase.

1.2.3 detection of gDNA of two bacteria

To further examine the detection specificity of the Beads-HCR CADD, different amounts of two types of E.coli genomic DNA (gDNA) were extracted and solubilized in equal volumes. gDNA was detected with sgRNA targeting T7 RNA polymerase DNA. The results are shown in FIGS. 2C and 2D, in which FIG. 2C shows fluorescence images of Beads when detecting DNA of different numbers of bacteria, and FIG. 2D is the result of quantitative analysis of the fluorescence of Beads. It can be seen that the Beads-HCR CADD not only can quantitatively detect BL21 bacteria containing T7 RNA polymerase DNA, but also has good specificity (no signal can be detected by DH5 alpha bacteria containing no T7 RNA polymerase DNA in various concentrations).

Example 2

Detection of mutant TERT promoter DNA Using Beads-HCR CADD

2.1, experimental method:

2.1.1 preparation of sgRNA in vitro transcription template by PCR amplification method

The same as 1.1.1 of example 1. Sgrnas designed to target mutant TERT promoter DNA are shown in table 2.1. Primers for PCR preparation of sgRNA transcription templates are shown in table 2.2.

TABLE 2.1 sgRNA targeting TERT promoter DNA (SEQ ID NO.36-37 in order)

TABLE 2.2 PCR primers for preparing template for in vitro transcription of the TERT promoter sgRNA

Primer name	Sequence (5 '-3')
		F1、Ra、Rb、sgRa、sgRb	As in Table 1.1
TERT-a-sgRNA-F2	GGACCGCGCTCCCCACGTGGGTTTTAGAGCTAGAAATAGCAAG
		TERT-a-sgRNA-F3	TTCTAATACGACTCACTATAGGGACCGCGCTCCCCACGTGG
TERT-b-sgRNA-F2	TCCCCGGCCCAGCCCCTTCCGTTTTAGAGCTAGAAATAGCAAG
		TERT-b-sgRNA-F3	TTCTAATACGACTCACTATAGTCCCCGGCCCAGCCCCTTCC

2.1.2 preparation of sgRNA by in vitro transcription

The preparation method is the same as 1.1.2 of example 1.

The sgRNA prepared in example 2 was used to detect mutant TERT promoter DNA, wherein the 5' end target DNA binding sequences of sgRNA and sgRNA are shown in table 2.1; the 3' capture sequences of sgRNAa and sgRNAb were 5'-CGGAA CCTTA CGAAT ACCAG ATGC-3' and 5'-TACTT CATGT TACAG ACGAC TCCCA C-3' or 5'-ATCTA GTGGA ACCTC AAACA TACC-3', respectively.

2.1.3 preparation of HCR hairpins

The same as 1.1.3 of example 1.

2.1.4 preparation of oligonucleotide-modified magnetic beads

Same as 1.1.4 of example 1.

2.1.5 preparation of TERT promoter DNA fragment

Using genomic DNA extracted from HepG2 cells as a template for PCR, PCR reactionShould (50 μ L) be: 1 is prepared from

HS, 0.2. mu.M TERT-F, 0.2. mu.M TERT-R and 20ng gDNA; the PCR procedure was: 5 minutes at 98 ℃; 10 seconds at 98 ℃, 15 seconds at 58 ℃, 1 minute at 72 ℃ and 28 cycles; 72 ℃ for 5 minutes. The amplification product is 235 bp. The fragment was recovered and purified by gel as a substrate for HCR detection. The primer sequence is as follows: 5'-AGTGG ATTCG CGGGC ACAGA-3' (TERT-F) and 5'-CAGCG CTGCC TGAAA CTC-3' (TERT-R). The fragment is recovered and purified by gel, and sequencing confirms that the target base (rs1327649395) in the sequence is the wild-type TERT promoter, and the fragment is used as the wild-type TERT promoter sample for HCR detection.

Design a pair of point mutation primers (PM-5' -CGGGT CCCCG GCCCA GCCCC)

TCCG GGCCC TCCCA GCCCC TCC-3'(PM-F)；5'-GGAGG GGCTG GGAGG GCCCG GA

GG GGCTG GGCCG GGGAC CCG-3' (PM-R); the boxed base is a base for introducing mutation; CG for the wild-type TERT promoter and TA for the mutant TERT promoter). PCR amplification was performed using 5ng of the wild type TERT promoter fragment amplified from the HepG2 genome as template and TERT-F and PM-R, PM-F and TERT-R, respectively, as amplification primers. And (3) recovering the amplification products through electrophoresis gel cutting, taking 20ng of each of the two products as an amplification template, using TERT-F and TERT-R primers, carrying out PCR reaction for 5 cycles without adding the primers, and adding the primers for subsequent 23 cycles to continue amplification. And performing gel detection and gel cutting recovery on the amplification product, and verifying the success of mutation through sequencing. This fragment was used as a sample of mutant TERT promoter for HCR detection.

