CN108486234A - A kind of method and its application of CRISPR partings PCR - Google Patents
A kind of method and its application of CRISPR partings PCR Download PDFInfo
- Publication number
- CN108486234A CN108486234A CN201810271385.3A CN201810271385A CN108486234A CN 108486234 A CN108486234 A CN 108486234A CN 201810271385 A CN201810271385 A CN 201810271385A CN 108486234 A CN108486234 A CN 108486234A
- Authority
- CN
- China
- Prior art keywords
- pcr
- dna
- crispr
- artificial sequence
- partings
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Abstract
The invention discloses a kind of method and its application of CRISPR partings PCR, this method is a kind of method of progress DNA detection and parting.Routine PCR reaction system is added in the sgRNA of Cas9 albumen and targeting target dna by this method, and a short time constant-temperature incubation program is added before PCR response procedures, starts standard PCR amplification program later.The invention discloses the method for CRISPR partings PCR be a kind of homogeneous detection technique, only need a PCR amplification step that detection can be completed, present invention utilizes CRISPR technologies to the specific recognition cutting characteristic of DNA, simply, homogeneously, enzyme rapidly and sensitively to target dna it can carry out specific detection and parting, it is a kind of DNA new detecting methods with high specific and sensitivity, people HPV DNA in clinical sample is successfully detected by the method with the present invention.
Description
Technical field
The invention belongs to biotechnology, it is related to a kind of DNA detections based on CRISPR and classifying method, specially one
The method (abbreviation ctPCR methods) of kind CRISPR partings PCR and its application.
Background technology
For basic research, various detections and diagnostic application, DNA detections and Genotyping are critically important always.Therefore, DNA
Detection and genotyping technique are constantly subjected to extensive concern, to promote the development of such technology.In brief, mainly there are three classes
DNA is detected and genotyping technique is widely used.The first is the various technologies based on polymerase chain reaction (PCR).PCR is
Most common DNA detections and genotyping technique.The DNA detections of based on PCR and Genotyping depend on specific primer
Design and multiplexed PCR amplification.PCR detections can quantitative PCR (qPCR) and the number developed recently by normal PCR (tPCR)
Word PCR is realized.Because having clear advantage, such as detection in real time and high sensitivity, Q-PCR is in almost all of research, inspection
It is obtained in survey and diagnostic test room highly popular.More accurate digital pcr has been developed now, as clinical detection tool,
With prodigious potentiality and advantage.However, round pcr is when for distinguishing highly relevant genotype, it be by multiplex amplification
With the limitation of high degree of specificity primer.In addition to round pcr, a variety of DNA hybridization technologies such as DNA microarray are also widely used for detecting
And typing DNA.However, due to its expensive equipment, complicated testing process and inevitable non-specific hybridization, DNA are micro-
Array technique cannot become routine DNA detections and Genotyping tool as PCR.DNA sequencing is another effective DNA inspections
Survey and genotyping technique.In particular with the appearance of next-generation sequencing (NGS) technology, Illumina NovaSeq etc.
The DNA sequencing tool of NGS platforms is more and more.However, due to needing expensive equipment and chemical reagent, they still cannot picture
PCR is equally used for conventional study, detect and diagnose.Therefore, in contrast, if overcoming the limitation of design of primers, PCR is still
It is the platform of the DNA detection and Genotyping of most convenient, economical and efficient.
Ishino et al. is between 1987 are found that the rule of cluster in the genome of Escherichia coli (E.coli) for the first time
Every short palindrome repetitive sequence, and CRISPR (Clustered regularly were defined as in 2002 by Jansen et al.
interspaced short palindromic repeat).There are three types of different types (I, II and type III) for CRISPR systems.I
Type and type III system need a variety of Cas albumen interaction competence exertion normal functions, therefore more complicated than II types very much.
In II type systems, it is only necessary to which a kind of albumen (Cas9), Cas9 can specifically be identified and cut after being combined with guiding RNA (gRNA)
Double-stranded DNA (dsDNA).Cas9 is the marker protein of II type systems, in trans-activation crRNA (tracrRNA) and CRISPR RNA
(crRNA) it plays a role under guiding.TracrRNA can activate Cas9 nucleases, crRNA specifically with 20 cores of target DNA
Nucleotide sequence is complementary.Therefore crRNA determines the specificity of CRISPR-Cas9 systems.TracrRNA and crRNA are integrated into one
A RNA is after list is oriented to RNA (sgRNA), to greatly simplifie II type CRISPR systematic differences.The site-specific that Cas9 is mediated
Property cutting depend on sgRNA and PAM (protospacer adjacent motif).If there is PAM in target dna, in sgRNA
Guiding under, Cas9 cuts target DNA at the base of the upstreams PAM three.Currently, due to easy and efficient, CRISPR-Cas9 systems
It is widely used in genome editor field by many researchers.In addition, dCas9 (dead Cas9) is transformed by Cas9,
It loses nuclease, but retains gene transcriptional activation structural domain (AD) or inhibit structural domain (ID), dCas9 (dead
Cas9) endogenous gene expression regulation and control have been widely used in it as a kind of new manual transcription factor.
Although Cas9/sgRNA is widely used to gene editing and regulation and control, it is rarely applied to detection of nucleic acids.By height
The DNA cutting powers (can distinguish single base) of specificity, Cas9/sgRNA have in DNA detections and parting with prodigious latent
Power.For example, CRISPR-Cas9 systems have been used for detecting Zika viruses and can divide the U.S. and Africa Zika viruses
Type (Sci Transl Med.2017,9 (388) .pii:eaag0538.doi:10.1126/scitranslmed.aag0538).
High specific based on CRISPR, CRISPR-Cas9 can reach the resolution ratio of single base when distinguishing Strain, can be in list
Parting detection is carried out to the bacterium of ortholog and virus on base level.Currently, commercially producing with Cas9 albumen, base
New development is gradually welcome in the DNA detection techniques of Cas9.Such as it has been reported that Cas9/sgRNA for handling dissociative DNA in blood
(cfDNA), to eliminate wild type genotype, convenient for the disease relevant mutant genotype in enrichment ctDNA, make saltant type base
Because type can be detected with PCR amplification (Oncogene, 2017,36：6823-6829).In addition, we are by round pcr and Cas9/
SgRNA system entries combine, and two kinds of new DNA detections and typing method has been developed, is named as " CRISPR- partings PCR
(CRISPR-typing PCR, ctPCR) "；These technologies declared national inventing patent (201711146674.2,
201711156103.7), and delivered scientific paper (Anal Bioanal Chem, 2018, DOI:10.1007/s00216-
018-0873-5；biorxiv:doi:https://doi.org/10.1101/236588).For the ease of distinguishing and reflecting technology
Between difference and improvement, by above-mentioned two research invention ctPCR be known as ctPCR1.0 (biorxiv:doi:https://
Doi.org/10.1101/236588) and ctPCR2.0 (Anal Bioanal Chem, 2018, DOI:10.1007/s00216-
018-0873-5)。
Based on CRISPR systems to the sequence-specific cutting function of nucleic acid molecules, CRISPR systems are in field of nucleic acid detection
Application gradually developed.Other than above-mentioned Cas9 enzymes, the application of other Cas albumen has also been presented in CRISPR
Application value of the system in field of nucleic acid detection.For example, the Cas13a (also referred to as C2c2) of type III CRISPR systems has been answered recently
For Zika viruses detection and with hypersensitivity (amount of virion down to 2aM), (this method is named as
Sherlock)(Science.2017；356(6336):438-442.doi:10.1126/science.aam9321；Science,
2018, eaaq0179；DOI:10.1126/science.aaq0179).But Sherlock technologies can only cut RNA due to relying on
Cas13a enzymes, be only used for detection RNA；To detect DNA, need first to carry out DNA with recombination enzymatic amplification (RPA) technology
Isothermal duplication introduces T7 promoter sequences in amplified production end by primer during amplification, then carries out in-vitro transcription, generates
RNA carries out cas13a to RNA later and specifically cuts, and then activates Non-specific cleavage activity of the cas13a to single stranded RNA, reaches
To the purpose of detection DNA.The detection technique is dependent on recombination enzymatic amplification and in-vitro transcription, though it is sensitive to be conducive to raising detection volume
Degree, but detection process is cumbersome, it is of high cost.In addition, based on Cas12a (also referred to as Cpf1) specificity cutting target double-stranded DNA
(dsDNA) characteristic of the non-specific single stranded DNA (ssDNA) of meeting, has developed the new technology (party for detecting target DNA molecule after
Method is named as Detectr) (Science, 2018, DOI.10.1126/science.aar6245).Detectr technologies can be examined
Amole grades of molecule is surveyed, there is very high clever lightness, but Detectr also relies on a nucleic acid isothermal as Sherlock
Amplification procedure, it is costly and time consuming.These when CRISPR systems are for developing nucleic acid detection technique studies have shown that have prodigious
Potentiality and advantage.