2.1.6 Beads-HCR detection reaction system and method

Reaction for HCR detection (20. mu.L): 1 xHCR reaction buffer, 15nM sgRNA, 30nM dCas9 protein, 1 ~ 4 x 10⁴Beads @ oligo, 10pM DNA, 40U RNase inhibitor. Incubation at room temperature (25 ℃) for 15 minutes with full rotationAnd (5) uniformly mixing.

The procedure for detecting the Beads-HCR and the method for analyzing the results were the same as those of example 1, 1.1.6.

The experimental results are as follows:

wild type and mutant TERT promoter DNA were detected by the Beads-HCR reaction, respectively. The results are shown in FIG. 3, in which FIG. 3A shows fluorescence images of Beads when different concentrations of DNA were detected, and FIG. 3B shows the results of quantitative analysis of the fluorescence of Beads. It can be seen that Beads-HCR CADD can specifically detect mutant TERT promoter DNA. The mutant telomerase reverse transcriptase (TERT) promoter causes telomerase expression in cells, leading to malignant proliferation of cells. Telomerase expression is caused by mutations in the TERT promoter in more than 90% of tumor cells.

Example 3

Detection of HPV DNA Using Beads-HCR CADD

3.1, experimental method:

3.1.1 preparation of sgRNA in vitro transcription template by PCR amplification method

The same as 1.1.1 of example 1. Sgrnas designed to target DNA of 15 high-risk HPV (hrHPV) types are shown in table 3.1. Primers for PCR preparation of sgRNA transcription templates are shown in table 3.2.

Table 3.1 sgrnas targeting 15 hrhpvdnas. The same as sequence table 1.

TABLE 3.2 PCR primers for preparing 15 hrHPVsgRNA in vitro transcription templates

3.1.2 preparation of sgRNA by in vitro transcription

The preparation method is the same as 1.1.2 of example 1.

The sgRNA prepared in example 3 is used for detecting HPV DNA, wherein the 5' -end target DNA binding sequences of sgRNA a and sgRNA b are the same as the sequences SEQ ID NO.4-33 described in the sequence table 1; the 3' capture sequences of sgRNAa and sgRNAb were 5'-CGGAA CCTTA CGAAT ACCAG ATGC-3' and 5'-TACTT CATGT TACAG ACGAC TCCCA C-3' or 5'-ATCTA GTGGA ACCTC AAACA TACC-3', respectively.

3.1.3 preparation of HCR hairpins

The same as 1.1.3 of example 1.

3.1.4 preparation of oligonucleotide-modified magnetic beads

Same as 1.1.4 of example 1.

Cloning plasmid for 3.1.5, 15 kinds of hrHPV L1 fragments

In a previous study (Analytical and biological Chemistry, 2018, 410: 2889-2900) of the inventor, 15 full-length fragments of hrHPV L1 were cloned in pMD plasmid to prepare 15 hrHPV standards including pMD-HPV16, pMD-HPV18, pMD-HPV31, pMD-HPV33, pMD-HPV35, pMD-HPV39, pMD-HPV45, pMD-HPV51, pMD-HPV52, pMD-HPV56, pMD-HPV58, pMD-HPV59, pMD-HPV66, pMD-HPV68 and pMD-HPV 73. The plasmid is used to transform colibacillus, and various plasmid DNAs and empty plasmid pMD are extracted by an alkaline lysis method.

3.1.6 HPV detection clinical sample DNA acquisition and detection

A detection kit (PCR-reverse dot hybridization method) for genotyping (23 type) human papilloma virus of the company Limited in the Shenzhen is used. The kit is used for extracting cervical cell DNA samples. Then, HPV detection was carried out using the kit (PCR-reverse dot hybridization method). After two clinical samples were tested clinically in this way, the first clinical sample DNA (31) was tested by the Beads-HCR CADD method and the second (33) was tested by the DNA-Bind-ELISA CADD method.

3.1.7 Beads-HCR detection reaction system and method

Single target HCR detection reaction system (20 μ L): 1 xHCR reaction buffer, 15nM sgRNA, 30nM dCas9 protein, 1 ~ 4 x 10⁴Beads @ oligo, DNA sample (added as needed), 40U RNase inhibitor. Incubate for 15 minutes at room temperature (25 ℃) and spin the mixture through the whole process.

Multi-target HCR detection reaction system (20 μ L): 1 XHCR reaction buffer, 15nM XN sgRNA, 15nM XN dCas9 protein, 1-4X 10⁴Beads @ oligo, DNA sample (added as needed), 40U RNase inhibitor. Where N is the number of targets detected (e.g., 2 for both HPV16 and HPV 18). Incubate for 15 minutes at room temperature (25 ℃) and spin the mixture through the whole process.

The reaction procedure, conditions and method of analyzing HCR results of magnetic beads were the same as in example 1.

3.1.8 PCR verification of Beads-HCR test results of clinical samples

To verify the mixed infection status of samples No.2, 11 and 37 in the first clinical samples, the following primers were designed to amplify the L1 specific sequences of HPV45 and HPV59, respectively. The primer sequence is as follows: 5'-TTCTG TGGCC AGAGT TGTCA-3' (HPV45-test-F), 5'-ACAGT TGTTC ACGGC GTAGG-3' (HPV45-test-R), 5'-TAGGT GTTGA AATCG GTCGG G-3' (HPV59-test-F) and 5'-AGACT TGCGA CGCTT AACAC-3' (HPV 59-test-R).

The target sequences were first amplified using the cloning vectors of HPV45 and HPV59, pMD empty vector, clinical sample and the genome of HeLa cells, respectively, as templates, and the PCR reaction (50 μ L) was: 1 × Hieff^TMPCR Master Mix, 0.2. mu.M forward primer (HPV45-test-F or HPV59-test-F), 0.2. mu.M reverse primer (HPV45-test-R or HPV59-test-R) and template DNA (wherein the genome usage amount of clinical samples and HeLa cells is 20ng, and the cloning vector is 1 ng); the PCR procedure was: 5 minutes at 98 ℃; 10 seconds at 98 ℃, 15 seconds at 58 ℃, 1.5 minutes at 72 ℃ and 28 cycles; 72 ℃ for 5 minutes. Wherein the amplification product of HPV45 is 722bp, and the amplification product of HPV59 is 1208 bp. The amplification products were detected using 1% agarose gel electrophoresis.

3.2, results of the experiment

3.2.1 gradient detection of HPV16 plasmid DNA

Different concentrations of pMD-HPV16(100pM, 10pM, 1pM, 100fM, 10fM, 1fM, 100aM) were detected by the Beads-HCR method. The results are shown in FIGS. 4A and 4B, where FIG. 4A shows the images of Beads fluorescence detecting different concentrations of DNA and FIG. 4B is the result of quantitative analysis of the Beads fluorescence. It can be seen that the Beads-HCR CADD can quantitatively detect pMD-HPV16 DNA.

3.2.2 typing assays for HPV16 and HPV18

To examine the specificity of the Beads-HCR method for HPV detection preliminarily, pMD-HPV16 and pMD-HPV18 were first detected using the Beads-HCR method. Detecting pMD-HPV16 and pMD-HPV18 DNA of 1pM by using sgRNA16, sgRNA18 and sgRNA; wherein sgRNA is an equimolar mixture (cocktail) of specific sgRNAs (sgRNAs sp) of 15 hrHPVs. The results are shown in FIGS. 4C and 4D, wherein FIG. 4C shows the Beads fluorescence image for detection of pMD-HPV16 and pMD-HPV18 DNA, and FIG. 4D is the result of quantitative analysis of the fluorescence of the Beads. It can be seen that the Beads-HCR CADD can specifically detect two HPV DNA.

3.2.3 detection of gDNA of three cervical carcinoma cells

In order to preliminarily investigate whether the Beads-HCR method can detect HPV DNA in similar actual clinical sample DNA, gDNA of three cervical cancer cell lines is extracted. HeLa cells are known as HPV 18-infected cervical cancer cell lines, SiHa cells are known as HPV 16-infected cervical cancer cell lines, and C-33a is known as HPV infection-free cervical cancer cell line. The sgrnas 16, 18, and sgRNAct were used to detect gdnas from three cervical cancer cell lines, respectively. The results are shown in FIG. 5, where FIG. 5A shows the Beads fluorescence image of 3 gDNA samples detected, and FIG. 5B is the result of quantitative analysis of the Beads fluorescence. It can be seen that the Beads-HCR CADD can specifically detect HPV DNA in gDNA.