HPV is double-stranded DNA virus, and with cervix cancer, cancer of anus and the pathogenesis of other cancers are closely related.About
The HPV of 100 kinds of Different Variation types.According to the difference of carciongenic potency, HPV points are high-risk HPV (hrHPV) and low risk HPV
(lrHPV).Most common hrHPV is HPV16 and HPV18 in the world, they result in about 70% cervical carcinoma.Other
HrHPV includes HPV31,33,35,39,45,51,52,56,58,59,68,82 etc..LrHPV include HPV6,11,40,42,43,
44,61,81 etc..Because of its abundant DNA polymorphism, HPV is researching DNA detection and the good experiment material of typing method.Therefore,
The present invention carries out the demonstration of the method for the present invention using HPV DNA as material.Further it is proposed that ctPCR technologies and set
The sgRNA of meter, a set of targeting high-risk HPV for screening and developing, has substantially developed a kind of instant HPV clinical samples
New detecting technique.
Polymerase chain reaction (PCR) is as one of most common nucleic acid detection method, by almost all of biology, detection
With the relevant laboratory of diagnosis as basic detection of nucleic acids tool.On the basis of normal PCR (tPCR), derive quantitative
PCR (qPCR), and it is widely used in DNA detect and diagnoses.In addition, the digital pcr (dPCR) developed recently has shown that
Go out its great potential and advantage as clinical detection tool.In the application, the main problem that round pcr faces is specificity
The non-specific amplification of design and the primer specificity not strong production of PCR primer；It is false that these problems cause PCR detections easily to occur
It is positive.As described above, CRISPR systems, especially cas9 systems, the specific recognition with target DNA sequence and cutting power,
Even there is single base separating capacity.Therefore, CRISPR and being combined into for round pcr develop new detection of nucleic acids and parting skill
Art provides new chance.These technologies have been provided simultaneously with the high specific of CRISPR technologies and the high sensitivity of round pcr,
In DNA detections and Genotyping advantageously.
Invention content
Goal of the invention：In view of the problems of the existing technology, while for the ease of distinguishing ctPCR1.0 in the prior art
(biorxiv:doi:https://doi.org/10.1101/236588) and ctPCR2.0 (Anal Bioanal Chem,
2018,DOI:10.1007/s00216-018-0873-5) and reflection technology between difference and improvement.The present invention provides a kind of
DNA detections and classifying method, i.e., a kind of new method of CRISPR partings PCR, this method based on CRISPR are named as
CtPCR3.0, i.e. CRISPR partings PCR method 3.0 (ctPCR3.0), this method be it is a kind of quickly, homogeneous (homogeneous),
Low cost and the sensitively PCR method based on CRISPR effectively can carry out specific detection and parting to target dna.This
The ctPCR3.0 of invention is a kind of homogeneous detection technique, i.e., only needs a PCR amplification step that detection can be completed, and the present invention utilizes
Specific recognition cutting characteristic of the CRISPR technologies to DNA, can it is simple, homogeneous, enzyme rapidly and sensitively target dna is carried out
Specific detection and parting are a kind of DNA new detecting methods with high specific and sensitivity, pass through the side with the present invention
Method successfully detects people HPV DNA in clinical sample.
The present invention also provides the applications of the method for CRISPR partings PCR.
Technical solution：To achieve the goals above, a kind of CRISPR partings PCR (CRISPR-typing as described herein
PCR, ctPCR) method, include the following steps：
(1) the PCR reactions of CRISPR partings are established：By CRISPR associated nucleic acids enzyme and the sgRNA and routine of targeting target dna
PCR reaction reagents are added in PCR reaction systems and establish CRISPR parting PCR reaction systems；
(2) CRISPR parting PCR programs are run：It establishes after CRISPR parting PCR reaction systems and adds before PCR response procedures
Enter a short time constant-temperature incubation program, starts PCR amplification program later.
Wherein, step (1) the CRISPR associated nucleic acids enzyme includes Cas9 albumen, and other similar with Cas9
CRISPR associated nucleic acid enzymes；The present invention mainly carries out case study with Cas9 albumen, and Cas9 can be substituted for similar with Cas9
Other CRISPR associated nucleic acid enzymes, such as Cpf1 or other CRISPR associated nucleic acid enzymes.
Wherein, the sgRNA of step (1) the targeting target dna is the matched guiding RNA of CRISPR associated nucleic acid enzymes, target
To the sgRNA of target dna either a sgRNA, can also be a plurality of sgRNA.SgRNA is guiding Cas9 targeting proteins mesh
Mark DNA sgRNA, can also be substituted for the matched guiding RNA of other CRISPR associated nucleic acid enzymes, such as the matched guiding of Cpf1
RNA.The item number for the sgRNA being wherein added in ctPCR reactions will ensure effective cutting such as Cas9/sgRNA to target DNA.
Wherein, step (1) the routine PCR reaction reagent includes common PCR reaction reagent, quantitative fluorescent PCR reaction examination
Agent and digital pcr reaction reagent.
Preferably, step (1) the routine PCR reaction reagent is quantitative PCR reaction reagent.It is realized using quantitative PCR
When ctPCR is detected, advantage is that detection process is real-time, quick, cheap.Further, it can be used in quantitative PCR cheap
Fluorescent dye determination (such as quantitative PCR premixed liquid containing SybrGreen).It is proved in the embodiment of the present invention, conventional regular-PCR is anti-
Answer premixed liquid can be well compatible to the cleavage reaction of DNA with Cas9/sgRNA with quantitative PCR premixed liquid, i.e., Cas9/sgRNA can
The cutting assembled and to target DNA is realized in PCR premixed liquids, that is to say, that PCR premixed liquids have no effect on the assembling of Cas9/sgRNA
With its cutting to target DNA, this is important discovery and the innovative point of the present invention.
Wherein, the PCR primer in step (1) the routine PCR reaction reagent, can also either unique sequence primer
It is degenerate sequence primer；The primer used in the method for CRISPR partings PCR be can by the DNA fragmentation containing target DNA sequence from
The pair of primers that PCR amplification comes out in DNA sample to be detected.
Wherein, step (2) the operation CRISPR partings PCR programs：Increase before routine PCR reaction program including one
Short time constant-temperature incubation program and routine PCR reaction program later.Wherein before routine PCR reaction program it is increased in short-term
Between constant-temperature incubation program, refer to step (1) being set up to the ctPCR reaction systems completed first steady temperature a certain again first keeping certain
Time is kept for 30 minutes such as at 37 DEG C；Can also be other temperature and times, a certain steady temperature first keeps certain time
The purpose of the program is that CRISPR associated nucleic acids enzyme is assembled into compound with sgRNA and cuts in allowing CRISPR partings PCR to react
Target DNA, as long as time and the temperature of above-mentioned purpose can be completed, as to be assembled into Cas9/sgRNA compound by Cas9 and sgRNA
Object simultaneously cuts target DNA.This cutting can cause the reduction of pcr template molecule, be embodied in the increase of Ct values in quantitative PCR detection.
The increase of Ct values during this Cas9/sgRNA cuttings target DNA causes ctPCR to detect, is the judgment basis of ctPCR detection target DNAs.
Application of the method for CRISPR partings PCR of the present invention in DNA detections and parting.
Wherein, the method for the CRISPR partings PCR can be in the application in HPV double-stranded DNAs biological detection and parting.
Application of the ctPCR methods of the present invention in the detection of DNA associated biomolecules, such as certain type viral DNA in detection DNA sample
The presence or absence etc. of certain disease related mutation in presence or absence, detection dissociative DNA in blood (cfDNA).
Application of the ctPCR methods of the present invention in human papilloma virus double-stranded DNA biological detection；Such as human papilloma
The detection of virus (HPV) DNA and parting.
Wherein, the HPV viruse includes two kinds of various high-risk HPV viruses, especially HPV16 and HPV18.Especially,
The various genotype of L1 and E6-E7 genes etc. of human papilloma virus (HPV).The present invention only uses HPV as a kind of reality
Material is tested to verify the feasibility of ctPCR3.0 methods.This method can also be used for detecting other DNA.The present invention uses HPV DNA
DNA target mark as ctPCR3.0 detections.The result shows that ctPCR3.0 can be detected and parting HPV DNA；It was found that ctPCR3.0
The HPV16 and HPV18DNA in cervical cancer cell genomic DNA (gDNA) can be detected；It was found that ctPCR3.0 can detect uterine neck
Cancer detects 10 kinds of HPV hypotypes (16,18,33,35,45,51,52,56,58 and 59) in clinical sample.
The various high-risk HPV DNA of targeting that the method for CRISPR partings PCR of the present invention is added in detecting HPV
SgRNA, which is characterized in that the nucleic acid sequence of the sgRNA of the various high-risk HPV DNA such as SEQ ID NO.1-24 institutes
Show.In the application that ctPCR3.0 of the present invention detects HPV, is designed for the L1 genes of each HPV hypotype and use two kinds
SgRNA, SEQ ID NO.1-24 are respectively：16L1a：TTAAGGAGTACCTACGACAT；16L1b：
GTATCTTCTAGTGTGCCTCC；18L1a：TGCTGCACCGGCTGAAAATA；18L1b：GCATCATATTGCCCAGGTAC；
33L1a：CTGAGAGGTAACAAACCTAT；33L1b：AAGGAAAAGGAAGACCCCTT；35L1a：
ACACAGACATATTTGTACTA；35L1b：TCTTTAGGTTTTGGTGCACT；45L1a：GGGTCATATGTACTTGGCAC；
45L1b：ACGATATGTATCCACCAAAC；51L1a：ATCCTACCATTCTTGAACAG；51L1b：
ACAGGCTAAGCCAGATCCTT；52L1a：GGAATACCTTCGTCATGGCG；52L1b：CAGTTGTTTTGTCACAGTTG；
56L1a：TATTGGGTTATCCCCGCCAG；56L1b：CATATTCCTCCACATGTCTA；58L1a：
GCTACGAGTGGTATCAACCA；58L1b：AATGACATATATACATACTA；59L1a：TAAGGGTCCTGTTTAACTGG；
59L1b：CTGGTAGGTGTGTATACATT；16E6a：GATTCCATAATATAAGGGGT；16E7b：
GAGGAGGAGGATGAAATAGA；18E6a：GTGCTGCAACCGAGCACGAC；18E7b：CGAGCAATTAAGCGACTCAG.On
It is 5 ' to 3 ' to state sequence direction.
Since the L1 genes of human papilloma virus (HPV) are widely used in detection and differentiate HPV hypotypes.In the present invention
In, respectively devise a pair first against having 10 kinds of high-risk HPVs, i.e. HPV16,18,33,35,45,51,52,56,58 and 59
SgRNA, the L1 genes for detecting 10 kinds of high-risk HPVs.With these sgRNA and it has been reported that for expanding the regions HPV L1
Universal primer SEQ ID NO.25-26, i.e. MY09 (5 '-CGTCC MARRG GAWAC TGATC-3 ') and MY11 (5 '-
GCMCA GGGWC ATAAY AATGG-3 ') (wherein M is A or C；R is A or G；W is A or T；Y is C or T), by being based on fluorescence
The ctPCR3.0 methods of quantitative PCR have detected the L1 genes of 10 kinds of high-risk HPVs.The result shows that ctPCR3.0 can be examined effectively
Survey 10 kinds of high-risk-types；Show feasibilities and application value of the ctPCR3.0 for DNA detection and parting.
Since HPV genes are during being integrated into host cell gene group, L1DNA has missing sometimes, may cause
The omission of HPV detections.Therefore, the detection of oncogene E6/E7 is increasingly paid attention in HPV detections, because E6-E7 is integrated into HPV
It will not be lacked when in human gene group DNA, and excalation may occur for L1 genes.Therefore, detection E6-E7 genes can anti-leak-stopping
It surveys.
Therefore, in the present invention, for two kinds of high-risk HPVs, i.e. HPV16 and HPV18, also each design have simultaneously used a pair of of target
To the sgRNA of E6-E7 genes；With these sgRNA, three-type-person's cervical cancer tumer line is had detected with method proposed by the present invention
HPV16 in HeLa, SiHa and C-33a and HPV18DNA.The result shows that successfully being detected in HeLa and SiHa cells respectively
HPV18 and 16；However, not detecting two kinds of HPV in C-33a cells.This is HPV18 positive cells with HeLa, and SiHa is
The fact that HPV16 positive cells and C-33a are HPV negative cells is consistent.
In the present invention, when detecting the E6-E7 genes of HPV16 and 18, a pair of degenerate primers SEQ of the invention designed has been used
ID NO.27-28, i.e. E67-6F (5 '-AAGGG MGTAAC CGAAA WCGGT-3 ') and E67-7R (5 '-GTACC TKCWG
GATCA GCCAT-3 '), wherein M is A or C；W is A or T；K is G or T.
Since Cas9 endonucleases have a large amount of binding site that misses the target, can be cut in the position of some mispairing
It cuts.It is a bottleneck that CRISPR-Cas9 systems are applied within the scope of full-length genome to miss the target, and is especially used to gene therapy and face
Bed application.Although there are many miss points within the scope of full-length genome by Cas9, should have on small DNA fragmentation considerably less or not have
There is site of missing the target.The present invention in order to ensure ctPCR3.0 methods specificity, for each HPV subspecies design and use a pair
sgRNA.The result shows that finding that ctPCR3.0 can be detected：(1) be cloned in plasmid 10 kinds of HPV hypotypes (16,18,33,35,
45,51,52,56,58 and L1 genes 59)；(2) L1 of the HPV16 and HPV18 in cervical cancer cell genomic DNA (gDNA)
Gene and E6-E7 genes；(3) cervical carcinoma detection clinical sample in 10 kinds of HPV hypotypes (16,18,33,35,45,51,52,56,
58 and L1 genes 59).
Advantageous effect：Compared with prior art, the invention has the advantages that：
The present invention develops a kind of new DNA detections and classifying method --- CRISPR partings PCR based on CRISPR
(CRISPR-typing PCR, ctPCR), this method is named as ctPCR3.0, represents the Cas9/sgRNA partings of 3.0 versions
PCR.This method is a kind of quick, homogeneous, cheap and sensitive PCR method based on CRISPR, can be effectively to target dna
Carry out specific detection and parting.The present invention successfully has detected the gene of HPV, (1) clone by the method with ctPCR3.0
The L1 genes of 10 kinds of HPV hypotypes (16,18,33,35,45,51,52,56,58 and 59) in plasmid, (2) cervical cancer cell base
Because in the L1 genes and E6-E7 genes of HPV16 and HPV18 in a group DNA (gDNA), and (3) cervical carcinoma detection clinical sample
10 kinds of HPV hypotypes (16,18,33,35,45,51,52,56,58 and 59) L1 genes, fully demonstrate this method.In short,
The present invention develop it is a kind of with high specific and quickly, new method --- the ctPCR3.0 of homogeneous detection and typing DNA.Having
In the case of standby DNA detections sample, the fluorescence quantitative PCR instrument that dependence has been popularized, whole detection process of ctPCR3.0 can be with
It is completed in 2 hours.