Typing detection of 3.2.4, 15 hrHPV

In order to systematically detect 15 hrHPV, the sgRNA and sgRNA targeting 15 hrHPV were used to detect DNA of 15 hrHPV (pMD-HPV 16-pMD-HPV 73). The empty vector pMD served as a negative control. Partial results are shown in fig. 6 and 7, in which fig. 6A and 6B show Beads fluorescence images for detecting pMD-HPV16 and pMD-HPV18, respectively, using sgrnas and sgrnacts targeting 15 hrHPV. It can be seen that the designed sgrnas targeting 15 hrHPV have high specificity. To show the Beads images more clearly, fig. 6C and 6D show the Beads fluorescence image and bright field image of pMD-HPV31 detected with sgRNA and sgRNA targeting HPV31, respectively. Fig. 7A shows Beads fluorescence images of detection of 15 hrHPV DNAs using sgRNA and sgRNAct targeting 15 hrHPV, respectively. In the figure, only Beads fluorescence images of each DNA detected by its corresponding sgRNA and sgRNA are shown, and many negative images detected by other sgrnas are shown. Fig. 7B shows the results of quantitative analysis of Beads fluorescence images of each DNA detected by its corresponding sgRNA and sgRNA. Fig. 7C shows overall results of quantitative analysis of Beads fluorescence images for detection of 15 hrHPV DNAs with sgRNA and sgRNAct of 15 hrHPV, respectively; fig. 7D shows overall average fluorescence values of Beads fluorescence images of 15 hrHPV DNAs detected with sgRNA and sgRNAct of 15 hrHPV, respectively, in a heat map. As can be seen from fig. 7C and fig. 7D, each HPV DNA was able to detect a signal only by its corresponding sgRNA and sgRNA, while none of the other sgrnas detected a signal, and the negative control DNA pMD was unable to detect a signal by all sgrnas, indicating that the designed sgRNA had a high specificity in detecting 15 hrHPV DNAs.

3.2.5 detection of HPV clinical samples

To examine whether sgrnas designed for 15 hrHPV DNAs were used to detect HPV clinical samples, sgrnas and sgrnacts targeting 15 hrHPV were used to detect 31 clinical sample DNAs, respectively, with 150ng of DNA used for each detection reaction. The results are shown in fig. 8, in which fig. 8A shows the beads fluorescence image in which sample No.36 was detected with each sgRNA, and in which the beads fluorescence image and bright field image in which the sample was detected with sgRNA were also enlarged. Fig. 8C shows overall average fluorescence values of Beads fluorescence images of 31 clinical samples detected with sgrnas and sgrnacts of 15 hrHPV, respectively, in a heat map. FIG. 8C shows a comparison of the results of 31 clinical samples tested by the Beads-HCR CADD and PCR-reverse dot blot hybridization (shown in PCR column in FIG. 8C), which shows that the Beads-HCR CADD accurately tests whether 15 hrHPV in these samples are infected with (yes or no) and the typing; in addition, the Beads-HCR CADD assay also found mixed infection in samples 2, 11 and 37 that was not detected by the PCR-reverse dot hybridization method; these mixed infections were then confirmed by specific PCR amplification (PCR-rd) (FIG. 9), indicating that the detection results of this method are more accurate.

Example 4

Detection of HPV DNA with Beads-ELISA CADD

4.1, experimental method:

4.1.1 preparation of sgRNA in vitro transcription template by PCR amplification method

The same as 1.1.1 of example 1. In the preparation of sgRNA in vitro transcription templates using PCR, the primer Rb is replaced with the primer Rc and sgRc is used instead of sgRb. This substitution resulted in the final preparation of sgRNA with a different 3' capture sequence than the sgRNA used in the above-described Beads-HCR assays, facilitating use in Beads-ELISA and subsequent DNA-Bind ELISA assays.

Table 4.1 sgRNA targeting 15 hrHPV DNAs. The same as sequence table 1.

TABLE 4.2 PCR primers for preparation of 15 hrHPV sgRNA in vitro transcription templates

4.1.2 preparation of sgRNA by in vitro transcription

The preparation method is the same as 1.1.2 of example 1. The sgRNA prepared can be used to capture the oligonucleotide re-biotin.

The sgRNA prepared in example 4 is used for detecting HPV DNA, wherein the 5' -end target DNA binding sequences of sgRNA a and sgRNA b are the same as the sequences SEQ ID NO.4-33 described in the sequence table 1; the 3' capture sequences of sgRNAa and sgRNAb were 5'-CGGAA CCTTA CGAAT ACCAG ATGC-3' and 5'-ATCTA GTGGA ACCTC AAACA TACC-3', respectively.

4.1.4 preparation of oligonucleotide-modified magnetic beads

Same as 1.1.4 of example 1.

4.1.4 Beads-ELISA detection reaction system and method

10 XDcAs 9 buffer (100mM NaCl, 500mM Tris-HCl, 100mM MgCl)₂(ii) a 100 μ g/ml BSA; pH7.9@25 ℃; NEBuffer 3.1; NEB; the dCas9 enzyme carries the buffer; 10 XDPas 9 buffer), horseradish peroxidase conjugated Streptavidin (HRP-conjugated Streptavidin) (0.4mg/ml) (Shanghai Biotech, cat #: d111054-0100), TMP developing Solution (TMB Chromogen Solution for ELISA; p0209-100 ml; beyotime). The biotin-labeled oligonucleotide re-biotin (5'-biotin-TTTTT TGGTA TGTTT GAGGT TCCAC TAGAT-3') was synthesized.

Single target detection reaction (20 μ L): 1 XHCR reaction buffer, 15nM sgRNA, 30nM dCas9 protein,1～4×10⁴Beads @ oligo, DNA sample (added as needed), 40U RNase inhibitor. Incubate for 15 minutes at room temperature (25 ℃) and spin the mixture through the whole process.