Present invention utilizes CRISPR technologies to the specific recognition cutting characteristic of DNA, can simply, enzyme rapidly and sensitively
Specific detection and parting are carried out to target dna, successfully avoid current detection of nucleic acids and parting field center acid hybridization and spy
Critical bottlenecks problem, the most significant advantages of ctPCR3.0 such as specific PCR primers design are homogeneously to detect.
Description of the drawings
Fig. 1 is the principle and flow diagram of ctPCR3.0 detections and typing DNA molecule；CtPCR3.0 is indicated in Fig. 1
When for detecting HPV, the location of sgRNA used and PCR primer；When realizing ctPCR3.0 detections with quantitative fluorescent PCR, two
A program required reaction time, entire ctPCR3.0 detections include the following steps：(1) ctPCR reactions are established；(2) it runs
CtPCR programs；SgRNA and routine PCR reaction reagent of the ctPCR reactions comprising Cas9 albumen, targeting target dna；CtPCR programs
Including increased short time constant-temperature incubation program and a routine PCR reaction program later before routine PCR reaction program；
Fig. 2 is that Cas9/sgRNA complexs cut 10 kinds of HPV hypotypes HPV L1 Plasmid DNA and ctPCR3.0 detects HPV16
With the schematic diagram of HPV18L1 Plasmid DNA；(A) Cas9/sgRNA cuts 10 kinds of HPV L1 Plasmid DNA, for the HPV of 10 kinds of hypotypes
L1 genes have separately designed 10 couples of special sgRNA, these sgRNA cut corresponding HPV L1 matter after being combined respectively with Cas9
Grain DNA；Negative control：(1) sgRNA and Cas9 of HPV16 are compound, for cutting HPV18L1 Plasmid DNA；(2) HPV18
SgRNA is compound with Cas9, for cutting HPV16L1 Plasmid DNA；(3) HPV16 the and HPV18L1 Plasmid DNA that do not cut；(B)
CtPCR3.0 detects HPV16 Plasmid DNA；(C) ctPCR3.0 detects HPV18L1DNA；
Fig. 3 is the schematic diagram that 10 kinds of HPV hypotype L1 Plasmid DNA are detected with ctPCR3.0；There are 10 kinds of hypotype HPV (high in Fig. 3
Danger type：16, after the sgRNA and Cas9 of 18,33,35,45,51,52,56,58 and 59) L1 Plasmid DNA, 10 kinds of hypotype HPV are compound
The HPV Plasmid DNA of 10 kinds of hypotypes is respectively cut；
Fig. 4 is the schematic diagram that the L1 and E6-E7 genes of HPV18 and 16 in cell are detected with ctPCR3.0；It is detected in Fig. 4
HeLa or SiHa gDNA, and C-33a gDNA are used as negative control (A) ctPCR3.0 and are detected in HeLa cells
HPV18L1 genes；(B) the HPV16L1 genes in SiHa cells are detected with ctPCR3.0；(C) use ctPCR3.0 in HeLa cells
Middle detection HPV18E6-E7 genes；(D) HPV16E6-E7 genes are detected in SiHa cells with ctPCR3.0；
Fig. 5 is the schematic diagram that the HPV (first) in eight clinical samples is detected with ctPCR3.0；In first clinical sample
In product, six kinds of clinical sample (numbers：1~6) it is found that HPV in, and HPV is not found in other two kinds of clinical samples, sample
1-6 is HPV16,16,18,33,51 and 59 respectively；
Fig. 6 is the schematic diagram that the HPV in 8 clinical samples is detected with ctPCR3.0 (second batch)；In second batch clinic sample
In this, in 6 clinical samples (number：1~6) it is found that HPV in, does not find HPV, sample 1- in other two clinical sample
6 be HPV16,16,35,52,56 and 58 respectively；
Fig. 7 is the schematic diagram that the HPV (third batch) in 10 clinical samples is detected with ctPCR3.0；In the clinical sample of third batch
In product, in 8 clinical samples (number：1~8) HPV is found in, does not find HPV, 1-8 points of sample in other two clinical samples
It is not HPV16,18,18,33,45,52,56 and 58.
Specific implementation mode
Below in conjunction with drawings and examples, the invention will be further described.
Embodiment 1
CtPCR3.0 is detected and the principle and flow diagram of typing DNA molecule are as shown in Figure 1.CtPCR3.0 detects DNA
The schematic diagram (Fig. 1) of molecule.This method homogeneously detects target dna by a step：The DNA sample detected is a pair of first
Cas9/sgRNA compounds are cut, and then carry out qPCR with a pair of universal primer.All detected components (DNA, Cas9 to be detected
Albumen, sgRNA and qPCR reagents) the advance mixing all in a PCR pipe.Entire detection process is before regular-PCR program
One constant-temperature incubation time (37 DEG C, 30 minutes) is added.In constant-temperature incubation step, Cas9 nucleases respectively with a pair of of sgRNA
(sgRNAa and b) compound rear cutting DNA sample simultaneously.Cas9/sgRNA, which specifically cuts target DNA, will lead to the Ct in qPCR amplifications
Value increases.
L1 the and E6/E7 genes of the target dna HPV16 and HPV18 of each embodiment detection in the present invention, and it is directed to this
The PCR primer of a little gene design and use, the position of sgRNA are as shown in Figure 1.The schematic diagram helps to understand the embodiment of the present invention
Experiment in 2~5.
Embodiment 2
HPV plasmids are cut with Cas9/sgRNA and differentiate HPV16 and 18 with ctPCR3.0
Experimental method：
The preparation of sgRNA：
It is prepared by sgRNA in-vitro transcription templates：PCR1：According to the skeleton part of sgRNA, pair of primers (such as table 1 is designed first
Shown F1 and R) carry out PCR.PCR reaction systems (30 μ L)：2 μ L F1 (table 1), 2 μ L R (table 1), 15 2 × primestar of μ L
(TAKARA), H is used2Volume is supplemented to 30 μ L by O.PCA response procedures：95 DEG C 2 minutes；7 cycles：95 DEG C 15 seconds, 72 DEG C 1 point
Clock.Then with 1.5% Ago-Gel 100V electrophoresis 40 minutes, with plastic recovery kit (Axygen) recovery purifying, it is dissolved in 25 μ
In L eluents, Nanodrop2000 spectrophotometers is used in combination to detect its DNA concentration and purity, which is named as segment 1,
- 20 DEG C are placed in save backup.PCR2：It is template with segment 1, F2 and Sg-R are that primer carries out PCR amplification.PCR reaction systems (50
μL)：2 μ L segments 1,1 μ L F2,1 μ L Sg-R, 25 2 × primestar of μ L (TAKARA), 20 μ L H2O.PCA response procedures：
95 DEG C 2 minutes；30 cycles：95 DEG C 15 seconds, 60 DEG C 30 seconds, 72 DEG C 1 minute；72 DEG C 2 minutes.PCR is directly used after PCR
Cleaning kits (Axygen) recycle the segment, are dissolved in 25 μ L eluents, which is named as segment 2, use
2000 spectrophotometers of Nanodrop detect its DNA concentration and purity, are placed in -20 DEG C and save backup.PCR3：It is mould with segment 2
Plate, F3 (table 1) and Sg-R (table 1) are that primer carries out PCR amplification.PCR reaction systems (50 μ L)：2 μ L segments 2,1 μ L F3 (tables
1), 1 μ L Sg-R (table 1), 25 2 × primestar of μ L (TAKARA), 20 μ l H2O.PCA response procedures：95 DEG C 2 minutes；Into
Enter 30 cycles：95 DEG C 15 seconds, 60 DEG C 30 seconds, 72 DEG C 1 minute；72 DEG C 2 minutes.PCR cleaning are directly used after PCR
Kit (Axygen) recycles the segment, is dissolved in 25 μ L eluents, which is named as T7-sgRNA transcription templates, uses
2000 spectrophotometers of Nanodrop detect its DNA concentration and purity, are placed in -20 DEG C and save backup.The present embodiment is used to prepare
The oligonucleotide sequence of the in-vitro transcription template of sgRNA includes F1, R, Sg-R and each F2 and F3 such as SEQ ID NO.29-79 institutes
Show.
It is prepared by sgRNA in-vitro transcriptions：According to T7RNA polymerases (the T7RNA Pol bought；NEB) the ginseng in specification
System and dosage are examined, the in-vitro transcription (H that this process uses is carried out2O, EP pipes, pipette tips etc. must pass through RNase processing), phase
The system (20 μ L) answered is as shown in the table：0.2~1 μ g T7-sgRNA transcription templates, 2 μ L T7RNA Pol, 2 μ L T7RNA
Pol buffer, 1 μ L rNTP (NEB), use H2Volume is supplemented to 20 μ L by O.The system mixed above is placed in 37 DEG C of constant temperature
In water-bath, reaction overnight.
SgRNA extracting and purifyings：RNA is extracted using Trizol (Invitrogen companies) reagent.It is first that in-vitro transcription is anti-
1mL Trizol are added in the system that should be stayed overnight, several times with pipette tips piping and druming.Lysate is transferred in the centrifuge tube of 1.5mL, room temperature
It places 5 minutes.Chloroform is added by the amount of 0.2mL chloroforms/mL Trizol, covers pipe lid, acutely shaking 15 seconds, are placed at room temperature for 5 points
Clock, 4 DEG C, 12000g is centrifuged 15 minutes.Upper phase is transferred in a clean centrifuge tube, isopropanol (0.5mL/mL is added
Trizol), gently overturn mixing for several times, be placed at room temperature for 10 minutes, 4 DEG C, 12000g is centrifuged 10 minutes.Supernatant is outwelled, is added
75% ethyl alcohol (1mL/mL Trizol) mixes well, 4 DEG C, and 7500g is centrifuged 5 minutes.Remove supernatant, precipitation, which is set, is placed at room temperature for 5
~10 minutes, makes its natural airing (not be completely dried), the DEPC water dissolutions RNA of 30 μ L is added；Use ultraviolet specrophotometer
It measures 260/280 ratio and measures RNA concentration, and take the agarose gel electrophoresis detection of 1 μ g progress 1.5%.
SgRNA prepared by embodiment 2 is additionally operable to the experiment of the embodiment 3~5 in the present invention.
The oligonucleotide sequence that table 1 is used to prepare the in-vitro transcription template of sgRNA (is followed successively by SEQ ID from top to bottom
NO29-79)
The HPV mono- of 10 kinds of hypotypes shares 10 pairs of corresponding sgRNAs (sgRNAa and sgRNAb) (table 2).It is used respectively per a pair of
The Plasmid DNA of 10 kinds of hypotype HPV (16,18,33,35,45,51,52,56,58 and 59) of cutting is gone after sgRNA combinations Cas9
(200ng).Recombinant C as9 albumen is purchased from New England Biolabs (NEB).Cas9 cleavage reactions system (30 μ L)：15μL
2 × SYBR Green Master Mix (Yeasen), 1 μM of Cas9 nuclease (NEB), 300nM sgRNAa (table 2) and 300nM
SgRNAb (table 2).Cas9 reaction solutions are incubated 10 minutes at 25 DEG C first.Then 200ng substrates are added into Cas9 reaction solutions
DNA (Plasmid DNA), and be incubated 20 minutes at 37 DEG C.Finally, Cas9 is inactivated 10 minutes at 65 DEG C.With 2% Ago-Gel into
Row electrophoresis detection.
HPV Plasmid DNA (2ng) after sgRNAs/Cas9 nucleic acid cleavages, is directly entered qPCR reactions.CtPCR3.0 is anti-
It answers (30 μ L)：15 μ L 2 × SYBR Green Master Mix (Yeasen), 1 μM of Cas9 nucleases (NEB), 300nM
SgRNAa (table 2), 300nM sgRNAb (table 2), 500nM L1-MY09 (table 3), 500nM L1-MY11 (table 3) and 2ng HPV
Plasmid DNA.Operating scheme：37 DEG C 30 minutes, 95 DEG C 10 minutes, 40 cycle 95 DEG C 15 seconds, 58.5 DEG C 30 seconds and 72 DEG C 45
Second.Reaction carries out on real-time PCR device StepOne plus (ABI).
Experimental result：
By the PCR amplification and in-vitro transcription of above-mentioned sgRNA transcription templates can prepare for the present invention test it is various
SgRNA, these sgRNA sequences and corresponding HPV hypotypes and gene are as shown in table 2.These sgRNA are real for present invention experiment
Apply the experiment in example 2~5.Notice in table 2 that sgRNA is not write as RNA sequence form, but DNA sequence dna form, this is in order to just
It is compared in DNA sequence dna, the T in sequence in table is changed to U, then become RNA sequence.
2 sgRNA sequences of table and corresponding HPV hypotypes and gene (being followed successively by SEQ ID NO1-24 from top to bottom)
PCR primer (be from top to bottom followed successively by SEQ ID NO.25-28) of the table 3 for ctPCR detections HPV
| Primer | Sequence (5' to 3') |
| L1-MY09 | CGTCCMARRGGAWACTGATC |
| L1-MY11 | GCMCAGGGWCATAAYAATGG |
| E67-6F | AAGGGMGTAACCGAAAWCGGT |
| E67-7R | GTACCTKCWGGATCAGCCAT |
10 kinds of HPV L1 Plasmid DNA respectively have a pair of special sgRNA (sgRNAa and sgRNAb) (table 2), this 10 couples of sgRNA
After being combined with Cas9, it is respectively used to 10 kinds of HPV L1 Plasmid DNA of cutting.Negative control：(1) sgRNA and the Cas9 knot of HPV16
It closes, for cutting HPV18L1 Plasmid DNA；(2) sgRNA of HPV18 is combined with Cas9, for cutting HPV16L1 Plasmid DNA；
(3) HPV16 the and HPV18L1 Plasmid DNA that do not cut.After cutting 30 minutes, original DNA completely can not in Ago-Gel
See (Fig. 2A), this shows that the cutting efficiency of Cas9 is very high and is sufficient for testing in next step.Then HPV16 is distinguished with ctPCR3.0
With 18 L1 genes.
HPV16 the and 18L1 genes being cloned in plasmid are had detected with first attempting to property of ctPCR3.0.HPV16 and 18L1 bases
Because expanding substrate as qPCR, if they are cut, the Ct values of qPCR will increase.In order to which preliminary identification ctPCR3.0 is detected
Specificity, by the sgRNA cross actions of the L1 genes of HPV16 and 18 and HPV16 and 18 in ctPCR3.0 detections.As a result it shows
Show the LI genes that can be good at detecting two kinds of HPV hypotypes with ctPCR3.0, and the L1 genes of HPV16 and 18 can be distinguished well
(Fig. 2 B and 2C).