Multi-target detection reaction (20 μ L): 1 xHCR reaction buffer, 15nM xN sgRNA (i.e., 15nM of each sgRNA), 15nM xN sgRNA, 15nM xN dCas9 protein, 1-4 x 10⁴Beads @ oligo, DNA sample (added as needed), 40U RNase inhibitor. Where N is the number of targets detected (e.g., 2 for both HPV16 and HPV 18). Incubate for 15 minutes at room temperature (25C) and spin mix throughout.

After the reaction was completed, the beads were washed three times with 1 XDPas 9 buffer containing 0.5% BSA (containing 10U of RNA inhibitor, the same below) (3 minutes for each maintenance incubation to ensure complete blocking of the bead surface), then after the last blocking, short chain re-biotin was added at a final concentration of 0.5. mu.M, spin incubated for 3 minutes, the beads were washed three times with 1 XDPas 9 buffer containing 0.5% BSA (every separation wash, after addition of resuspension for magnetic separation), then 20. mu.L of 1000-fold diluted Streptavidin (stock concentration: HRP 4mg/ml) was added, after 3 minutes of incubation (according to experience, if this step extended incubation time, the possibility of false positives increased), then after washing three times with 1 XDPas 9 buffer containing 0.5% BSA (magnetic separation wash, after addition for magnetic separation), transferred to well plate 96 (at this time, the reaction volume was 30. mu.L; i.e.finally, resuspended with 30. mu.5% dCas 0.25% 1 XDPas 9 buffer) Liquid-resuspended magnetic beads) and then 50 μ L of TMP color developing solution are added, after 10 minutes of reaction, a microplate reader is used for measuring the light absorption value at 630nm, a biorad gel imager is used for taking a picture in a stationary free mode, or a mobile phone is used for taking a picture under white light (after observation, the signal is stable within 30 minutes after the TMP color developing solution in a cloudy day is reacted, the light absorption value at 630nm and the imaging brightness are unchanged, solid particles with different degrees are separated out in more than 30 minutes, and the stronger signal is more easily separated out) (the TMP color developing solution is saturated generally within 5 minutes after being added). First, a microplate reader is used to perform full-wave-band absorption light detection on the detection product of ELISA so as to determine the optimal detection wavelength.

4.2, results of the experiment

4.2.1 detection procedure and principle of Beads-ELISA CADD

In order to investigate and process the signal output of the CADD detection method realized by the HCR method, the invention designs the Beads-ELISA method. The detection principle is shown in FIG. 10A, and the basic principle is the same as that of Beads-HCR, except that the signal reporter system in the third step of CADD method is changed, i.e., the 3' end capture sequence of sgRNA is hybridized and combined with a biotin-labeled oligonucleotide re-biotin. Then, streptavidin coupled with horseradish peroxidase (HRP) is used for binding biotin, then a soluble chromogenic substrate TMB of the HRP is used for carrying out enzymatic chromogenic reaction, and a light absorption value is measured to reflect a detection signal of the CADD. The signal display program was named as Beads-ELISA because it was identical to the conventional ELISA method.

4.2.2 pMD-HPV16 gradient assay

Different concentrations of pMD-HPV16 were detected with sgRNA targeting HPV16(sgRNA16) using pMD-HPV16 as the detection target, 4 replicates for each concentration detection. The results are shown in FIG. 10, where FIG. 10B shows microplate imaging results of TMB color development results; FIG. 10C shows the 630nm absorbance quantitative analysis of the microplate reader of FIG. 10B; FIG. 10D shows the results of full-band measurement at 310nm to 700nm with a microplate reader; these results indicate that the Beads-ELISA method can quantitatively detect target DNA. pMD was also used as a negative control in this assay, and it was seen that no detection signal was produced even with the highest dose (100pM) of pMD detected.

Typing detection of 4.2.3, 15 hrHPV

To further examine whether the Beads-ELISA could detect 15 hrHPV, the SgRNA and sgRNA targeting 15 hrHPV were used to detect the DNA of 15 hrHPV (pMD-HPV 16-pMD-HPV 73). The empty vector pMD served as negative control, while an equimolar mixture of 15 hrHPV DNA (pMD-HPVct) served as positive control. The results are shown in fig. 11, in which fig. 11A shows Beads-ELISA images of 15 hrHPV DNAs detected using various sgrnas, respectively; FIG. 11B shows the quantification results of FIG. 11A as a heat map. It can be seen that the DNA of each hrHPV can be specifically detected by using the Beads-ELISA method.

To further investigate whether the Beads-ELISA could detect mixed infections, two HPV mixed infections were simulated with 15 hrHPV DNAs combined two by two (mixed two DNAs). The results of testing various mock mixed infection samples with various sgrnas and sgrnas are shown in fig. 11C and 11D, where fig. 11C shows Beads-ELISA images of testing each mock mixed infection sample with various sgrnas, respectively; FIG. 11D shows the quantification results of FIG. 11C as a heat map. It can be seen that the mixed infection of hrHPV can be specifically detected by using the Beads-ELISA method.

In order to detect the specificity of the Beads-ELISA by using clinical samples, DNA (pMD-HPV 16-pMD-HPV 73) of a plurality of hrHPV and clinical DNA samples are detected again by using the Beads-ELISA, the result is shown in FIG. 11E, each HPV DNA can be detected by corresponding sgRNA and sgRNA, and signals are not detected by single clinical sample DNA or a mixture of two clinical sample DNA (150ng) selected according to the detection result of the Beads-HCR, which indicates that the Beads-ELISA has good specificity, and even in complex genomic DNA, false positive signals can not appear if HPV infection is lacked.

Example 5

Detection of HPV DNA by DNA-Bind-ELISA CADD

5.1, an experimental method:

5.1.1 preparation of sgRNA in vitro transcription template by PCR amplification method

The same as 4.1.1 of example 4.

5.1.2 preparation of sgRNA by in vitro transcription

The preparation method is the same as 1.1.2 of example 1.

The sgRNA prepared in example 5 is used for detecting HPV DNA, wherein the 5' -end target DNA binding sequences of sgRNA a and sgRNA b are the same as the sequences SEQ ID NO.4-33 described in the sequence table 1; the 3' capture sequences of sgRNAa and sgRNAb were 5'-CGGAA CCTTA CGAAT ACCAG ATGC-3' and 5'-ATCTA GTGGA ACCTC AAACA TACC-3', respectively.

5.1.3 preparation of DNA-Bind microplates

DNA-BIND 96-well plate purchased from Corning; the surface of the microporous plate is provided with N-Oxysuccinimide groups, and the microporous plate can be used for covalently fixing amino-containing molecules on the surface of the microporous plate. Amino-modified oligonucleotides RE-NH using DNA-BIND 96-well microplate instructions₂(5'-NH₂-TTTTT TGCAT CTGGT ATTCG TAAGG TTCCG-3') is fixed at the bottom of the micropore plate, sealed by a preservative film and then placed in a refrigerator at 4 ℃ for standby.

5.1.2 DNA-Bind-ELISA detection reaction system and method

Single target detection reaction (20 μ L): 1 × HCR reaction buffer, 15nM sgRNA, 30nM dCas9 protein, DNA sample (added in amounts as needed), 40U RNase inhibitor. Incubate for 15 minutes at room temperature (25 ℃) and spin the mixture through the whole process.

Multi-target detection reaction (20 μ L): 1 × HCR reaction buffer, 15nM × N sgRNA (i.e., 15nM of each sgRNA), 15nM × N sgRNA, 15nM × N dCas9 protein, DNA sample (added in amounts as needed), 40U RNase inhibitor. Where N is the number of targets detected (e.g., 2 for both HPV16 and HPV 18). Incubate for 15 minutes at room temperature (25 ℃) and spin the mixture through the whole process.

Using the above reaction system, the above detection reaction was first carried out in a 200. mu.L EP tube. After the reaction is finished, adding oligonucleotide re-biotin with the final concentration of 0.5 mu M, using 1 XdCas 9 buffer solution, expanding the reaction system to 80 mu L, transferring the reaction system into a micropore plate diluted by the oligonucleotide, slightly shaking, and placing the reaction system on a horizontal mixer for hybridization incubation at room temperature for 15 minutes; then using 1 x dCas9 buffer washing 3 times (each washing using 2000RPM centrifugal 30sec or instantaneous centrifugal after the absorption of washing liquid from the hole edge), finally using 80 u L1 x dCas9 buffer wet hole bottom (i.e. adding 80 u L1 x dCas9 buffer), then adding 20 u L1000 times diluted HRP-conjugated Streptavidin (the stock solution concentration is 0.4mg/ml), after 3 minutes of incubation rapidly using 0.5% 1 x dCas9 buffer washing three times, then adding 30 u L1 x dCas9 buffer wet hole bottom (i.e. adding 30 u L1 x dCas9 buffer), then adding 50u L TMP solution, reaction 10 minutes after 630nm enzyme labeling instrument determination of absorbance, using Biorad gel imaging instrument in stationary free mode photograph.

5.2, Experimental results

5.2.1 DNA-Bind-ELISA CADD detection procedure and principle

In order to investigate whether the Beads-ELISA method can be realized by other solid phase carriers, the DNA-Bind-ELISA method is designed. The detection principle is shown in FIG. 12A, the basic principle is the same as that of the Beads-ELISA method, only the captured solid phase carrier is changed, namely the solid phase carrier in the Beads-ELISA is replaced by a microplate from the Beads, and the capture oligonucleotide fixed on the surface of the Beads is fixed in the microplate, namely the capture sequence at the 3' end of the sgRNAa is hybridized and combined with the oligonucleotide fixed in the microplate. The signal reporting system in the third step of CADD is completely the same as the Beads-ELISA method.

5.2.2 pMD-HPV16 gradient assay

To investigate the feasibility of the DNA-Bind-ELISA, different concentrations of pMD-HPV16 were first tested using this method; each concentration was tested in 3 replicates. The results are shown in FIG. 12B and FIG. 12C, in which FIG. 12B shows the imaging of the detection microplate, FIG. 12B shows the result of the quantitative analysis of FIG. 12B, and it can be seen that DNA-Bind-ELISA quantitatively determined the target DNA pMD-HPV 16. The negative control pMD also produced no signal at the highest concentration.

5.2.3 testing a second clinical sample

A second clinical sample (33 in total) was obtained by DNA-Bind-ELISA. The amount of clinical sample used was 150ng for each assay reaction. The results are shown in FIG. 13, where FIG. 13A shows the imaging results after microplate development; fig. 13B shows the absorbance quantification results of fig. 13A as a heat map. FIG. 13C shows the results of 33 clinical samples tested by DNA-Bind-ELISA (CADD column in FIG. 13C) and PCR-reverse dot hybridization (PCR column in FIG. 13C) and compared with each other, and it can be seen that DNA-Bind-ELISA CADD accurately detected the infection and typing of 15 hrHPV (hrHPV) in these samples; in addition, DNA-Bind-ELISA CADD also detected more complex infections (e.g., samples 2, 5, 15, 33). To confirm the detection results, 5 samples were retested and the results are shown in fig. 13D and 13E, where fig. 13D shows microplate chromogenic imaging results and fig. 13E shows the results of absorbance quantitative analysis of fig. 13D in a heat map. These results demonstrate that DNA-Bind-ELISA CADD can be used to detect HPV infection in clinical samples.

Sequence listing

<110> university of southeast

<120> DNA detection method based on CRISPR/Cas9

<160> 41

<170> SIPOSequenceListing 1.0

<210> 1

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cggaacctta cgaataccag atgc 24

<210> 2

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tacttcatgt tacagacgac tcccac 26

<210> 3

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atctagtgga acctcaaaca tacc 24

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ttaaggagta cctacgacat 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gtatcttcta gtgtgcctcc 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tgctgcaccg gctgaaaata 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gcatcatatt gcccaggtac 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

acctacctct aaaccaacac 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tcctacacct agcggctcca 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ctgagaggta acaaacctat 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

aaggaaaagg aagacccctt 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

acacagacat atttgtacta 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tctttaggtt ttggtgcact 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gtcccccgta gatacattat 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gacctatagt agggcgcctg 20

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

gggtcatatg tacttggcac 20

<210> 17

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

acgatatgta tccaccaaac 20

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

atcctaccat tcttgaacag 20

<210> 19

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

acaggctaag ccagatcctt 20

<210> 20

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

ggaatacctt cgtcatggcg 20

<210> 21

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

cagttgtttt gtcacagttg 20

<210> 22

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

tattgggtta tccccgccag 20

<210> 23

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

catattcctc cacatgtcta 20

<210> 24

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

gctacgagtg gtatcaacca 20

<210> 25

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

aatgacatat atacatacta 20

<210> 26

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

taagggtcct gtttaactgg 20

<210> 27

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

ctggtaggtg tgtatacatt 20

<210> 28

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

caatcaatac cttcgccatg 20

<210> 29

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

cccaatagag gacggtgaca 20

<210> 30

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

catagaccca ctaggcgagg 20

<210> 31

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 31

tgatacgcag cgattggtat 20

<210> 32

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 32

tgataaggag cgcctagtat 20

<210> 33

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 33

taggttgtag gcctccctta 20

<210> 34

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 34

ctgcggttga agcaatgaac 20

<210> 35

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 35

cccacactac agtcttacga 20

<210> 36

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 36

ggaccgcgct ccccacgtgg 20

<210> 37

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 37

tccccggccc agccccttcc 20

<210> 38

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 38

gcatctggta ttcgtaaggt tccg 24

<210> 39

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 39

tacttcatgt tacagacgac tcccac 26

<210> 40

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 40

gtgggagtcg tctgtaacat gaagta 26

<210> 41

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 41

ttttttggta tgtttgaggt tccactagat 30

Claims (12)

1. The application of a pair of dCas 9-sgRNAs used in a CRISPR/Cas 9-based DNA detection method in preparing a detection reagent for detecting various DNA molecules is characterized by comprising the following steps:

(1) incubating the DNA molecule to be detected with a pair of dCas9-sgRNA to form a dCas9-sgRNA-DNA-dCas9-sgRNA compound;

(2) capturing a dCas9-sgRNA-DNA-dCas9-sgRNA complex to the surface of a solid phase substrate by using a capture sequence on the sgRNA of one dCas 9-sgRNA;

(3) the signal reporter was captured using a capture sequence on the sgRNA of another dCas 9-sgRNA.

2. The use of claim 1, wherein the pair of dCas9-sgRNA of step (1) refers to two dCas9-sgRNA complexes, dCas9-sgRNA and dCas 9-sgRNA; wherein the sgRNA and the sgRNA have different 5 'end target DNA binding sequences and 3' end capture sequences respectively.

3. The use of claim 2, wherein the sequence of the 3' capture sequence of the sgRNAa is (SEQ ID No.1) 5'-CGGAA CCTTA CGAAT ACCAG ATGC-3'; the sequence of the capture sequence at the 3' end of the sgRNA is (SEQ ID NO.2) 5'-TACTT CATGT TACAG ACGAC TCCCA C-3' or (SEQ ID NO.3) 5'-ATCTA GTGGA ACCTC AAACA TACC-3'.

4. The use according to claim 2, characterized in that the target DNA binding sequences of the 5' ends of the sgRNA a and the sgRNA b are both 20bp long sequences, and dCas9-sgRNA complex is guided to bind to the target DNA by hybridization with the target DNA to form dCas9-sgRNA-DNA-dCas9-sgRNA complex; the sgRNA and sgRNA, when used to detect papillomavirus DNA molecules, have target DNA binding sequences at the 5' ends selected from one pair of sequences SEQ ID NO. 4-33; when detecting the DNA of the Escherichia coli T7 RNA polymerase, the 5' end target DNA binding sequences of sgRNA and sgRNA are respectively SEQ ID NO. 34-35; when detecting mutant TERT promoter DNA, the target DNA binding sequences of 5' ends of sgRNA and sgRNAb are respectively SEQ ID NO. 36-37.

5. The use of any one of claims 1 to 4, wherein the step (2) of capturing the dCas9-sgRNA-DNA-dCas9-sgRNA complex to the surface of the solid phase substrate using the capture sequence on the sgRNA means that the dCas9-sgRNA-DNA-dCas9-sgRNA complex can be captured to the surface of the solid phase substrate by the capture sequence at the 3' end of the sgRNA.

6. The use of claim 5, wherein the solid phase matrix of step (2) comprises various solid phase matrices including microspheres, microplates, glass plates, or nanoparticles; the surface of the solid phase matrix is fixed with capture oligonucleotide; wherein the sequence of the capture oligonucleotide is base complementary to the 3' capture sequence of the sgRNAa; wherein the capture oligonucleotide has the sequence (SEQ ID NO.38)5'-GCATC TGGTA TTCGT AAGGT TCCG-3'.

7. The use of any one of claims 1 to 4, wherein the capturing of the signal reporter using the capture sequence on the sgRNA in step (3) is performed by capturing the signal reporter to dCas9-sgRNA-DNA-dCas9-sgRNA complex via the 3' capture sequence of the sgRNA.

8. The use of claim 7, wherein the signal reporter molecule of step (3) is a hybrid chain reaction hairpin 1; wherein the hybrid chain reaction consists of two DNA molecules of hairpin 1 and hairpin 2; wherein the 3' capture sequence (SEQ ID No.39) 5'-TACTT CATGT TACAG ACGAC TCCCA C-3' of sgRNAb can open hairpin 1 by hybridization; the opened hairpin 1 can be crossed with the hairpin 2, and the hairpin 2 is opened; the opened hairpin 2 can be hybridized with the hairpin 1 to open the hairpin 1; so circulating, and forming a continuously prolonged DNA chain; the 3' end of the hairpin 1 has the sequence of (SEQ ID NO.40) 5'-G TGGGA GTCGT CTGTA ACATG AAGTA-3'.

9. The use of claim 7, wherein the signaling reporter molecule of step (3) is a biotin-labeled oligonucleotide having a sequence that is base complementary to the 3' capture sequence of the sgRNA; wherein the sequence of the biotin-labeled oligonucleotide is (SEQ ID NO.41)5'-TTTTT TGGTA TGTTT GAGGT TCCAC TAGAT-3'.

10. The use according to claim 9, wherein the biotin-labeled oligonucleotide comprises a biotin molecule that binds to an enzyme-labeled streptavidin molecule.

11. The use of claim 10, wherein the enzyme is horseradish peroxidase, which is capable of producing a pigment molecule by catalyzing a substrate for reporting a detection signal by detecting light absorbance; the substrate is TMB.

12. The use of claim 1, wherein the CRISPR/Cas 9-based DNA detection method uses a pair of dCas 9-sgrnas in the preparation of a detection reagent for detecting papillomavirus DNA molecules.

Images