Embodiment 3
The L1 genes in HPV hypotype plasmids are detected with ctPCR3.0
Experimental method：
HPV Plasmid DNA (2ng) after sgRNAs/Cas9 nucleic acid cleavages, is directly entered qPCR reactions.CtPCR3.0 is anti-
It answers (30 μ L)：15 μ L 2 × SYBR Green Master Mix (Yeasen), 1 μM of Cas9 nucleases (NEB), 300nM
SgRNAa (table 2), 300nM sgRNAb (table 2), 500nM L1-MY09 (table 3), 500nM L1-MY11 (table 3) and 2ng HPV
Plasmid DNA.Operating scheme：37 DEG C 30 minutes, 95 DEG C 10 minutes, 40 cycle 95 DEG C 15 seconds, 58.5 DEG C 30 seconds and 72 DEG C 45
Second.Reaction carries out on real-time PCR device StepOne plus (ABI).
Experimental result：
In order to further verify the specificity of ctPCR3.0.There are the HPV (high risks of 10 kinds of hypotypes：16、18、33、35、45、
51,52,56,58 and 59) L1 Plasmid DNA, 10 couples of sgRNA the HPV Plasmid DNA of each hypotype is cut after being combined respectively with Cas9
(37 DEG C, 30 minutes).Then Cas9 albumen is inactivated at 95 DEG C, opens simultaneously qPCR reactions.QPCR results show ctPCR3.0
This 10 kinds of HPV hypotypes are mutually successfully distinguished into (Fig. 3).The above results demonstrate again that ctPCR3.0 can be used for specific detection 10
Kind HPV hypotypes.CtPCR3.0 can also be used to detect other genes.
Embodiment 4
HPV L1 and E6-E7 genes in cervical cancer cell are detected with ctPCR3.0
Experimental method：
CtPCR3.0 reaction systems (30 μ L) by 15 μ L 2 × SYBR Green Master Mix (Yeasen), 1 μM
Cas9 nucleases (NEB), 300nM sgRNAa (table 2), 300nM sgRNAb (table 2), 500nM L1-MY09 (table 3) or E67-
6F (table 3), 500nM L1-MY11 (table 3) or the gDNA of E67-7R (table 3) and the various cervical cancer cells of 200ng compositions.Use with
Lower operating scheme：37 DEG C 30 minutes, 95 DEG C 10 minutes, 35 cycle 95 DEG C 15 seconds, 58.5 DEG C 30 seconds and 72 DEG C 45 seconds.Reaction
It is carried out on real-time PCR device StepOne plus (ABI).
Experimental result：
It is detected in HPV18L1 and E6 genes and SiHa cells in HeLa cells by using ctPCR3.0
HPV16L1 and E6 genes.First, 200ng HeLa or SiHa gDNA are detected, and use C-33agDNA as negative control.Knot
Fruit shows that ctPCR3.0 can be detected contains HPV18 and HPV16 genes respectively in HeLa and SiHa gDNA.On the contrary, in C-
HPV18 and HPV16 genes (Fig. 4) are not detected in 33a gDNA.The result shows that ctPCR3.0 can be in HPV infection cell
It is effectively detected and parting HPV DNA.
Embodiment 5
The HPV L1 genes in clinical sample are detected with ctPCR3.0
Experimental method：
The preparation of sgRNA is the same as embodiment 1.
CtPCR3.0 reacts (30 μ L)：15 μ L 2 × SYBR Green Master Mix (Yeasen), 1 μM of Cas9 nucleic acid
Enzyme (NEB), 300nM sgRNAa (table 2), 300nM sgRNAb (table 2), 500nM L1-MY09 (table 3), 500nM L1-MY11
(table 3) and 20ng DNA.DNA is extracted from three batches of clinical samples the cervical mucus cast-off cells of totally 26 patients.It uses
Following operating scheme：37 DEG C 30 minutes, 95 DEG C 10 minutes, 40 cycle 95 DEG C 15 seconds, 58.5 DEG C 30 seconds and 72 DEG C 45 seconds.Instead
It should be carried out on real-time PCR device StepOne plus (ABI).Clinical sample comes from Nanjing General Hospital, Nanjing Military Area Command, PLA's (South China
Capital).DNA uses phenol/chloroform and isopropyl alcohol extraction successively, and ethanol precipitation is used in combination.The DNA of purifying is dissolved in ddH2It is used in combination in O
Spectroscopic assay standard measure.
Experimental result：
Finally, the specificity of ctPCR3.0 methods is verified by detecting clinical sample.3 are had detected with ctPCR3.0 altogether
Criticize clinical sample (26 cervical mucus cast-off cells).After Cas9 cuttings, qPCR inspections are carried out using universal primer L1-MY09/11
It surveys.In first six kinds of clinical samples (number：1~6) it is found that HPV in, and is not found in other two kinds of clinical samples
HPV (Fig. 5).Sample 1~6 is HPV16,16,18,33,51 and 59 respectively.It is found that in six clinical samples of second batch
HPV (numbers：1-6), HPV (Fig. 6) is not found in other two clinical samples.Sample 1~6 be respectively HPV16,16,35,
52,56 and 58.In eight clinical samples (number of third batch：1~8) it is found that HPV in, is not sent out in other two clinical samples
Existing HPV (Fig. 7).Sample 1~8 is HPV16,18,18,33,45,52,56 and 58 respectively.These results with from Nanjing Military Command south
HC2 (Digene) examining report of the HPV of capital hospital general is consistent, shows the reliability of ctPCR3.0 detections.These statistics indicate that
The HPV in clinical sample can specifically be detected by ctPCR3.0 methods.
Sequence table
<110>Southeast China University
<120>A kind of method and its application of CRISPR partings PCR
<160> 79
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
ttaaggagta cctacgacat 20
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
gtatcttcta gtgtgcctcc 20
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
tgctgcaccg gctgaaaata 20
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
gcatcatatt gcccaggtac 20
<210> 5
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
ctgagaggta acaaacctat 20
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
aaggaaaagg aagacccctt 20
<210> 7
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 7
acacagacat atttgtacta 20
<210> 8
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 8
tctttaggtt ttggtgcact 20
<210> 9
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 9
gggtcatatg tacttggcac 20
<210> 10
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 10
acgatatgta tccaccaaac 20
<210> 11
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 11
atcctaccat tcttgaacag 20
<210> 12
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 12
acaggctaag ccagatcctt 20
<210> 13
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 13
ggaatacctt cgtcatggcg 20
<210> 14
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 14
cagttgtttt gtcacagttg 20
<210> 15
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 15
tattgggtta tccccgccag 20
<210> 16
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 16
catattcctc cacatgtcta 20
<210> 17
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 17
gctacgagtg gtatcaacca 20
<210> 18
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 18
aatgacatat atacatacta 20
<210> 19
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 19
taagggtcct gtttaactgg 20
<210> 20
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 20
ctggtaggtg tgtatacatt 20
<210> 21
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 21
gattccataa tataaggggt 20
<210> 22
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 22
gaggaggagg atgaaataga 20
<210> 23
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 23
gtgctgcaac cgagcacgac 20
<210> 24
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 24
cgagcaatta agcgactcag 20
<210> 25
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 25
cgtccmarrg gawactgatc 20
<210> 26
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 26
gcmcagggwc ataayaatgg 20
<210> 27
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 27
aagggmgtaa ccgaaawcgg t 21
<210> 28
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 28
gtacctkcwg gatcagccat 20
<210> 29
<211> 53
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 29
gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttg 53
<210> 30
<211> 52
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 30
aaaaaaaagc accgactcgg tgccactttt tcaagttgat aacggactag cc 52
<210> 31
<211> 32
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 31
aaaaaaaagc accgactcgg tgccactttt tc 32
<210> 32
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 32
ttaaggagta cctacgacat gttttagagc tagaaatagc aag 43
<210> 33
<211> 42
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 33
ttctaatacg actcactata gttaaggagt acctacgaca tg 42
<210> 34
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 34
gtatcttcta gtgtgcctcc gttttagagc tagaaatagc aag 43
<210> 35
<211> 42
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 35
ttctaatacg actcactata ggtatcttct agtgtgcctc cg 42
<210> 36
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 36
tgctgcaccg gctgaaaata gttttagagc tagaaatagc aag 43
<210> 37
<211> 42
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 37
ttctaatacg actcactata gtgctgcacc ggctgaaaat ag 42
<210> 38
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 38
gcatcatatt gcccaggtac gttttagagc tagaaatagc aag 43
<210> 39
<211> 42
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 39
ttctaatacg actcactata ggcatcatat tgcccaggta cg 42
<210> 40
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 40
ctgagaggta acaaacctat gttttagagc tagaaatagc aag 43
<210> 41
<211> 42
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 41
ttctaatacg actcactata gctgagaggt aacaaaccta tg 42
<210> 42
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 42
aaggaaaagg aagacccctt gttttagagc tagaaatagc aag 43
<210> 43
<211> 42
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 43
ttctaatacg actcactata gaaggaaaag gaagacccct tg 42
<210> 44
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 44
acacagacat atttgtacta gttttagagc tagaaatagc aag 43
<210> 45
<211> 42
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 45
ttctaatacg actcactata gacacagaca tatttgtact ag 42
<210> 46
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 46
tctttaggtt ttggtgcact gttttagagc tagaaatagc aag 43
<210> 47
<211> 42
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 47
ttctaatacg actcactata gtctttaggt tttggtgcac tg 42
<210> 48
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 48
gggtcatatg tacttggcac gttttagagc tagaaatagc aag 43
<210> 49
<211> 42
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 49
ttctaatacg actcactata ggggtcatat gtacttggca cg 42
<210> 50
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 50
acgatatgta tccaccaaac gttttagagc tagaaatagc aag 43
<210> 51
<211> 42
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 51
ttctaatacg actcactata gacgatatgt atccaccaaa cg 42
<210> 52
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 52
atcctaccat tcttgaacag gttttagagc tagaaatagc aag 43
<210> 53
<211> 42
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 53
ttctaatacg actcactata gatcctacca ttcttgaaca gg 42
<210> 54
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 54
acaggctaag ccagatcctt gttttagagc tagaaatagc aag 43
<210> 55
<211> 42
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 55
ttctaatacg actcactata gacaggctaa gccagatcct tg 42
<210> 56
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 56
ggaatacctt cgtcatggcg gttttagagc tagaaatagc aag 43
<210> 57
<211> 42
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 57
ttctaatacg actcactata gggaatacct tcgtcatggc gg 42
<210> 58
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 58
cagttgtttt gtcacagttg gttttagagc tagaaatagc aag 43
<210> 59
<211> 42
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 59
ttctaatacg actcactata gcagttgttt tgtcacagtt gg 42
<210> 60
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 60
tattgggtta tccccgccag gttttagagc tagaaatagc aag 43
<210> 61
<211> 42
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 61
ttctaatacg actcactata gtattgggtt atccccgcca gg 42
<210> 62
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 62
catattcctc cacatgtcta gttttagagc tagaaatagc aag 43
<210> 63
<211> 42
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 63
ttctaatacg actcactata gcatattcct ccacatgtct ag 42
<210> 64
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 64
gctacgagtg gtatcaacca gttttagagc tagaaatagc aag 43
<210> 65
<211> 42
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 65
ttctaatacg actcactata ggctacgagt ggtatcaacc ag 42
<210> 66
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 66
aatgacatat atacatacta gttttagagc tagaaatagc aag 43
<210> 67
<211> 42
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 67
ttctaatacg actcactata gaatgacata tatacatact ag 42
<210> 68
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 68
taagggtcct gtttaactgg gttttagagc tagaaatagc aag 43
<210> 69
<211> 42
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 69
ttctaatacg actcactata gtaagggtcc tgtttaactg gg 42
<210> 70
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 70
ctggtaggtg tgtatacatt gttttagagc tagaaatagc aag 43
<210> 71
<211> 42
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 71
ttctaatacg actcactata gctggtaggt gtgtatacat tg 42
<210> 72
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 72
gattccataa tataaggggt gttttagagc tagaaatagc aag 43
<210> 73
<211> 41
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 73
ttctaatacg actcactata ggattccata atataagggg t 41
<210> 74
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 74
gaggaggagg atgaaataga gttttagagc tagaaatagc aag 43
<210> 75
<211> 41
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 75
ttctaatacg actcactata ggaggaggag gatgaaatag a 41
<210> 76
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 76
gtgctgcaac cgagcacgac gttttagagc tagaaatagc aag 43
<210> 77
<211> 41
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 77
ttctaatacg actcactata ggtgctgcaa ccgagcacga c 41
<210> 78
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 78
cgagcaatta agcgactcag gttttagagc tagaaatagc aag 43
<210> 79
<211> 41
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 79
ttctaatacg actcactata gcgagcaatt aagcgactca g 41
Claims (11)
1. a kind of CRISPR partings PCR method, which is characterized in that include the following steps：
(1) the PCR reactions of CRISPR partings are established：The sgRNA and PCR of CRISPR associated nucleic acids enzyme, targeting target dna are reacted into examination
Agent is added in PCR reaction systems and establishes CRISPR parting PCR reaction systems；
(2) CRISPR parting PCR programs are run：After establishing CRISPR parting PCR reaction systems one is added before PCR response procedures
A short time constant-temperature incubation program starts PCR amplification program later.
2. the method for CRISPR partings PCR according to claim 1, which is characterized in that step (1) CRISPR is related
Nuclease includes Cas9 albumen, or the CRISPR associated nucleic acid enzyme Cpf1 similar with Cas9.
3. CRISPR partings PCR method according to claim 1 or 2, which is characterized in that step (1) the targeting target
The sgRNA of DNA is the matched guiding RNA of CRISPR associated nucleic acid enzymes, and the sgRNA for targeting target dna is a sgRNA or a plurality of
sgRNA。
4. the method for CRISPR partings PCR according to claim 1, which is characterized in that step (1) the PCR reactions examination
Agent includes common PCR reaction reagent, quantitative fluorescent PCR reaction reagent or digital pcr reaction reagent.
5. the method for CRISPR partings PCR according to claim 4, which is characterized in that step (1) the PCR reactions examination
Agent is preferably quantitative PCR reaction reagent.
6. CRISPR partings PCR method according to claim 1, which is characterized in that step (1) the PCR reaction reagents
In PCR primer be unique sequence primer or degenerate sequence primer；The primer used in the method for CRISPR partings PCR is can
By the pair of primers that PCR amplification comes out from DNA sample to be detected of the DNA fragmentation containing target DNA sequence.
7. CRISPR partings PCR method according to claim 1, which is characterized in that step (2) is described in PCR reaction intervals
A short time constant-temperature incubation program is added before sequence and refers to the CRISPR parting PCR reaction systems that step (1) is set up and is completed first perseverance
Constant temperature degree is kept for certain time, and it is that CRISPR is related in allowing CRISPR partings PCR to react that the steady temperature, which is kept for certain time,
Nuclease is assembled into compound and cuts the temperature and time of target DNA with sgRNA.
8. a kind of application of CRISPR partings PCR method described in claim 1 in DNA detections and parting.
9. application according to claim 8, which is characterized in that the method for the CRISPR partings PCR is in HPV double-stranded DNA biologies
Application in detection and parting.
10. a kind of various high-risk HPVs of targeting that CRISPR partings PCR method described in claim 1 is added in detecting HPV
The sgRNA of DNA, which is characterized in that the nucleic acid sequence such as SEQ ID NO.1-24 of the sgRNA of the various high-risk HPV DNA
It is shown.
11. a kind of CRISPR partings PCR method described in claim 1 institute when detecting the E6-E7 genes of HPV is drawn using PCR
Object, which is characterized in that the primer is degenerate primer, i.e. SEQ ID NO.27：E67-6F(5′-
AAGGGMGTAACCGAAAWCGGT-3 ') and SEQ ID NO.28：E67-7R (5 '-GTACCTKCWGGATCAGCCAT-3 '),
Middle M is A or C；W is A or T；K is G or T.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810271385.3A CN108486234B (en) | 2018-03-29 | 2018-03-29 | CRISPR (clustered regularly interspaced short palindromic repeats) typing PCR (polymerase chain reaction) method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810271385.3A CN108486234B (en) | 2018-03-29 | 2018-03-29 | CRISPR (clustered regularly interspaced short palindromic repeats) typing PCR (polymerase chain reaction) method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108486234A true CN108486234A (en) | 2018-09-04 |
| CN108486234B CN108486234B (en) | 2022-02-11 |
Family
ID=63316867
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810271385.3A Active CN108486234B (en) | 2018-03-29 | 2018-03-29 | CRISPR (clustered regularly interspaced short palindromic repeats) typing PCR (polymerase chain reaction) method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108486234B (en) |
Cited By (28)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| CN110596384A (en) * | 2019-10-12 | 2019-12-20 | 南京黎明生物制品有限公司 | Human papilloma virus 6 type and 11 type immunoassay kit prepared based on Cas protein and gRNA compound |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| CN110923314A (en) * | 2019-12-30 | 2020-03-27 | 广州白云山拜迪生物医药有限公司 | Primer group for detecting SNP locus rs9263726, crRNA sequence and application thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| CN112029838A (en) * | 2020-07-23 | 2020-12-04 | 东南大学 | CRISPR/Cas9 typing PCR method for DNA homogeneous phase detection and application thereof |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| CN112111605A (en) * | 2020-09-21 | 2020-12-22 | 中山大学附属第一医院 | Detection kit for HPV based on CRISPR-Cas12a and G quadruplex-heme |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| CN115335536A (en) * | 2021-01-08 | 2022-11-11 | 武汉大学 | Compositions and methods for point-of-care nucleic acid detection |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| CN115873991A (en) * | 2022-11-02 | 2023-03-31 | 中创科瑞(北京)生物科技有限公司 | Block crRNA, function of enabling crRNA to switch and control binding with Cas12a and function verification method thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103981256A (en) * | 2014-04-15 | 2014-08-13 | 中国人民解放军疾病预防控制所 | Salmonella CRISPR (clustered regularlay interspaced short palindromic repeats) sequencing typing method |
-
2018
- 2018-03-29 CN CN201810271385.3A patent/CN108486234B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103981256A (en) * | 2014-04-15 | 2014-08-13 | 中国人民解放军疾病预防控制所 | Salmonella CRISPR (clustered regularlay interspaced short palindromic repeats) sequencing typing method |
Non-Patent Citations (6)
| Title |
|---|
| LEE, HB等: "Allele-Specific Quantitative PCR for Accurate, Rapid, and Cost-Effective Genotyping", 《HUMAN GENE THERAPY》 * |
| QIAO WANG等: "CRISPR-typing PCR (ctPCR), a new Cas9-based DNA detection method", 《BIORXIV》 * |
| ZHANG, BB等: "Detecting and typing target DNA with a novel CRISPR-typing PCR (ctPCR) technique", 《ANALYTICAL BIOCHEMISTRY》 * |
| 吴琳: "基于CRISPR的均相核酸检测新方法研究", 《中国优秀硕士学位论文全文数据库 医药卫生科技辑》 * |
| 庄孝飞: "基于CRISPR序列的沙门氏菌分子分型方法的建立", 《中国优秀硕士学位论文全文数据库 工程科技I辑》 * |
| 温旺荣等: "《临床分子诊断学 第2版》", 31 May 2015, 广州：广东科技出版社 * |
Cited By (42)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| CN110596384B (en) * | 2019-10-12 | 2022-08-12 | 南京黎明生物制品有限公司 | Human papilloma virus 6 type and 11 type immunoassay kit prepared based on Cas protein and gRNA compound |
| CN110596384A (en) * | 2019-10-12 | 2019-12-20 | 南京黎明生物制品有限公司 | Human papilloma virus 6 type and 11 type immunoassay kit prepared based on Cas protein and gRNA compound |
| CN110923314A (en) * | 2019-12-30 | 2020-03-27 | 广州白云山拜迪生物医药有限公司 | Primer group for detecting SNP locus rs9263726, crRNA sequence and application thereof |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| CN112029838A (en) * | 2020-07-23 | 2020-12-04 | 东南大学 | CRISPR/Cas9 typing PCR method for DNA homogeneous phase detection and application thereof |
| CN112111605A (en) * | 2020-09-21 | 2020-12-22 | 中山大学附属第一医院 | Detection kit for HPV based on CRISPR-Cas12a and G quadruplex-heme |
| CN115335536A (en) * | 2021-01-08 | 2022-11-11 | 武汉大学 | Compositions and methods for point-of-care nucleic acid detection |
| CN115873991A (en) * | 2022-11-02 | 2023-03-31 | 中创科瑞(北京)生物科技有限公司 | Block crRNA, function of enabling crRNA to switch and control binding with Cas12a and function verification method thereof |
| CN115873991B (en) * | 2022-11-02 | 2024-03-01 | 中创科瑞(北京)生物科技有限公司 | Block crRNA, function enabling crRNA to switch and control binding with Cas12a and function verification method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108486234B (en) | 2022-02-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108486234A (en) | A kind of method and its application of CRISPR partings PCR | |
| Moberg et al. | Real-time PCR-based system for simultaneous quantification of human papillomavirus types associated with high risk of cervical cancer | |
| Nagao et al. | Rapid and sensitive detection of physical status of human papillomavirus type 16 DNA by quantitative real-time PCR | |
| Han et al. | Simultaneous amplification and identification of 25 human papillomavirus types with Templex technology | |
| CN107828874A (en) | A kind of DNA detections and classifying method and its application based on CRISPR | |
| CN108192956A (en) | It is a kind of based on the DNA determination methods of Cas9 nucleases and its application | |
| de Koning et al. | Evaluation of a novel highly sensitive, broad-spectrum PCR-reverse hybridization assay for detection and identification of beta-papillomavirus DNA | |
| CN108060269B (en) | DPO primer group for detecting porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus and porcine rotavirus and application thereof | |
| CN107988428A (en) | Shrimp irido virus（SIV）RAA constant temperature fluorescence detection method and reagent | |
| CN111235313A (en) | CRISPR-Cas13 method for rapidly detecting novel coronavirus | |
| AU2021212731A1 (en) | Improved detection assays | |
| CN107164541A (en) | Many cross substitutions amplification of AUDG mediations combines the nucleic acid detection technique of bio-sensing | |
| CN113508182B (en) | Assay for detection of Human Papillomavirus (HPV) | |
| CN114231665A (en) | Phaseolus golden mosaic virus (RPA-LFD) detection kit and application thereof | |
| WO2022110335A1 (en) | Kit for rapidly detecting hepatitis b virus gene and detection method therefor | |
| Woo et al. | The use of HPV Linear Array Assay for multiple HPV typing on archival frozen tissue and DNA specimens | |
| CN106048080B (en) | Primer and method for rapidly screening HPV (human papilloma Virus) subtypes | |
| EP1546413B1 (en) | Method and kit for quantitative and qualitative determination of human papillomavirus | |
| Powell et al. | Digital PCR in the clinical microbiology laboratory: another tool on the molecular horizon | |
| CN116356079A (en) | RPA-CRISPR-Cas12a based visual detection kit for detecting Gaota virus and application | |
| WO2022100441A1 (en) | Probe set for detecting human papillomaviruses hpv16 and hpv18, and kit thereof | |
| CN108300804A (en) | Material and method for HBV miR-3 fluorescence quantitative PCR detections | |
| CN113481322A (en) | Composite amplification system and kit for typing detection of 16-valent HPV (human papillomavirus) | |
| CN113151495A (en) | Primer, probe, kit and method for universal visual detection of schistosoma japonicum and schistosoma mansoni nucleic acid by LFD-RPA | |
| US20210180107A1 (en) | Oligonucleotides and method for the detection and typing of human papillomavirus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |