WO2022044011A1 - Oligonucleotides and methods of using same - Google Patents

Oligonucleotides and methods of using same Download PDF

Info

Publication number
WO2022044011A1
WO2022044011A1 PCT/IL2021/051044 IL2021051044W WO2022044011A1 WO 2022044011 A1 WO2022044011 A1 WO 2022044011A1 IL 2021051044 W IL2021051044 W IL 2021051044W WO 2022044011 A1 WO2022044011 A1 WO 2022044011A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
seq
acid sequence
primer
set forth
Prior art date
Application number
PCT/IL2021/051044
Other languages
French (fr)
Inventor
Ariel Kushmaro
Karin YANIV
Eden OZER
Original Assignee
B. G. Negev Technologies And Applications Ltd., At Ben-Gurion University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by B. G. Negev Technologies And Applications Ltd., At Ben-Gurion University filed Critical B. G. Negev Technologies And Applications Ltd., At Ben-Gurion University
Publication of WO2022044011A1 publication Critical patent/WO2022044011A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention is in the field of molecular biology and diagnostics.
  • RNA virus The SARS-CoV-2 world pandemic erupted in early 2020 with rising numbers in morbidity and mortality.
  • SARS-CoV-2 was recognized as an RNA virus, therefore detection methods emerging for immediate response were mainly based on of reverse transcriptase quantitative polymerase chain reaction (RT-qPCR).
  • RT-qPCR reverse transcriptase quantitative polymerase chain reaction
  • RNA is extracted, undergoes reverse transcription for DNA strand generation, followed by PCR amplification and TaqMan probes fluorescence detection.
  • RT-qPCR is the most common methodology for SARS-CoV-2 diagnostics.
  • NGS next generation sequencing
  • Other detection methods are based on RT-qPCR and include a "drop-out" signal. These methodologies use RT-qPCR with two different markers, a double signal manifest for the original SARS-CoV-2 virus, while only a single signal manifest for the targeted variant.
  • Another detection methodology uses the characterization of ACt between one detection signal and another, amongst the different variants.
  • the present invention is directed to a method for detecting or determining the presence of a viral-derived polynucleotide in a biological sample.
  • the biological sample comprises an environmental sample or a sample obtained or derived form a subject.
  • the present invention is directed to specific oligonucleotides, compositions comprising same, and kits comprising same, for use in the determination of the presence of viral-derived polynucleotide in a sample.
  • the present invention is based in part, on the finding that the particular oligonucleotides disclosed herein below, provided detection of SARS-Cov- 2-derived RNA (or a complementary DNA thereto) or variants thereof, in a sample, including an environmental sample obtained or derived from wastewater, with greater amplification efficacy and sensitivity, compared to the state-of-the-art oligonucleotides and current practice.
  • a method for determining the presence of SARS-CoV-2 RNA or a variant thereof in a biological sample comprising: (a) providing a biological sample suspected of comprising a complementary DNA (cDNA) molecule complementary to SARS-CoV-2 RNA molecule; (b) contacting the biological sample of step (a) with a pair of primers capable of hybridizing to the cDNA molecule, wherein the pair of primers comprises any one of: (i) a first primer being an oligonucleotide consisting of the nucleic acid sequence GACCCCAAAATCAGCGAAATG (SEQ ID NO: 1), and a second primer being an oligonucleotide consisting of the nucleic acid sequence TCTGGTTACTGCCAGTTGAATCTG (SEQ ID NO: 22); (ii) a first primer being an oligonucleotide consisting of the nucleic acid sequence TGATTACAAACATTGGCCGC (SEQ ID NO:
  • a second primer being an oligonucleotide consisting of the nucleic acid sequence
  • a first primer being an oligonucleotide consisting of the nucleic acid sequence
  • CATGACGTTCGTGTTGTTTTAG SEQ ID NO: 16
  • a second primer being an oligonucleotide consisting of the nucleic acid sequence
  • kits for determining the presence of SARS-CoV-2 RNA molecule or a variant thereof in a biological sample comprising at least one pair of primers capable of amplifying a cDNA molecule complementary to the SARS-CoV-2 RNA molecule, wherein the at least one pair of primers is selected from the group consisting of: (i) a first primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 1, and a second primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 22; (ii) a first primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 2, and a second primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 3; (iii) a first primer being an oligonucleotide consist
  • step (b) further comprises contacting the biological sample with a probe molecule being a nucleic acid sequence capable of hybridizing to the cDNA molecule
  • step (b)(i) comprises contacting the biological sample with a probe being a nucleic acid molecule consisting of the nucleic acid sequence ACCCCGCATTACGTTTGGTGGACC (SEQ ID NO: 24)
  • step (b)(ii) comprises contacting the biological sample with a probe being a nucleic acid molecule consisting of the nucleic acid sequence ACAATTTGCCCCCAGCGCTTCAG (SEQ ID NO: 25)
  • step (b)(iii) comprises contacting the biological sample with a probe being a nucleic acid molecule consisting of the nucleic acid sequence TCACATTGGCACCCGCAATCCTGC (SEQ ID NO: 5);
  • step (b)(iv) comprises contacting the biological sample with a probe being a nucleic acid molecule consisting of the nucleic acid sequence T
  • the SARS-CoV-2 RNA molecule encodes a SARS-CoV-2 nucleocapsid protein or a SARS-CoV-2 spike protein.
  • the SARS-CoV-2 nucleocapsid protein is encoded by a nucleic acid sequence set forth in SEQ ID NO: 26.
  • the SARS-CoV-2 spike protein is encoded by a nucleic acid sequence set forth in any one of: SEQ ID Nos: 27-30, and 36.
  • the SARS-CoV-2 RNA or a variant thereof comprises a nucleic acid sequence set forth in SEQ ID NO: 31.
  • the method further comprises a step preceding step (a), the step comprises extracting RNA from the biological sample and performing a reverse transcription reaction using the extracted RNA as a template for producing the cDNA.
  • the biological sample is derived or obtained from an environment or a subject.
  • the biological sample derived or obtained from an environment is derived or obtained from: sewage, a water source, or soil.
  • the kit further comprises at least one probe molecule being a nucleic acid sequence capable of hybridizing to the cDNA molecule, wherein the at least one probe consists of a nucleic acid sequence selected from the group consisting of: SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 5, SEQ IN NO: 8, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 35, and any combination thereof.
  • the kit further comprises instructions for contacting the cDNA molecule complementary to the SARS-CoV-2 RNA molecule or the variant thereof with any one of: (a) the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 1, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 22, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 24; (b) the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 2, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 3, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 25; (c) the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO:
  • the SARS-CoV-2 RNA molecule comprises a nucleic acid sequence encoding SARS-CoV-2 nucleocapsid protein, spike protein, or both.
  • the kit further comprises instructions for any one of: extracting RNA from a biological sample being derived or obtained from an environment or a subject, reverse transcribing the extracted RNA to cDNA, and a combination thereof.
  • Figs. 1A-1B include a scheme and a graph showing N gene detection designs and characterization.
  • (1A) A non-limiting scheme showing improved and new primers-probe sets design along SARS-CoV-2 N gene.
  • IB Calibration curves for all examined primers- probe sets for N gene detection. Error bars present standard deviation for six replicates.
  • Fig. 2 includes graphs the lower detection limit of N gene examined primers-probe sets in wastewater matrix.
  • NTC Non-Template Control
  • Solid lines indicate the median and dashed lines indicate the detection limit as decided by clinical guidelines.
  • Fig. 3 includes a bar graph showing SARS-CoV-2 detection in wastewater using primers-probe sets Improved N3 and CDC’s N2.
  • ACt was calculated as resulted Ct for CDC’s N2 minus resulted Ct for improved N3.
  • Figs. 4A-4B include a scheme and a graph.
  • (4A) A non-limiting scheme showing designed detection sets for differentiation and identification of SARS-CoV-2 British variant B.l.1.7 and South Africa variant B.1.351.
  • (IB) Calibration curves for primers-probe sets for variants of concern detection. Error bars present standard deviation for six replicates.
  • Fig. 5 includes graphs showing lower detection limit of SA69, SA241 and SI primers-probe sets in wastewater matrix.
  • NTC Non-Template Control
  • SA69 set and SA241 set the S gene deletion template corresponded to A69-70 deletion site in B.l.1.7 and A241-243 deletion site in B.1.135.
  • SI set the S gene template corresponded to NC_045512.2 sequence.
  • Solid lines indicate the median and dashed lines indicate the detection limit as decided by clinical guidelines.
  • Fig. 6 includes a graph showing B.l.1.7 variant detection in Beer Sheva wastewater over time. Samples were collected between November 2020 and March 2021, and tested for N gene, SI and SA69 detection.
  • Figs. 7A-7B include a scheme and a graph.
  • (7A) A non-limiting scheme showing designed detection sets for differentiation and identification of SARS-CoV-2 Brazilian variant P.l and Indian variant B.1.617.
  • (7B) Calibration curves for primers-probe sets for variants of concern detection. Error bars present standard deviation for six replicates.
  • Positive DNA template for SA157 set corresponded to A156-157 deletion site in B.1.617.
  • Positive DNA template for P.l set corresponded to the DNA segment from the end of ORF8 and the beginning of N gene including the 4 nucleotides insertion.
  • Fig. 8 includes graphs showing lower detection limit of P. l and SAI 57 primers- probe sets in wastewater matrix.
  • Positive DNA template for SA157 set corresponded to A156-157 deletion site in B.1.617.
  • Positive DNA template for P.l set corresponded to the DNA segment from the end of ORF8 and the beginning of N gene including the 4 nucleotides insertion. ND - not detected.
  • Solid lines indicate the median and dashed lines indicate the detection limit as decided by clinical guidelines.
  • Figs. 9A-9C include a scheme and graphs.
  • (9A) A non-limiting scheme showing designed detection set for differentiation and identification of SARS-CoV-2 Lambda variant.
  • (9C) A graph showing limit of detection of SA246 primers-probe set in wastewater matrix. RNA extracted from negative detection wastewater sample (No virus) spiked with known concentrations of SARS-CoV-2 S gene template (10°-10 2 S gene template copies per pl) and Non-Template Control (NTC, water). Positive DNA template for SA246 set corresponded to A246-252 deletion site in Lambda variant. ND - not detected.
  • the present invention is directed to oligonucleotides, a kit comprising same, and a method of using same, such as for determining the presence of SARS-CoV-2 RNA molecule in a biological sample.
  • an oligonucleotide consisting of a nucleic acid sequence of: GACCCCAAAATCAGCGAAATG (SEQ ID NO: 1).
  • an oligonucleotide consisting of a nucleic acid sequence of: TGATTACAAACATTGGCCGC (SEQ ID NO: 2).
  • an oligonucleotide consisting of a nucleic acid sequence of: TGCCAATGCGCGACATTCCG (SEQ ID NO: 3).
  • an oligonucleotide consisting of a nucleic acid sequence of: GGGAGCCTTGAATACACCAAAAG (SEQ ID NO: 4).
  • an oligonucleotide consisting of a nucleic acid sequence of: TCACATTGGCACCCGCAATCCTGC (SEQ ID NO: 5).
  • an oligonucleotide consisting of a nucleic acid sequence of: CAATTTGCCCCCAGCGCTTC (SEQ ID NO: 6).
  • an oligonucleotide consisting of a nucleic acid sequence of: ATCCAATTTGATGGCACCTG (SEQ ID NO: 7).
  • an oligonucleotide consisting of a nucleic acid sequence of: TTCTTCGGAATGTCGCGCATTGGC (SEQ ID NO: 8).
  • an oligonucleotide consisting of a nucleic acid sequence of: GTTCTTACCTTTCTTTTCCAATGTTAC (SEQ ID NO: 9).
  • an oligonucleotide consisting of a nucleic acid sequence of: CCATCATTAAATGGTAGGACAGGG (SEQ ID NO: 10).
  • an oligonucleotide consisting of a nucleic acid sequence of: AGATTTGCCAATAGGTATTAACATC (SEQ ID NO: 11).
  • an oligonucleotide consisting of a nucleic acid sequence of: CTGAAGAAGAATCACCAGGAGTC (SEQ ID NO: 12).
  • an oligonucleotide consisting of a nucleic acid sequence of: TGGTTCCATGCTATACATGTCTCTGG (SEQ ID NO: 13).
  • an oligonucleotide consisting of a nucleic acid sequence of: TGGTTCCATGCTATCTCTGGGACC (SEQ ID NO: 14).
  • an oligonucleotide consisting of a nucleic acid sequence of: CTAGGTTTCAAACTTTACATAGAAGTT (SEQ ID NO: 15).
  • an oligonucleotide consisting of a nucleic acid sequence of: CATGACGTTCGTGTTGTTTTAG (SEQ ID NO: 16).
  • an oligonucleotide consisting of a nucleic acid sequence of: CATTTCGCTGATTTTGGGGTCC (SEQ ID NO: 17).
  • an oligonucleotide consisting of a nucleic acid sequence of: GTTTATTACCACAAAAACAACAAAAG (SEQ ID NO: 18).
  • an oligonucleotide consisting of a nucleic acid sequence of: GGCTGAGAGAGACATATTCAAAAGTG (SEQ ID NO: 19).
  • an oligonucleotide consisting of a nucleic acid sequence of: TTTCATCTAAACGAACAAACAAACTAAAAT (SEQ ID NO: 20).
  • an oligonucleotide consisting of a nucleic acid sequence of: TGGATGGAAAGTGGAGTTTATTCTAGT (SEQ ID NO: 21).
  • an oligonucleotide consisting of a nucleic acid sequence of: GGTATTAACATCACTAGGTTTCAAAC (SEQ ID NO: 33).
  • an oligonucleotide consisting of a nucleic acid sequence of: GATAACCCACATAATAAGCTGCAGC (SEQ ID NO: 34).
  • an oligonucleotide consisting of a nucleic acid sequence of: TTACTTGCTTTACATAATTCTTCTTCAGGT (SEQ ID NO: 35).
  • a composition comprising the oligonucleotide of the invention or any combination thereof.
  • the composition further comprises an acceptable carrier.
  • the oligonucleotide is a primer.
  • the oligonucleotide is a probe or a probing molecule.
  • the method comprises: (a) providing a biological sample suspected of comprising a complementary DNA (cDNA) molecule complementary to SARS-CoV-2 RNA molecule or a variant thereof; (b) contacting the biological sample of step (a) with a pair of primers capable of hybridizing to the cDNA molecule, and (c) subjecting the biological sample contacted with the pair of primers of step (b) to PCR amplification and obtaining an amplification product.
  • cDNA complementary DNA
  • the method is suitable for determining the presence or absence of RNA derived from a specific or particular SARS-CoV-2 variant.
  • obtaining an amplification product is indicative of the presence of the cDNA molecule in the biological sample, thereby determining the presence of SARS-CoV-2 RNA in the biological sample.
  • failing to obtain an amplification product is indicative of the absence of the cDNA molecule in the biological sample, thereby determining the absence of SARS-CoV-2 RNA in the biological sample.
  • the pair of primers comprises a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 1, and a second primer being an oligonucleotide consisting of the nucleic acid sequence TCTGGTTACTGCCAGTTGAATCTG (SEQ ID NO: 22).
  • the pair of primers comprises a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 2, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 3.
  • the pair of primers comprises a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 4, and a second primer being an oligonucleotide consisting of the nucleic acid sequence TGTAGCACGATTGCAGCATTG (SEQ ID NO: 23).
  • the pair of primers comprises a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 6, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 7.
  • the pair of primers comprises a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 9, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 10.
  • the pair of primers comprises a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 11, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 12.
  • the pair of primers comprises a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 16, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 17.
  • the pair of primers comprises a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 18, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 19.
  • the pair of primers comprises a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 33, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 34.
  • step (b) of the method of the invention further comprises contacting the biological sample with a probe molecule being a nucleic acid sequence capable of hybridizing to the cDNA molecule.
  • the probe is a nucleic acid molecule consisting of the nucleic acid sequence ACCCCGCATTACGTTTGGTGGACC (SEQ ID NO: 24).
  • the probe is a nucleic acid molecule consisting of the nucleic acid sequence ACAATTTGCCCCCAGCGCTTCAG (SEQ ID NO: 25).
  • the probe is a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 5.
  • the probe is a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 8.
  • the probe is a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 13.
  • the probe is a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 14.
  • the probe is a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 15.
  • the probe is a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 20.
  • the probe is a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 21.
  • the probe is a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 35.
  • step (b) of the method of the invention comprises contacting the biological sample with a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 1 , a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 22, and a probe being a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 24.
  • step (b) of the method of the invention comprises contacting the biological sample with a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 2, a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 3, and a probe being a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 25.
  • step (b) of the method of the invention comprises contacting the biological sample with a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 4, a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 23, and a probe being a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 5.
  • step (b) of the method of the invention comprises contacting the biological sample with a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 6, a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 7, and a probe being a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 8.
  • step (b) of the method of the invention comprises contacting the biological sample with a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 9, a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 10, and a probe being a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 13.
  • step (b) of the method of the invention comprises contacting the biological sample with a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 9, a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 10, and a probe being a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 14.
  • step (b) of the method of the invention comprises contacting the biological sample with a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 11, a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 12, and a probe being a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 15.
  • step (b) of the method of the invention comprises contacting the biological sample with a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 16, a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 17, and a probe being a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 20.
  • step (b) of the method of the invention comprises contacting the biological sample with a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 18, a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 19, and a probe being a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 21.
  • step (b) of the method of the invention comprises contacting the biological sample with a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 33, a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 34, and a probe being a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 35.
  • the method comprises contacting the biological sample with 2 probe molecules.
  • each of the 2 probe molecules hybridized to a different sequence.
  • the first probe molecule is complementary to a first nucleic acid sequence and the second probe molecule is complementary to a second nucleic acid sequence.
  • the first probe molecule and the second probe molecule hybridize to different nucleic acid sequence.
  • the first probe molecule and the second probe molecule have different complementary target sites.
  • the first probe molecule and the second probe molecule have target sites, wherein the target sites are different by at least one nucleotide or nucleobase compared to one another.
  • the target sites, described herein have not more than 99% homology or identity. In some embodiments, the target sites, described herein, are not identical.
  • the SARS-CoV-2 comprises any variant of the SARS-CoV- 2 virus.
  • the variant comprises any variant of SARS-CoV-2 characterized by having at least one mutation, insertion, deletion, inversion, genomic alteration, or any combination thereof.
  • the SARS-CoV-2 comprises any pathogenic variant. In some embodiments, the SARS-CoV-2 comprises any variant inducing or involved in a disease in a mammal subject, such as a human. [0105] In some embodiments, the SARS-CoV-2 variant comprises or is the British variant B.1.1.7. In some embodiments, the SARS-CoV-2 variant is the “Alpha” variant. In some embodiments, the British variant B.l.1.7 is the “Alpha” variant.
  • the SARS-CoV-2 comprises or is the South African variant B.1.351.
  • the SARS-CoV-2 variant is the “Beta” variant.
  • the South African B.1.351 is the “Beta” variant.
  • the SARS-CoV-2 variant comprises or is the Brazilian variant P.l. In some embodiments, the SARS-CoV-2 variant is the “Gamma” variant. In some embodiments, the Brazilian variant P.l is the “Gamma” variant.
  • the SARS-CoV-2 variant comprises or is the Indian variant B.1.617. In some embodiments, the SARS-CoV-2 variant is the “Delta” variant. In some embodiments, the Indian variant B.1.617 is the “Delta” variant.
  • the SARS-CoV-2 variant comprises or is the South American variant C.37. In some embodiments, the SARS-CoV-2 variant is the “Lambda” variant. In some embodiments, the South American variant C.37 is the “Lambda” variant.
  • the SARS-CoV-2 RNA molecule encodes a SARS-CoV-2 nucleocapsid protein. In some embodiments, the SARS-CoV-2 RNA molecule encodes a region located 5' upstream to the nucleic acid sequence encoding the nucleocapsid protein. In some embodiments, the region located 5' upstream to the nucleic acid sequence encoding the nucleocapsid protein is located between a nucleic acid sequence encoding ORF8 and the nucleic acid sequence encoding the nucleocapsid protein.
  • the region located 5' upstream to the nucleic acid sequence encoding the nucleocapsid protein is located 3' downstream to the nucleic acid sequence encoding ORF8 and 5' upstream to the nucleic acid sequence encoding the nucleocapsid protein.
  • the SARS-CoV-2 RNA molecule encodes a SARS-CoV-2 spike protein.
  • the SARS-CoV-2 RNA molecule encodes a SARS-CoV-2 nucleocapsid protein and a SARS-CoV-2 spike protein.
  • the region located 3' downstream to the nucleic acid sequence encoding ORF8 and 5' upstream to the nucleic acid sequence encoding the nucleocapsid protein comprises an insertion comprising at least 1, 2, 3, or 4 additional nucleotides compared to other SARS-CoV-2 variants, as described herein, or any value and range therebetween.
  • an insertion comprising at least 1, 2, 3, or 4 additional nucleotides compared to other SARS-CoV-2 variants, as described herein, or any value and range therebetween.
  • the SARS-CoV-2 P.l variant comprises the nucleic acid sequence set forth in SEQ ID NO: 31. In some embodiments, the SARS-CoV-2 P.l variant comprises at least 1, 2, 3, or 4 additional nucleotides compared SEQ ID NO: 32, or any value and range therebetween. Each possibility represents a separate embodiment of the invention. In some embodiments, the at least 1, 2, 3, or 4 additional nucleotides are contiguous nucleotides, or any value and range therebetween. Each possibility represents a separate embodiment of the invention.
  • the SARS-CoV-2 RNA molecule comprises the full genome of the SARS-CoV-2 virus. In some embodiments, the SARS-CoV-2 RNA molecule comprises a partial genome of the SARS-CoV-2 virus. In some embodiments, the SARS-CoV-2 RNA molecule comprises a fragment of the genome of the SARS-CoV-2 virus. In some embodiments, the SARS-CoV-2 RNA molecule comprises degradation products of the genome of the SARS-CoV-2 virus.
  • the SARS-CoV-2 RNA comprises or is derived from the publicly available SARS-CoV-2 genome (GenBank accession no. MN908947).
  • the SARS-CoV-2 nucleocapsid protein is encoded by the nucleic acid sequence:
  • the SARS-CoV-2 spike protein is encoded by the nucleic acid sequence:
  • the SARS-CoV-2 spike protein is encoded by the nucleic acid sequence:
  • the SARS-CoV-2 spike protein is encoded by the nucleic acid sequence:
  • the SARS-CoV-2 spike protein is encoded by the nucleic acid sequence:
  • the SARS-CoV-2 spike protein is encoded by the nucleic acid sequence:
  • the SARS-CoV-2 spike protein is encoded by the nucleic acid sequence: (SEQ ID NO: 27).
  • the SARS-CoV-2 spike protein of the British variant (B.1.1.7) as referred to herein comprises or consists of SEQ ID NO: 28.
  • the SARS-CoV-2 spike protein of the South African variant (B.1.351) as referred to herein comprises or consists of SEQ ID NO: 29.
  • the SARS-CoV-2 spike protein of the Indian variant (B.1.617) as referred to herein comprises or consists of SEQ ID NO: 30.
  • the SARS-CoV-2 spike protein of the South American variant (C.37) as referred to herein comprises or consists of SEQ ID NO: 36.
  • the SARS-CoV-2 spike protein is encoded by any one of SEQ ID Nos: 27-30, and 36.
  • the SARS-CoV-2 of the Brazilian variant (P.l) as referred to herein comprises the nucleic acid sequence: CAUGACGUUCGUGUUGUUUUAGAUUUCAUCUAAACGAACAAACAAACUAA AAUGUCUGAUAAUGGACCCCAAAAUCAGCGAAAUG (SEQ ID NO: 31).
  • the SARS-CoV-2 of the "original" SARS-CoV-2 variant comprises the nucleic acid sequence: CAUGACGUUCGUGUUGUUUUAGAUUUCAUCUAAACGAACAAACUAAAAUG UCUGAUAAUGGACCCCAAAAUCAGCGAAAUG (SEQ ID NO: 32).
  • the method further comprises an additional step, comprising extracting RNA from the biological sample. In some embodiments, the method further comprises an additional step comprising performing a reverse transcription reaction using extracted RNA as a template for producing cDNA. In some embodiments, the method further comprises an additional step comprising extracting RNA from the biological sample and performing a reverse transcription reaction using extracted RNA as a template for producing cDNA. In some embodiments, the additional step proceeds step (a) of the herein disclosed method.
  • the biological sample is derived or obtained from an environment or a subject.
  • a biological sample derived or obtained from an environment is derived or obtained from: sewage, a water source, or soil.
  • the present invention provides combined preparations.
  • a combined preparation defines especially a “kit of parts” in the sense that the combination partners as defined above can be dosed independently or by use of different fixed combinations with distinguished amounts of the combination partners i.e., simultaneously, concurrently, separately or sequentially.
  • the parts of the kit of parts can then, e.g., be used simultaneously or chronologically staggered, that is at different time points and with equal or different time intervals for any part of the kit of parts.
  • the ratio of the total amounts of the combination partners in some embodiments, can be used in the combined preparation.
  • kits for determining the presence of SARS-CoV-2 RNA molecule in a biological sample comprising at least one pair of primers capable of amplifying a cDNA molecule complementary to the SARS-CoV- 2 RNA molecule.
  • the at least one pair of primers is selected from: (i) a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 1, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 22; (ii) a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 2, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 3; (iii) a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 4, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 23; (iv) a first primer being an oligonucleotide
  • the kit further comprises at least one probe molecule being a nucleic acid sequence capable of hybridizing to the cDNA molecule.
  • the at least one probe consists of a nucleic acid sequence selected from: SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 5, SEQ IN NO: 8, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 35, and any combination thereof.
  • the kit further comprises instructions for contacting the cDNA molecule complementary to the SARS-CoV-2 RNA molecule with: the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 1, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 22, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 24.
  • the kit further comprises instructions for contacting the cDNA molecule complementary to the SARS-CoV-2 RNA molecule with: the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 2, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 3, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 25.
  • the kit further comprises instructions for contacting the cDNA molecule complementary to the SARS-CoV-2 RNA molecule with: the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 4, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 23, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 5.
  • the kit further comprises instructions for contacting the cDNA molecule complementary to the SARS-CoV-2 RNA molecule with: the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 6, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 7, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 8.
  • the kit further comprises instructions for contacting the cDNA molecule complementary to the SARS-CoV-2 RNA molecule with: the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 9, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 10, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 13.
  • the kit further comprises instructions for contacting the cDNA molecule complementary to the SARS-CoV-2 RNA molecule with: the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 9, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 10, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 14.
  • the kit further comprises instructions for contacting the cDNA molecule complementary to the SARS-CoV-2 RNA molecule with: the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 11, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 12, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 15.
  • the kit further comprises instructions for contacting the cDNA molecule complementary to the SARS-CoV-2 RNA molecule with: the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 16, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 17, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 20.
  • the kit further comprises instructions for contacting the cDNA molecule complementary to the SARS-CoV-2 RNA molecule with: the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 18, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 19, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 21.
  • the kit further comprises instructions for contacting the cDNA molecule complementary to the SARS-CoV-2 RNA molecule with: the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 33, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 34, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 35.
  • the kit further comprises instructions for: extracting RNA from a biological sample being derived or obtained from an environment or a subject, reverse transcribing the extracted RNA to cDNA, or any combination thereof.
  • the present invention provides at least one pair of DNA primers capable of amplifying a nucleic acid molecule, e.g., SARS-CoV-2 RNA complementary DNA (cDNA), as described herein, in a polymerase chain reaction (PCR).
  • a nucleic acid molecule e.g., SARS-CoV-2 RNA complementary DNA (cDNA)
  • PCR polymerase chain reaction
  • the present invention provides at least one pair of amplification DNA primers for PCR.
  • the present invention further provides at least one probe, capable of hybridizing to a nucleic acid molecule, e.g., SARS-CoV-2 RNA complementary DNA (cDNA), as described herein, and of generating a detectable signal.
  • the detectable signal is correlative to the amount of the nucleic acid molecule, e.g., SARS-CoV-2 RNA complementary DNA (cDNA).
  • the probe is being hydrolyzed in the polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • hydrolyzed comprises 5’ to 3’ exonucleation.
  • hydrolyzed is by 5’ to 3’ exonuclease activity of a DNA polymerase.
  • the DNA polymerase is the DNA polymerase of the PCR amplification.
  • the probe comprises a dye.
  • the probe comprises a quencher.
  • the probe is detectable after being partially or fully hydrolyzed. In some embodiments, an intact probe is undetected.
  • the terms “exonuclease” or “exonucleation” refer to an enzyme or activity thereof, respectfully, capable of cleaving nucleotides one at a time from the terminal end of a nucleic acid chain.
  • the probe comprises at least one DNA nucleotide. In some embodiments, the probe comprises at least one RNA nucleotide. In some embodiments, the probe comprises at least one locked nucleic acid (LNA) nucleotide. In some embodiments, the probe is a DNA probe. In some embodiments, the probe is an RNA probe. In some embodiments, the probe is an LNA probe. In some embodiments, the probe comprises: at least one DNA nucleotide, at least one RNA nucleotide, at least one LNA nucleotide, or any combination thereof.
  • LNA locked nucleic acid
  • probe refers to a labeled or unlabeled oligonucleotide capable of selectively hybridizing to a target or template nucleic acid under suitable conditions.
  • a probe is sufficiently complementary to a specific target sequence contained in a nucleic acid sample to form a stable hybridization duplex with the target sequence under a selected hybridization condition, such as, but not limited to, a stringent hybridization condition.
  • a hybridization assay carried out using the probe under sufficiently stringent hybridization conditions permits the selective detection of a specific target sequence.
  • the hybridizing region is typically from about 8 to about 100 nucleotides in length.
  • the probe may include additional nucleotide sequences that function, for example, as linker binding sites to provide a site for attaching the probe sequence to a solid support or the like, as sites for hybridization of other oligonucleotides, as restriction enzymes sites or binding sites for other nucleic acid binding enzymes, etc.
  • a probe of the invention is included in a nucleic acid that comprises one or more labels (e.g., a reporter dye, a quencher moiety, a fluorescent labeling, etc.), such as a 5 '-nuclease probe, a FRET probe, a molecular beacon, or the like, which can also be utilized to detect hybridization between the probe and target nucleic acids in a sample.
  • the hybridizing region of the probe is completely complementary to the target sequence. However, in general, complete complementarity is not necessary (i.e., nucleic acids can be partially complementary to one another); stable duplexes may contain mismatched bases or unmatched bases.
  • Modification of the stringent conditions may be necessary to permit a stable hybridization duplex with one or more base pair mismatches or unmatched bases.
  • Stability of the target/probe duplex depends on a number of variables including length of the oligonucleotide, base composition and sequence of the oligonucleotide, temperature, and ionic conditions.
  • exemplary probe nucleic acids include 5 '-nuclease probes, molecular beacons, among many others known to persons of skill in the art.
  • hybridization refers to a reaction in which at least one polynucleotide reacts to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues.
  • the hydrogen bonding may occur by Watson-Crick base pairing, in any other sequence- specific manner.
  • PCR comprises denaturing double-stranded DNA in a sample (to separate the complementary strands), annealing the primers to the dissociated DNA strands, and extension reaction from the primers catalyzed by a thermostable DNA polymerase, the cycle is then repeated.
  • PCR comprises denaturing double-stranded DNA in a sample (to separate the complementary strands), annealing the primers to the dissociated DNA strands, annealing the probe to one of the dissociated DNA strands, extension reaction from the primers catalyzed by a thermostable DNA polymerase, 5’ to 3’ exonucleation of the probe hybridized to one of the dissociated DNA strands, and determining the amount of signal generated by the 5’ to 3’ exonucleation of the probe, the cycle is then repeated.
  • a pair of DNA primers as described herein are specifically complementary to and hybridizing with opposite strands DNA with one to the left (5') and one to the right (3') of the target sequence within the SARS-CoV-2 RNA complementary DNA to be amplified.
  • the target sequence within the SARS-CoV-2 RNA complementary DNA to be amplified is a nucleic acid molecule encoding a spike protein, as described herein.
  • the target sequence within the SARS- CoV-2 RNA complementary DNA to be amplified is a nucleic acid molecule encoding a nucleocapsid protein as described herein.
  • the target sequence within the SARS-CoV-2 RNA complementary DNA to be amplified is a nucleic acid molecule located 3' downstream to a nucleic acid sequence encoding ORF8 and 5' upstream to a nucleic acid sequence encoding the nucleocapsid protein, as described herein.
  • the existence of a nucleic acid molecule as described herein in a biological sample provides direct evidence for the presence of SARS-CoV-2 RNA in the biological sample as described herein.
  • the absence of an amplification product resulting from contacting a biological sample suspected of comprising a SARS-CoV-2 RNA complementary DNA with oligonucleotides of the invention under PCR amplification conditions indicates that the biological sample is devoid of SARS-CoV-2 RNA, SARS- CoV-2 RNA complementary DNA, or both.
  • the biological sample comprises an environment derived biological sample.
  • the biological sample is obtained from the environment.
  • the biological sample is obtained or derived form a subject, such as, but not limited to a mammal, e.g., a human.
  • the subject is a human subject (as may be referred to herein as “clinical sample”).
  • an environment derived biological sample is derived or obtained from sewage.
  • an environment derived biological sample is derived or obtained from a water source.
  • a water source comprises: a lake, a water reservoir, a stream, a river, or a wastewater treatment or processing plant.
  • a water source comprises any body of water used by humans, or in proximity to a human settlement which is affected or connected to human activity.
  • a water source is polluted by human activity.
  • the water source comprises a lake, a stream, or a river that is polluted by water wastes provided by human activity, e.g., sewage, wastewater, treated water, or any equivalent thereof, or any combination thereof.
  • a kit as described herein further comprises a DNA polymerase. In one embodiment, a kit as described herein further comprises a thermostable DNA polymerase.
  • the DNA polymerase has a proof-reading activity. In some embodiments, the DNA polymerase has a 5’ to 3’ exonuclease activity. In some embodiments, the DNA polymerase is capable of digesting a probe molecule hybridized to a dissociated DNA strand. In some embodiments, the DNA polymerase is capable of digesting a probe molecule hybridized to a dissociated DNA strand simultaneously to its extension or polymerization activity.
  • the kit as described herein comprises a PCR buffer.
  • a nonlimiting example of a PCR buffer includes but is not limited to a buffer comprising: 5 to 100 mM Tris-HCl and 20 to 100 mM KC1.
  • the PCR buffer may further comprise 10 to 100 mM Magnesium Chloride.
  • the kit as described herein comprises a dNTP mixture.
  • the kit as described herein comprise DNA Polymerase such as but not limited to Taq DNA Polymerase.
  • the kit as described herein comprise distilled water.
  • compositions, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
  • method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
  • NC_045512.2 The original sequence of SARS-CoV-2 (NC_045512.2) was taken from NCBI database.
  • British B.1.1.7 variant EPI_ISL_742238
  • SA B.1.351 variant EPI_ISL_736935
  • P.l variant EPI_ISL_981709
  • B.1.617 variant EPI_ISL_1704637 sequences were taken from GISAID database (Shu and McCauley, 2017).
  • the probe design focused on the S gene 21724-21828 bp location that includes the British deletion 69-70, or S gene 22243-22331 bp location that includes the SA deletion 241-243, or the end of ORF8 and the beginning of N gene 28227-28286 bp location that includes the P.l insertion, or S gene 21989-22083 bp location that includes the Indian deletion 157-158. All primers and probes were purchased through Integrated DNA Technologies (IDT). ZEN Quencher was added to the probes as a second, internal quencher in qPCR 5’-nuclease assay.
  • IDTT Integrated DNA Technologies
  • SI probe was assigned a 6-carboxy-fluorescein (FAM) fluorophore and SA69 probe was assigned to Yakima Yellow (YakYel) fluorophore.
  • SA241, SA157 and P.l probes were assigned with FAM as well.
  • RT-qPCR was executed using One Step PrimeScript III RT-qPCR mix using standard manufacture protocol (RR600 TAKARA, Japan). Each reaction mixture contains primers (0.5 pM each), probe (0.2 pM each), ROX reference dye and 5 pL of DNA or RNA (dfLO was added to a final volume of 20 pL reaction volume). RT-qPCR amplification was executed using Step One Plus real-time PCR system (Applied Biosystems, Thermo Scientific). In addition to what is described above, in each run, all RT-qPCR experiments included quality controls. The first control was using water samples instead of DNA/RNA (Non template control (NTC)). The second control, used for RNA extractions, was MS2 phage detection (Dreier et al., 2005).
  • Calibration of SI probe was performed using the first gene block, while calibration of SA69 probe and SA241 was performed using the second gene block with the relevant deletions.
  • Calibration of P.l was performed with the third gene block and calibration of SA157 was performed with the fourth gene block. All N gene related calibrations were performed with the fifth gene block.
  • Serial dilutions for the relevant gene block were prepared based on copy number calculations. The resulting Ct values were plotted against the log copy number of the S gene template. Each concentration was examined by a minimum of six repetitions and a standard deviation was calculated. Linear regression was performed between the log copy number and the Ct values from the RT-qPCR results.
  • RNA extracted from wastewater sample pre-determined as negative for SARS- CoV-2 using standard CDC’s detection sets, was supplemented with known concentrations of a desired gene block.
  • the samples underwent the same RT-qPCR conditions as described for the calibration curves.
  • Matrix pre-determined as negative was constantly verified as negative in each assay without spiking. In each set, eight repetitions were performed for each viral concentration or control. Ct results were plotted to represent the new probes limit of detection in a complex environment.
  • a volume of two to five liter of 24 hr composite wastewater samples collected from the WWTP were shaken and mixed for 2 minutes manually. The samples were left standing for 15 minutes to ensure large particle settlement. The samples were then pumped at a rate of 10 L/min through a dialysis filter with a pore size 3-30 nm (NUFiltration ⁇ , Israel). The filter was backwashed with 0.07 to 0.15 Liter DW and collected directly to new 0.25 L bottle. After each sample concentration procedure, 2.5 liter of 0.01% hypochlorite solution was passed through the system followed by a 10 minute wash with DW to ensure no hypochlorite traces and new dialysis filter was placed for new batch concentration.
  • the 3' end of a primer sequence is the transcription initiation point for the polymerase, it is preferable the 3' end of a primer will possess G/C for more stable annealing (3 hydrogen bonds, compared to only 2 between A/T pair).
  • the primers were shifted to include G/C.
  • the probe sequence was shifted as well in order to maintain close proximity to the forward primer. Based on this approach, all 3 of the recommended primers-probe sets were improved (Fig. 1A, and Table 1).
  • the inventors also generated a fourth primers-probe termed “N4 new”. The new and improved sequences are presented in Table 1.
  • New oligonucleotides provide improved detection in an environmental sample with increased amplification efficacy and sensitivity
  • LOD is determined as the lowest detected copy number per pL in 90% of the tested cases. Given the complexity of the wastewater matrix, a reduction in LOD could be observed for all sets, CDC and Improved sets, except for in Improved N3 set. Compared to the calibration curves, while all the sets LOD rose to 100 copies per pL (compared to 10 or 1 copies concluded before), the Improved N3 was the only set that remained with a stable LOD value of 1 copy per pL. Comparison between the CDC’s sets and improved sets in a controlled wastewater sample, revealed that each improved set demonstrated better detection abilities than the original CDC's set, as expected.
  • the designed set is located at the S gene 21724-21828 bp of the original sequence. Within this range, the original SARS-CoV-2 and B.l.1.7 sequences are completely identical, apart from 6 nucleotides deletions (Fig. 4A). Our main attempt was to create two separate detections to the amplified area, one corresponding to the original sequence (when using SI probe) and the other corresponding to the B.l.1.7 (when using the SA69 probe). Using designated primers (Table 3) to amplify the specified region surrounding the 6 nucleotides differences, amplification will be generated regardless of the variant. The probes can thus be used in a single duplex assay via separate wavelengths, where a signal signifies a direct detection of either the original sequence, of B.l.1.7, or a combination of the two if exist.
  • Table 3 List of the oligonucleotides of the invention targeting the Spike 1 protein encoding gene (of the “original variant”, the “British variant”, and the “south African” variant, as disclosed herein).
  • the designated detection region was chosen further along the S gene when compared to the B.l.1.7 detection region. Focusing on S gene 22243- 22331 bp of the original sequence, the original SARS-CoV-2 sequence is identical to the B.1.351 sequence except for a 9 nucleotide deletion (Fig. 4A).
  • a detection set comprised of two primers meant to amplify the target region
  • SA241 probe was designed for the detection of the B.1.351 variant.
  • the SA241 probe is meant to correspond only to the deletion of 9 nucleotides in the specified region characterizing B.1.315, therefore it will signal detection only when B.1.351 is present and will not correspond to the original or B.1.1.7 sequence.
  • Table 4 List of Limit of detection, Linear regression R 2 , and Y intercept values based on calibration curves.
  • each set was tested with a negative control.
  • the negative control was comprised of a dsDNA template with the S gene with A69-70 and A241-243 nucleotides deletions. While for SA69 set and SA241 set, the original S gene sequence was used as negative control. As expected, none of the probes manifested a signal in the presence of a negative control and non-specific detection was not observed (Table 5).
  • the inventors have developed a direct RT-qPCR assay for detection of variants of concern, the Brazilian variant P.l and Indian variant B.1.617. These were believed to be the most urgent variants in need for fast detection in Israel.
  • the herein disclosed design for RT-qPCR detection assays of these two variants (Fig. 7) is based on the differences in gene sequence from the original SARS-CoV-2 sequence published (NC_045512.2).
  • the P.l variant contains an insertion located between the ORF8 region and the nucleocapsid gene, and the B.1.617 S gene contains a deletion known as A157-158. Accordingly, the herein disclosed designed detection-probe set focused on these regions and presented in Fig. 7.
  • the designed forward primer is located at the end of ORF8 gene, and the reverse primer is located at the beginning of N gene, meaning 28227- 28286 bp of the original sequence.
  • the original SARS-CoV-2 and P.l sequences are completely identical, apart from a 4 nucleotides insertion (Fig. 7A).
  • a detection set comprised of two primers meant to amplify the target region
  • a single probe was designed for the detection of the P.l variant only (corresponding to the insertion).
  • the designated detection region was chosen from within the S gene.
  • the original SARS-CoV-2 sequence is identical to the B.1.617 sequence with the exception of a 6 nucleotides deletion (Fig. 7A).
  • SAI 57 probe was designed for the detection of the B.1.617 variant only (corresponding to the deletion; Table 6).
  • Table 7 List of Limit of detection, Linear regression R 2 , and Y intercept values based on calibration curves.
  • the inventors developed a direct RT-qPCR assay for detection of Lambda variant.
  • the herein disclosed design for RT-qPCR detection assay of this variant is based on the differences in spike protein gene sequence between the original SARS-CoV-2 (NC_045512.2) and the Lambda variant (GISAID ID EPI_ISL_2795719).
  • the Lambda variant also known as C.37 S gene, contains a deletion known as A246-252. Accordingly, the herein disclosed designed primers-probe detection set focused on this region as presented in Fig. 9, meaning the target sequence of 22256-22370 bp in the original sequence.
  • the original SARS-CoV-2 and Lambda sequences are completely identical, apart from a 21 nucleotides deletion (Fig. 9A).
  • a detection set comprising two primers meant to amplify the target region
  • a single probe was designed for the detection of the Lambda variant only (corresponding strictly to the deletion in this region; Table 10).
  • Table 10 List of the oligonucleotides of the invention targeting the Spike 1 protein encoding gene of the C.37 variant, e.g., “Lambda variant”).
  • the described set of primers and probe underwent characterization. Initially, a calibration curve was generated for primers with the relevant probe, using dsDNA as a template. A detection range of between 10 6 copies and 10° copies per pl was tested (Fig. 9B). Linear regression performed demonstrated strong correlation and validated the usage of the probe on the amplified fragment. A limit of detection (LOD) could be determined as 10 2 copies per pl (Table 11). Specificity of the described set was also examined through analysis of wastewater found positive for the original SARS-CoV- 2, the British B 1.1.7 variant or the Delta B.1.617 variant. Moreover, a negative control for the SA246 set was tested in the form of a linear gene block corresponding to a part of the original variant's S gene. As expected, the SA246 set did not manifest a signal in any of these samples and was therefore found to be highly specific.
  • Table 11 List of Limit of detection, Linear regression R 2 , and Y intercept values based on a calibration curve.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention is directed to specific oligonucleotides, a kit comprising same, and a method of using same, such as for determining the presence of SARS-CoV-2 RNA in a biological or an environmental sample.

Description

OLIGONUCLEOTIDES AND METHODS OF USING SAME
CROSS-REFERENCE TO RELATED APPLICATIONS
[001] This application claims the benefit of priority of U.S. Provisional Application No. 63/069,777, filed August 25, 2020, U.S. Provisional Application No. 63/150,329, filed February 17, 2021, and of U.S. Provisional Application No. 63/218,324, filed July 4, 2021, all titled “OLIGONUCLEOTIDES AND METHODS OF USING SAME”. The contents of these applications are incorporated herein by reference in their entirety.
FIELD OF THE INVENTION
[002] The present invention is in the field of molecular biology and diagnostics.
BACKGROUND
[003] The SARS-CoV-2 world pandemic erupted in early 2020 with rising numbers in morbidity and mortality. SARS-CoV-2 was recognized as an RNA virus, therefore detection methods emerging for immediate response were mainly based on of reverse transcriptase quantitative polymerase chain reaction (RT-qPCR). In RT-qPCR, RNA is extracted, undergoes reverse transcription for DNA strand generation, followed by PCR amplification and TaqMan probes fluorescence detection. To date, RT-qPCR is the most common methodology for SARS-CoV-2 diagnostics.
[004] Starting in September 2020, new variants of concern of SARS-CoV-2 virus began to be detected in patients. Amongst them are the variants termed: the “British variant B.l.1.7”, the “South Africa (SA) variant B.1.351”, the “Brazilian variant P.l”, and the “Indian variant B.1.617”, which became dominant compared to the original SARS-CoV-2 virus.
[005] Currently, three methodologies have been developed for SARS-CoV-2 variant diagnostics. The first methodology, that is still the one being mainly employed, is the next generation sequencing (NGS) approach. In NGS the entire variant’s genome is sequenced. Despite the importance of this technique for identification of new variants, it is timeconsuming (three to five days minimum) and requires significant financial means and data analysis. [006] Other detection methods are based on RT-qPCR and include a "drop-out" signal. These methodologies use RT-qPCR with two different markers, a double signal manifest for the original SARS-CoV-2 virus, while only a single signal manifest for the targeted variant. Another detection methodology uses the characterization of ACt between one detection signal and another, amongst the different variants. These current RT-qPCR approaches for variant detection, though significantly faster and more cost-effective than the NGS methodology, focus on indirect detection and may result in false/inconclusive identification.
[007] Urban sewage treatment is carried out through wastewater treatment plants that are usually separated from industrial sewage. Therefore, wastewater sampling is often used as an epidemiological tool, and numerous countries have adopted this methodology as it provides a more reliable representation of population morbidity status compared to volunteered clinical tests as it can provide a snapshot of the microbial lineages and their diversity in the population. Nonetheless, although wastewater samples are not unbiased, they do pose some challenges when monitored.
[008] Therefore, there is still a great need for detection methods with improved specificity, sensitivity, and speed of detection of SARS-CoV-2 variants. Such advanced methodologies will be amenable for clinical diagnostics as well as for environmental- derived quantification, greatly improving wastewater and population level epidemiological investigation.
SUMMARY
[009] According to some embodiments, the present invention is directed to a method for detecting or determining the presence of a viral-derived polynucleotide in a biological sample. In some embodiments, the biological sample comprises an environmental sample or a sample obtained or derived form a subject.
[010] In some embodiments, the present invention is directed to specific oligonucleotides, compositions comprising same, and kits comprising same, for use in the determination of the presence of viral-derived polynucleotide in a sample.
[Oi l] In some embodiments, the present invention is based in part, on the finding that the particular oligonucleotides disclosed herein below, provided detection of SARS-Cov- 2-derived RNA (or a complementary DNA thereto) or variants thereof, in a sample, including an environmental sample obtained or derived from wastewater, with greater amplification efficacy and sensitivity, compared to the state-of-the-art oligonucleotides and current practice.
[012] According to a first aspect, there is provided a method for determining the presence of SARS-CoV-2 RNA or a variant thereof in a biological sample comprising: (a) providing a biological sample suspected of comprising a complementary DNA (cDNA) molecule complementary to SARS-CoV-2 RNA molecule; (b) contacting the biological sample of step (a) with a pair of primers capable of hybridizing to the cDNA molecule, wherein the pair of primers comprises any one of: (i) a first primer being an oligonucleotide consisting of the nucleic acid sequence GACCCCAAAATCAGCGAAATG (SEQ ID NO: 1), and a second primer being an oligonucleotide consisting of the nucleic acid sequence TCTGGTTACTGCCAGTTGAATCTG (SEQ ID NO: 22); (ii) a first primer being an oligonucleotide consisting of the nucleic acid sequence TGATTACAAACATTGGCCGC (SEQ ID NO: 2), and a second primer being an oligonucleotide consisting of the nucleic acid sequence TGCCAATGCGCGACATTCCG (SEQ ID NO: 3); (iii) a first primer being an oligonucleotide consisting of the nucleic acid sequence GGGAGCCTTGAATACACCAAAAG (SEQ ID NO: 4), and a second primer being an oligonucleotide consisting of the nucleic acid sequence TGTAGCACGATTGCAGCATTG (SEQ ID NO: 23); (iv) a first primer being an oligonucleotide consisting of the nucleic acid sequence CAATTTGCCCCCAGCGCTTC (SEQ ID NO: 6), and a second primer being an oligonucleotide consisting of the nucleic acid sequence ATCCAATTTGATGGCACCTG (SEQ ID NO: 7); (v) a first primer being an oligonucleotide consisting of the nucleic acid sequence GTTCTTACCTTTCTTTTCCAATGTTAC (SEQ ID NO: 9), and a second primer being an oligonucleotide consisting of the nucleic acid sequence CCATCATTAAATGGTAGGACAGGG (SEQ ID NO: 10); (vi) a first primer being an oligonucleotide consisting of the nucleic acid sequence
AGATTTGCCAATAGGTATTAACATC (SEQ ID NO: 11), and a second primer being an oligonucleotide consisting of the nucleic acid sequence
CTGAAGAAGAATCACCAGGAGTC (SEQ ID NO: 12); (vii) a first primer being an oligonucleotide consisting of the nucleic acid sequence
CATGACGTTCGTGTTGTTTTAG (SEQ ID NO: 16), and a second primer being an oligonucleotide consisting of the nucleic acid sequence
CATTTCGCTGATTTTGGGGTCC (SEQ ID NO: 17); (viii) a first primer being an oligonucleotide consisting of the nucleic acid sequence GTTTATTACCACAAAAACAACAAAAG (SEQ ID NO: 18), and a second primer being an oligonucleotide consisting of the nucleic acid sequence GGCTGAGAGACATATTCAAAAGTG (SEQ ID NO: 19); (ix) a first primer being an oligonucleotide consisting of the nucleic acid sequence GGTATTAACATCACTAGGTTTCAAAC (SEQ ID NO: 33), and a second primer being an oligonucleotide consisting of the nucleic acid sequence GATAACCCACATAATAAGCTGCAGC (SEQ ID NO: 34) and (c) subjecting the biological sample contacted with the pair of primers of step (b) to PCR amplification and obtaining an amplification product, wherein the amplification product is indicative of the presence of the cDNA molecule in the biological sample, thereby determining the presence of the SARS-CoV-2 RNA or a variant thereof in the biological sample.
[013] According to another aspect, there is provided a kit for determining the presence of SARS-CoV-2 RNA molecule or a variant thereof in a biological sample, comprising at least one pair of primers capable of amplifying a cDNA molecule complementary to the SARS-CoV-2 RNA molecule, wherein the at least one pair of primers is selected from the group consisting of: (i) a first primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 1, and a second primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 22; (ii) a first primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 2, and a second primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 3; (iii) a first primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 4, and a second primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 23; (iv) a first primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 6, and a second primer being an oligonucleotide consisting of the (v) a first primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 9, and a second primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 10; (vi) a first primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 11, and a second primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 12; (vii) a first primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 16, and a second primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 17; (viii) a first primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 18, and a second primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 19; (ix) a first primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 33, and a second primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 34; and (x) any combination of (i) to (ix).
[014] In some embodiments, step (b) further comprises contacting the biological sample with a probe molecule being a nucleic acid sequence capable of hybridizing to the cDNA molecule, wherein the: step (b)(i) comprises contacting the biological sample with a probe being a nucleic acid molecule consisting of the nucleic acid sequence ACCCCGCATTACGTTTGGTGGACC (SEQ ID NO: 24); step (b)(ii) comprises contacting the biological sample with a probe being a nucleic acid molecule consisting of the nucleic acid sequence ACAATTTGCCCCCAGCGCTTCAG (SEQ ID NO: 25); step (b)(iii) comprises contacting the biological sample with a probe being a nucleic acid molecule consisting of the nucleic acid sequence TCACATTGGCACCCGCAATCCTGC (SEQ ID NO: 5); step (b)(iv) comprises contacting the biological sample with a probe being a nucleic acid molecule consisting of the nucleic acid sequence TTCTTCGGAATGTCGCGCATTGGC (SEQ ID NO: 8); step (b)(v) comprises contacting the biological sample with a probe being a nucleic acid molecule consisting of the nucleic acid sequence TGGTTCCATGCTATACATGTCTCTGG (SEQ ID NO: 13) or TGGTTCCATGCTATCTCTGGGACC (SEQ ID NO: 14); step (b)(vi) comprises contacting the biological sample with a probe being a nucleic acid molecule consisting of the nucleic acid sequence CTAGGTTTCAAACTTTACATAGAAGTT (SEQ ID NO: 15); step (b)(vii) comprises contacting the biological sample with a probe being a nucleic acid molecule consisting of the nucleic acid sequence TTTCATCTAAACGAACAAACAAACTAAAAT (SEQ ID NO: 20); step (b)(viii) comprises contacting the biological sample with a probe being a nucleic acid molecule consisting of the nucleic acid sequence TGGATGGAAAGTGGAGTTTATTCTAGT (SEQ ID NO: 21); and step (b)(ix) comprises contacting the biological sample with a probe being a nucleic acid molecule consisting of the nucleic acid sequence TTACTTGCTTTACATAATTCTTCTTCAGGT (SEQ ID NO: 35).
[015] In some embodiments, the SARS-CoV-2 RNA molecule encodes a SARS-CoV-2 nucleocapsid protein or a SARS-CoV-2 spike protein. [016] In some embodiments, the SARS-CoV-2 nucleocapsid protein is encoded by a nucleic acid sequence set forth in SEQ ID NO: 26.
[017] In some embodiments, the SARS-CoV-2 spike protein is encoded by a nucleic acid sequence set forth in any one of: SEQ ID Nos: 27-30, and 36.
[018] In some embodiments, the SARS-CoV-2 RNA or a variant thereof comprises a nucleic acid sequence set forth in SEQ ID NO: 31.
[019] In some embodiments, the method further comprises a step preceding step (a), the step comprises extracting RNA from the biological sample and performing a reverse transcription reaction using the extracted RNA as a template for producing the cDNA.
[020] In some embodiments, the biological sample is derived or obtained from an environment or a subject.
[021] In some embodiments, the biological sample derived or obtained from an environment is derived or obtained from: sewage, a water source, or soil.
[022] In some embodiments, the kit further comprises at least one probe molecule being a nucleic acid sequence capable of hybridizing to the cDNA molecule, wherein the at least one probe consists of a nucleic acid sequence selected from the group consisting of: SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 5, SEQ IN NO: 8, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 35, and any combination thereof.
[023] In some embodiments, the kit further comprises instructions for contacting the cDNA molecule complementary to the SARS-CoV-2 RNA molecule or the variant thereof with any one of: (a) the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 1, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 22, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 24; (b) the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 2, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 3, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 25; (c) the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 4, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 23, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 5; (d) the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 6, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 7, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 8; (e) the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 9, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 10, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 13 or SQ ID NO: 14; (f) the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 11, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 12, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 15; (g) the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 16, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 17, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 20; (h) the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 18, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 19, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 21; and (i) the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 33, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 34, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 35.
[024] In some embodiments, the SARS-CoV-2 RNA molecule comprises a nucleic acid sequence encoding SARS-CoV-2 nucleocapsid protein, spike protein, or both.
[025] In some embodiments, the kit further comprises instructions for any one of: extracting RNA from a biological sample being derived or obtained from an environment or a subject, reverse transcribing the extracted RNA to cDNA, and a combination thereof.
[026] Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting. [027] Further embodiments and the full scope of applicability of the present invention will become apparent from the detailed description given hereinafter. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.
BRIEF DESCRIPTION OF THE FIGURES
[028] Figs. 1A-1B include a scheme and a graph showing N gene detection designs and characterization. (1A) A non-limiting scheme showing improved and new primers-probe sets design along SARS-CoV-2 N gene. (IB) Calibration curves for all examined primers- probe sets for N gene detection. Error bars present standard deviation for six replicates.
[029] Fig. 2 includes graphs the lower detection limit of N gene examined primers-probe sets in wastewater matrix. RNA extracted from negative detection wastewater sample (No virus) spiked with known concentrations of SARS-CoV-2 S gene template (lO^lO2 N gene template copies per pL) and Non-Template Control (NTC, water). ND - not detected. Solid lines indicate the median and dashed lines indicate the detection limit as decided by clinical guidelines.
[030] Fig. 3 includes a bar graph showing SARS-CoV-2 detection in wastewater using primers-probe sets Improved N3 and CDC’s N2. For each sample out of 148 different samples in September-December 2020, ACt was calculated as resulted Ct for CDC’s N2 minus resulted Ct for improved N3. Any sample where CDC’s N2 resulted in a signal and improved N3 did not, an arbitrary value of -5 was assigned and colored in blue. Any sample where improved N3 resulted in a signal and CDC’s N2 did not, an arbitrary value of +5 was assigned and colored in red.
[031] Figs. 4A-4B include a scheme and a graph. (4A) A non-limiting scheme showing designed detection sets for differentiation and identification of SARS-CoV-2 British variant B.l.1.7 and South Africa variant B.1.351. (IB) Calibration curves for primers-probe sets for variants of concern detection. Error bars present standard deviation for six replicates.
[032] Fig. 5 includes graphs showing lower detection limit of SA69, SA241 and SI primers-probe sets in wastewater matrix. RNA extracted from negative detection wastewater sample (No virus) spiked with known concentrations of SARS-CoV-2 S gene template (10°-102 S gene template copies per pL) and Non-Template Control (NTC, water). For SA69 set and SA241 set, the S gene deletion template corresponded to A69-70 deletion site in B.l.1.7 and A241-243 deletion site in B.1.135. For SI set, the S gene template corresponded to NC_045512.2 sequence. ND - not detected. Solid lines indicate the median and dashed lines indicate the detection limit as decided by clinical guidelines.
[033] Fig. 6 includes a graph showing B.l.1.7 variant detection in Beer Sheva wastewater over time. Samples were collected between November 2020 and March 2021, and tested for N gene, SI and SA69 detection.
[034] Figs. 7A-7B include a scheme and a graph. (7A) A non-limiting scheme showing designed detection sets for differentiation and identification of SARS-CoV-2 Brazilian variant P.l and Indian variant B.1.617. (7B) Calibration curves for primers-probe sets for variants of concern detection. Error bars present standard deviation for six replicates. Positive DNA template for SA157 set, corresponded to A156-157 deletion site in B.1.617. Positive DNA template for P.l set, corresponded to the DNA segment from the end of ORF8 and the beginning of N gene including the 4 nucleotides insertion.
[035] Fig. 8 includes graphs showing lower detection limit of P. l and SAI 57 primers- probe sets in wastewater matrix. RNA extracted from negative detection wastewater sample (No virus) spiked with known concentrations of SARS-CoV-2 S gene template (10°-102 S gene template copies per pL) and Non-Template Control (NTC, water). Positive DNA template for SA157 set, corresponded to A156-157 deletion site in B.1.617. Positive DNA template for P.l set, corresponded to the DNA segment from the end of ORF8 and the beginning of N gene including the 4 nucleotides insertion. ND - not detected. Solid lines indicate the median and dashed lines indicate the detection limit as decided by clinical guidelines.
[036] Figs. 9A-9C include a scheme and graphs. (9A) A non-limiting scheme showing designed detection set for differentiation and identification of SARS-CoV-2 Lambda variant. (9B) Calibration curve for primers-probe set. Error bars represent standard deviation for ten replicates. Positive DNA template for SA246 set corresponded to A246- 252 deletion site in Lambda variant. (9C) A graph showing limit of detection of SA246 primers-probe set in wastewater matrix. RNA extracted from negative detection wastewater sample (No virus) spiked with known concentrations of SARS-CoV-2 S gene template (10°-102 S gene template copies per pl) and Non-Template Control (NTC, water). Positive DNA template for SA246 set corresponded to A246-252 deletion site in Lambda variant. ND - not detected.
DETAILED DESCRIPTION
[037] In some embodiments, the present invention is directed to oligonucleotides, a kit comprising same, and a method of using same, such as for determining the presence of SARS-CoV-2 RNA molecule in a biological sample.
Oligonucleotides
[038] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: GACCCCAAAATCAGCGAAATG (SEQ ID NO: 1).
[039] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: TGATTACAAACATTGGCCGC (SEQ ID NO: 2).
[040] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: TGCCAATGCGCGACATTCCG (SEQ ID NO: 3).
[041] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: GGGAGCCTTGAATACACCAAAAG (SEQ ID NO: 4).
[042] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: TCACATTGGCACCCGCAATCCTGC (SEQ ID NO: 5).
[043] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: CAATTTGCCCCCAGCGCTTC (SEQ ID NO: 6).
[044] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: ATCCAATTTGATGGCACCTG (SEQ ID NO: 7).
[045] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: TTCTTCGGAATGTCGCGCATTGGC (SEQ ID NO: 8).
[046] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: GTTCTTACCTTTCTTTTCCAATGTTAC (SEQ ID NO: 9).
[047] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: CCATCATTAAATGGTAGGACAGGG (SEQ ID NO: 10).
[048] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: AGATTTGCCAATAGGTATTAACATC (SEQ ID NO: 11). [049] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: CTGAAGAAGAATCACCAGGAGTC (SEQ ID NO: 12).
[050] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: TGGTTCCATGCTATACATGTCTCTGG (SEQ ID NO: 13).
[051] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: TGGTTCCATGCTATCTCTGGGACC (SEQ ID NO: 14).
[052] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: CTAGGTTTCAAACTTTACATAGAAGTT (SEQ ID NO: 15).
[053] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: CATGACGTTCGTGTTGTTTTAG (SEQ ID NO: 16).
[054] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: CATTTCGCTGATTTTGGGGTCC (SEQ ID NO: 17).
[055] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: GTTTATTACCACAAAAACAACAAAAG (SEQ ID NO: 18).
[056] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: GGCTGAGAGAGACATATTCAAAAGTG (SEQ ID NO: 19).
[057] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: TTTCATCTAAACGAACAAACAAACTAAAAT (SEQ ID NO: 20).
[058] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: TGGATGGAAAGTGGAGTTTATTCTAGT (SEQ ID NO: 21).
[059] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: GGTATTAACATCACTAGGTTTCAAAC (SEQ ID NO: 33).
[060] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: GATAACCCACATAATAAGCTGCAGC (SEQ ID NO: 34).
[061] According to some embodiments, there is provide an oligonucleotide consisting of a nucleic acid sequence of: TTACTTGCTTTACATAATTCTTCTTCAGGT (SEQ ID NO: 35). [062] According to some embodiments, there is provide a composition comprising the oligonucleotide of the invention or any combination thereof.
[063] In some embodiments, the composition further comprises an acceptable carrier.
[064] In some embodiments, the oligonucleotide is a primer.
[065] In some embodiments, the oligonucleotide is a probe or a probing molecule.
Methods of Use
[066] According to another aspect, there is provided a method for determining the presence of SARS-CoV-2 RNA or a variant thereof in a biological sample.
[067] In some embodiments, the method comprises: (a) providing a biological sample suspected of comprising a complementary DNA (cDNA) molecule complementary to SARS-CoV-2 RNA molecule or a variant thereof; (b) contacting the biological sample of step (a) with a pair of primers capable of hybridizing to the cDNA molecule, and (c) subjecting the biological sample contacted with the pair of primers of step (b) to PCR amplification and obtaining an amplification product.
[068] In some embodiments, the method is suitable for determining the presence or absence of RNA derived from a specific or particular SARS-CoV-2 variant.
[069] In some embodiments, obtaining an amplification product is indicative of the presence of the cDNA molecule in the biological sample, thereby determining the presence of SARS-CoV-2 RNA in the biological sample.
[070] In some embodiments, failing to obtain an amplification product is indicative of the absence of the cDNA molecule in the biological sample, thereby determining the absence of SARS-CoV-2 RNA in the biological sample.
[071] In some embodiments, the pair of primers comprises a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 1, and a second primer being an oligonucleotide consisting of the nucleic acid sequence TCTGGTTACTGCCAGTTGAATCTG (SEQ ID NO: 22).
[072] In some embodiments, the pair of primers comprises a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 2, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 3. [073] In some embodiments, the pair of primers comprises a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 4, and a second primer being an oligonucleotide consisting of the nucleic acid sequence TGTAGCACGATTGCAGCATTG (SEQ ID NO: 23).
[074] In some embodiments, the pair of primers comprises a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 6, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 7.
[075] In some embodiments, the pair of primers comprises a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 9, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 10.
[076] In some embodiments, the pair of primers comprises a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 11, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 12.
[077] In some embodiments, the pair of primers comprises a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 16, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 17.
[078] In some embodiments, the pair of primers comprises a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 18, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 19.
[079] In some embodiments, the pair of primers comprises a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 33, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 34.
[080] In some embodiments, step (b) of the method of the invention further comprises contacting the biological sample with a probe molecule being a nucleic acid sequence capable of hybridizing to the cDNA molecule. [081] In some embodiments, the probe is a nucleic acid molecule consisting of the nucleic acid sequence ACCCCGCATTACGTTTGGTGGACC (SEQ ID NO: 24).
[082] In some embodiments, the probe is a nucleic acid molecule consisting of the nucleic acid sequence ACAATTTGCCCCCAGCGCTTCAG (SEQ ID NO: 25).
[083] In some embodiments, the probe is a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 5.
[084] In some embodiments, the probe is a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 8.
[085] In some embodiments, the probe is a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 13.
[086] In some embodiments, the probe is a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 14.
[087] In some embodiments, the probe is a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 15.
[088] In some embodiments, the probe is a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 20.
[089] In some embodiments, the probe is a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 21.
[090] In some embodiments, the probe is a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 35.
[091] In some embodiments, step (b) of the method of the invention comprises contacting the biological sample with a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 1 , a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 22, and a probe being a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 24.
[092] In some embodiments, step (b) of the method of the invention comprises contacting the biological sample with a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 2, a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 3, and a probe being a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 25. [093] In some embodiments, step (b) of the method of the invention comprises contacting the biological sample with a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 4, a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 23, and a probe being a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 5.
[094] In some embodiments, step (b) of the method of the invention comprises contacting the biological sample with a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 6, a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 7, and a probe being a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 8.
[095] In some embodiments, step (b) of the method of the invention comprises contacting the biological sample with a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 9, a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 10, and a probe being a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 13.
[096] In some embodiments, step (b) of the method of the invention comprises contacting the biological sample with a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 9, a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 10, and a probe being a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 14.
[097] In some embodiments, step (b) of the method of the invention comprises contacting the biological sample with a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 11, a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 12, and a probe being a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 15.
[098] In some embodiments, step (b) of the method of the invention comprises contacting the biological sample with a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 16, a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 17, and a probe being a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 20. [099] In some embodiments, step (b) of the method of the invention comprises contacting the biological sample with a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 18, a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 19, and a probe being a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 21.
[0100] In some embodiments, step (b) of the method of the invention comprises contacting the biological sample with a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 33, a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 34, and a probe being a nucleic acid molecule consisting of a nucleic acid sequence set forth in SEQ ID NO: 35.
[0101] In some embodiments, the method comprises contacting the biological sample with 2 probe molecules.
[0102] In some embodiments, each of the 2 probe molecules hybridized to a different sequence. In some embodiments, the first probe molecule is complementary to a first nucleic acid sequence and the second probe molecule is complementary to a second nucleic acid sequence. In some embodiments, the first probe molecule and the second probe molecule hybridize to different nucleic acid sequence. In some embodiments, the first probe molecule and the second probe molecule have different complementary target sites. In some embodiments, the first probe molecule and the second probe molecule have target sites, wherein the target sites are different by at least one nucleotide or nucleobase compared to one another. In some embodiments, the target sites, described herein, have not more than 99% homology or identity. In some embodiments, the target sites, described herein, are not identical.
[0103] In some embodiments, the SARS-CoV-2 comprises any variant of the SARS-CoV- 2 virus. In some embodiments, the variant comprises any variant of SARS-CoV-2 characterized by having at least one mutation, insertion, deletion, inversion, genomic alteration, or any combination thereof.
[0104] In some embodiments, the SARS-CoV-2 comprises any pathogenic variant. In some embodiments, the SARS-CoV-2 comprises any variant inducing or involved in a disease in a mammal subject, such as a human. [0105] In some embodiments, the SARS-CoV-2 variant comprises or is the British variant B.1.1.7. In some embodiments, the SARS-CoV-2 variant is the “Alpha” variant. In some embodiments, the British variant B.l.1.7 is the “Alpha” variant.
[0106] In some embodiments, the SARS-CoV-2 comprises or is the South African variant B.1.351. In some embodiments, the SARS-CoV-2 variant is the “Beta” variant. In some embodiments, the South African B.1.351 is the “Beta” variant.
[0107] In some embodiments, the SARS-CoV-2 variant comprises or is the Brazilian variant P.l. In some embodiments, the SARS-CoV-2 variant is the “Gamma” variant. In some embodiments, the Brazilian variant P.l is the “Gamma” variant.
[0108] In some embodiments, the SARS-CoV-2 variant comprises or is the Indian variant B.1.617. In some embodiments, the SARS-CoV-2 variant is the “Delta” variant. In some embodiments, the Indian variant B.1.617 is the “Delta” variant.
[0109] In some embodiments, the SARS-CoV-2 variant comprises or is the South American variant C.37. In some embodiments, the SARS-CoV-2 variant is the “Lambda” variant. In some embodiments, the South American variant C.37 is the “Lambda” variant.
[0110] In some embodiments, the SARS-CoV-2 RNA molecule encodes a SARS-CoV-2 nucleocapsid protein. In some embodiments, the SARS-CoV-2 RNA molecule encodes a region located 5' upstream to the nucleic acid sequence encoding the nucleocapsid protein. In some embodiments, the region located 5' upstream to the nucleic acid sequence encoding the nucleocapsid protein is located between a nucleic acid sequence encoding ORF8 and the nucleic acid sequence encoding the nucleocapsid protein. In some embodiments, the region located 5' upstream to the nucleic acid sequence encoding the nucleocapsid protein is located 3' downstream to the nucleic acid sequence encoding ORF8 and 5' upstream to the nucleic acid sequence encoding the nucleocapsid protein. In some embodiments, the SARS-CoV-2 RNA molecule encodes a SARS-CoV-2 spike protein. In some embodiments, the SARS-CoV-2 RNA molecule encodes a SARS-CoV-2 nucleocapsid protein and a SARS-CoV-2 spike protein.
[0111] In some embodiments, in the SARS-CoV-2 P.l variant, the region located 3' downstream to the nucleic acid sequence encoding ORF8 and 5' upstream to the nucleic acid sequence encoding the nucleocapsid protein, comprises an insertion comprising at least 1, 2, 3, or 4 additional nucleotides compared to other SARS-CoV-2 variants, as described herein, or any value and range therebetween. Each possibility represents a separate embodiment of the invention.
[0112] In some embodiments, the SARS-CoV-2 P.l variant comprises the nucleic acid sequence set forth in SEQ ID NO: 31. In some embodiments, the SARS-CoV-2 P.l variant comprises at least 1, 2, 3, or 4 additional nucleotides compared SEQ ID NO: 32, or any value and range therebetween. Each possibility represents a separate embodiment of the invention. In some embodiments, the at least 1, 2, 3, or 4 additional nucleotides are contiguous nucleotides, or any value and range therebetween. Each possibility represents a separate embodiment of the invention.
[0113] In some embodiments, the SARS-CoV-2 RNA molecule comprises the full genome of the SARS-CoV-2 virus. In some embodiments, the SARS-CoV-2 RNA molecule comprises a partial genome of the SARS-CoV-2 virus. In some embodiments, the SARS-CoV-2 RNA molecule comprises a fragment of the genome of the SARS-CoV-2 virus. In some embodiments, the SARS-CoV-2 RNA molecule comprises degradation products of the genome of the SARS-CoV-2 virus.
[0114] In some embodiments, the SARS-CoV-2 RNA comprises or is derived from the publicly available SARS-CoV-2 genome (GenBank accession no. MN908947).
[0115] In some embodiments, the SARS-CoV-2 nucleocapsid protein is encoded by the nucleic acid sequence:
AUGUCUGAUAAUGGACCCCAAAAUCAGCGAAAUGCACCCCGCAUUACGUUU GGUGGACCCUCAGAUUCAACUGGCAGUAACCAGAAUGGAGAACGCAGUGG GGCGCGAUCAAAACAACGUCGGCCCCAAGGUUUACCCAAUAAUACUGCGUC UUGGUUCACCGCUCUCACUCAACAUGGCAAGGAAGACCUUAAAUUCCCUCG AGGACAAGGCGUUCCAAUUAACACCAAUAGCAGUCCAGAUGACCAAAUUGG CUACUACCGAAGAGCUACCAGACGAAUUCGUGGUGGUGACGGUAAAAUGA AAGAUCUCAGUCCAAGAUGGUAUUUCUACUACCUAGGAACUGGGCCAGAA GCUGGACUUCCCUAUGGUGCUAACAAAGACGGCAUCAUAUGGGUUGCAACU GAGGGAGCCUUGAAUACACCAAAAGAUCACAUUGGCACCCGCAAUCCUGCU AACAAUGCUGCAAUCGUGCUACAACUUCCUCAAGGAACAACAUUGCCAAAA GGCUUCUACGCAGAAGGGAGCAGAGGCGGCAGUCAAGCCUCUUCUCGUUCC UCAUCACGUAGUCGCAACAGUUCAAGAAAUUCAACUCCAGGCAGCAGUAGG GGAACUUCUCCUGCUAGAAUGGCUGGCAAUGGCGGUGAUGCUGCUCUUGCU UUGCUGCUGCUUGACAGAUUGAACCAGCUUGAGAGCAAAAUGUCUGGUAA AGGCCAACAACAACAAGGCCAAACUGUCACUAAGAAAUCUGCUGCUGAGGC UUCUAAGAAGCCUCGGCAAAAACGUACUGCCACUAAAGCAUACAAUGUAAC
ACAAGCUUUCGGCAGACGUGGUCCAGAACAAACCCAAGGAAAUUUUGGGG ACCAGGAACUAAUCAGACAAGGAACUGAUUACAAACAUUGGCCGCAAAUU GCACAAUUUGCCCCCAGCGCUUCAGCGUUCUUCGGAAUGUCGCGCAUUGGC
AUGGAAGUCACACCUUCGGGAACGUGGUUGACCUACACAGGUGCCAUCAAA UUGGAUGACAAAGAUCCAAAUUUCAAAGAUCAAGUCAUUUUGCUGAAUAA GCAUAUUGACGCAUACAAAACAUUCCCACCAACAGAGCCUAAAAAGGACAA
AAAGAAGAAGGCUGAUGAAACUCAAGCCUUACCGCAGAGACAGAAGAAAC AGCAAACUGUGACUCUUCUUCCUGCUGCAGAUUUGGAUGAUUUCUCCAAAC AAUUGCAACAAUCCAUGAGCAGUGCUGACUCAACUCAGGCCUAA (SEQ ID NO: 26).
[0116] In some embodiments, the SARS-CoV-2 spike protein is encoded by the nucleic acid sequence:
AUGUUUGUUUUUCUUGUUUUAUUGCCACUAGUCUCUAGUCAGUGUGUUAA
UCUUACAACCAGAACUCAAUUACCCCCUGCAUACACUAAUUCUUUCACACG UGGUGUUUAUUACCCUGACAAAGUUUUCAGAUCCUCAGUUUUACAUUCAA CUCAGGACUUGUUCUUACCUUUCUUUUCCAAUGUUACUUGGUUCCAUGCUA
UACAUGUCUCUGGGACCAAUGGUACUAAGAGGUUUGAUAACCCUGUCCUAC CAUUUAAUGAUGGUGUUUAUUUUGCUUCCACUGAGAAGUCUAACAUAAUA AGAGGCUGGAUUUUUGGUACUACUUUAGAUUCGAAGACCCAGUCCCUACU UAUUGUUAAUAACGCUACUAAUGUUGUUAUUAAAGUCUGUGAAUUUCAAU UUUGUAAUGAUCCAUUUUUGGGUGUUUAUUACCACAAAAACAACAAAAGU UGGAUGGAAAGUGAGUUCAGAGUUUAUUCUAGUGCGAAUAAUUGCACUUU UGAAUAUGUCUCUCAGCCUUUUCUUAUGGACCUUGAAGGAAAACAGGGUA AUUUCAAAAAUCUUAGGGAAUUUGUGUUUAAGAAUAUUGAUGGUUAUUUU AAAAUAUAUUCUAAGCACACGCCUAUUAAUUUAGUGCGUGAUCUCCCUCAG GGUUUUUCGGCUUUAGAACCAUUGGUAGAUUUGCCAAUAGGUAUUAACAU CACUAGGUUUCAAACUUUACUUGCUUUACAUAGAAGUUAUUUGACUCCUG GUGAUUCUUCUUCAGGUUGGACAGCUGGUGCUGCAGCUUAUUAUGUGGGU UAUCUUCAACCUAGGACUUUUCUAUUAAAAUAUAAUGAAAAUGGAACCAU UACAGAUGCUGUAGACUGUGCACUUGACCCUCUCUCAGAAACAAAGUGUAC GUUGAAAUCCUUCACUGUAGAAAAAGGAAUCUAUCAAACUUCUAACUUUA
GAGUCCAACCAACAGAAUCUAUUGUUAGAUUUCCUAAUAUUACAAACUUG
UGCCCUUUUGGUGAAGUUUUUAACGCCACCAGAUUUGCAUCUGUUUAUGC
UUGGAACAGGAAGAGAAUCAGCAACUGUGUUGCUGAUUAUUCUGUCCUAU
AUAAUUCCGCAUCAUUUUCCACUUUUAAGUGUUAUGGAGUGUCUCCUACU
AAAUUAAAUGAUCUCUGCUUUACUAAUGUCUAUGCAGAUUCAUUUGUAAU
UAGAGGUGAUGAAGUCAGACAAAUCGCUCCAGGGCAAACUGGAAAGAUUG
CUGAUUAUAAUUAUAAAUUACCAGAUGAUUUUACAGGCUGCGUUAUAGCU
UGGAAUUCUAACAAUCUUGAUUCUAAGGUUGGUGGUAAUUAUAAUUACCU
GUAUAGAUUGUUUAGGAAGUCUAAUCUCAAACCUUUUGAGAGAGAUAUUU
CAACUGAAAUCUAUCAGGCCGGUAGCACACCUUGUAAUGGUGUUGAAGGU
UUUAAUUGUUACUUUCCUUUACAAUCAUAUGGUUUCCAACCCACUAAUGG
UGUUGGUUACCAACCAUACAGAGUAGUAGUACUUUCUUUUGAACUUCUAC
AUGCACCAGCAACUGUUUGUGGACCUAAAAAGUCUACUAAUUUGGUUAAA
AACAAAUGUGUCAAUUUCAACUUCAAUGGUUUAACAGGCACAGGUGUUCU
UACUGAGUCUAACAAAAAGUUUCUGCCUUUCCAACAAUUUGGCAGAGACA
UUGCUGACACUACUGAUGCUGUCCGUGAUCCACAGACACUUGAGAUUCUUG
ACAUUACACCAUGUUCUUUUGGUGGUGUCAGUGUUAUAACACCAGGAACA
AAUACUUCUAACCAGGUUGCUGUUCUUUAUCAGGAUGUUAACUGCACAGA
AGUCCCUGUUGCUAUUCAUGCAGAUCAACUUACUCCUACUUGGCGUGUUUA
UUCUACAGGUUCUAAUGUUUUUCAAACACGUGCAGGCUGUUUAAUAGGGG
CUGAACAUGUCAACAACUCAUAUGAGUGUGACAUACCCAUUGGUGCAGGU
AUAUGCGCUAGUUAUCAGACUCAGACUAAUUCUCCUCGGCGGGCACGUAGU
GUAGCUAGUCAAUCCAUCAUUGCCUACACUAUGUCACUUGGUGCAGAAAAU
UCAGUUGCUUACUCUAAUAACUCUAUUGCCAUACCCACAAAUUUUACUAUU
AGUGUUACCACAGAAAUUCUACCAGUGUCUAUGACCAAGACAUCAGUAGA
UUGUACAAUGUACAUUUGUGGUGAUUCAACUGAAUGCAGCAAUCUUUUGU
UGCAAUAUGGCAGUUUUUGUACACAAUUAAACCGUGCUUUAACUGGAAUA
GCUGUUGAACAAGACAAAAACACCCAAGAAGUUUUUGCACAAGUCAAACA
AAUUUACAAAACACCACCAAUUAAAGAUUUUGGUGGUUUUAAUUUUUCAC
AAAUAUUACCAGAUCCAUCAAAACCAAGCAAGAGGUCAUUUAUUGAAGAU
CUACUUUUCAACAAAGUGACACUUGCAGAUGCUGGCUUCAUCAAACAAUAU
GGUGAUUGCCUUGGUGAUAUUGCUGCUAGAGACCUCAUUUGUGCACAAAA
GUUUAACGGCCUUACUGUUUUGCCACCUUUGCUCACAGAUGAAAUGAUUGC UCAAUACACUUCUGCACUGUUAGCGGGUACAAUCACUUCUGGUUGGACCUU UGGUGCAGGUGCUGCAUUACAAAUACCAUUUGCUAUGCAAAUGGCUUAUA GGUUUAAUGGUAUUGGAGUUACACAGAAUGUUCUCUAUGAGAACCAAAAA UUGAUUGCCAACCAAUUUAAUAGUGCUAUUGGCAAAAUUCAAGACUCACU UUCUUCCACAGCAAGUGCACUUGGAAAACUUCAAGAUGUGGUCAACCAAAA UGCACAAGCUUUAAACACGCUUGUUAAACAACUUAGCUCCAAUUUUGGUGC AAUUUCAAGUGUUUUAAAUGAUAUCCUUUCACGUCUUGACAAAGUUGAGG CUGAAGUGCAAAUUGAUAGGUUGAUCACAGGCAGACUUCAAAGUUUGCAG ACAUAUGUGACUCAACAAUUAAUUAGAGCUGCAGAAAUCAGAGCUUCUGC UAAUCUUGCUGCUACUAAAAUGUCAGAGUGUGUACUUGGACAAUCAAAAA GAGUUGAUUUUUGUGGAAAGGGCUAUCAUCUUAUGUCCUUCCCUCAGUCA GCACCUCAUGGUGUAGUCUUCUUGCAUGUGACUUAUGUCCCUGCACAAGAA AAGAACUUCACAACUGCUCCUGCCAUUUGUCAUGAUGGAAAAGCACACUUU
CCUCGUGAAGGUGUCUUUGUUUCAAAUGGCACACACUGGUUUGUAACACA AAGGAAUUUUUAUGAACCACAAAUCAUUACUACAGACAACACAUUUGUGU CUGGUAACUGUGAUGUUGUAAUAGGAAUUGUCAACAACACAGUUUAUGAU CCUUUGCAACCUGAAUUAGACUCAUUCAAGGAGGAGUUAGAUAAAUAUUU UAAGAAUCAUACAUCACCAGAUGUUGAUUUAGGUGACAUCUCUGGCAUUA AUGCUUCAGUUGUAAACAUUCAAAAAGAAAUUGACCGCCUCAAUGAGGUU GCCAAGAAUUUAAAUGAAUCUCUCAUCGAUCUCCAAGAACUUGGAAAGUA UGAGCAGUAUAUAAAAUGGCCAUGGUACAUUUGGCUAGGUUUUAUAGCUG GCUUGAUUGCCAUAGUAAUGGUGACAAUUAUGCUUUGCUGUAUGACCAGU UGCUGUAGUUGUCUCAAGGGCUGUUGUUCUUGUGGAUCCUGCUGCAAAUU UGAUGAAGACGACUCUGAGCCAGUGCUCAAAGGAGUCAAAUUACAUUACA
CAUAA (SEQ ID NO: 27).
[0117] In some embodiments, the SARS-CoV-2 spike protein is encoded by the nucleic acid sequence:
AUGUUUGUUUUUUUUGUUUUAUUGCCACUAGUCUCUAGUCAGUGUGUUAA UCUUACAACCAGAACUCAAUUACCCCCUGCAUACACUAAUUCUUUCACACG UGGUGUUUAUUACCCUGACAAAGUUUUCAGAUCCUCAGUUUUACAUUCAA CUCAGGACUUGUUCUUACCUUUCUUUUCCAAUGUUACUUGGUUCCAUGCUA UCUCUGGGACCAAUGGUACUAAGAGGUUUGAUAACCCUGUCCUACCAUUUA AUGAUGGUGUUUAUUUUGCUUCCACUGAGAAGUCUAACAUAAUAAGAGGC UGGAUUUUUGGUACUACUUUAGAUUCGAAGACCCAGUCCCUACUUAUUGU
UAAUAACGCUACUAAUGUUGUUAUUAAAGUCUGUGAAUUUCAAUUUUGUA
AUGAUCCAUUUUUGGGUGUUUACCACAAAAACAACAAAAGUUGGAUGGAA
AGUGAGUUCAGAGUUUAUUCUAGUGCGAAUAAUUGCACUUUUGAAUAUGU
CUCUCAGCCUUUUCUUAUGGACCUUGAAGGAAAACAGGGUAAUUUCAAAA
AUCUUAGGGAAUUUGUGUUUAAGAAUAUUGAUGGUUAUUUUAAAAUAUAU
UCUAAGCACACGCCUAUUAAUUUAGUGCGUGAUCUCCCUCAGGGUUUUUCG
GCUUUAGAACCAUUGGUAGAUUUGCCAAUAGGUAUUAACAUCACUAGGUU
UCAAACUUUACUUGCUUUACAUAGAAGUUAUUUGACUCCUGGUGAUUCUU
CUUCAGGUUGGACAGCUGGUGCUGCAGCUUAUUAUGUGGGUUAUCUUCAA
CCUAGGACUUUUCUAUUAAAAUAUAAUGAAAAUGGAACCAUUACAGAUGC
UGUAGACUGUGCACUUGACCCUCUCUCAGAAACAAAGUGUACGUUGAAAUC
CUUCACUGUAGAAAAAGGAAUCUAUCAAACUUCUAACUUUAGAGUCCAACC
AACAGAAUCUAUUGUUAGAUUUCCUAAUAUUACAAACUUGUGCCCUUUUG
GUGAAGUUUUUAACGCCACCAGAUUUGCAUCUGUUUAUGCUUGGAACAGG
AAGAGAAUCAGCAACUGUGUUGCUGAUUAUUCUGUCCUAUAUAAUUCCGC
AUCAUUUUCCACUUUUAAGUGUUAUGGAGUGUCUCCUACUAAAUUAAAUG
AUCUCUGCUUUACUAAUGUCUAUGCAGAUUCAUUUGUAAUUAGAGGUGAU
GAAGUCAGACAAAUCGCUCCAGGGCAAACUGGAAAGAUUGCUGAUUAUAA
UUAUAAAUUACCAGAUGAUUUUACAGGCUGCGUUAUAGCUUGGAAUUCUA
ACAAUCUUGAUUCUAAGGUUGGUGGUAAUUAUAAUUACCUGUAUAGAUUG
UUUAGGAAGUCUAAUCUCAAACCUUUUGAGAGAGAUAUUUCAACUGAAAU
CUAUCAGGCCGGUAGCACACCUUGUAAUGGUGUUGAAGGUUUUAAUUGUU
ACUUUCCUUUACAAUCAUAUGGUUUCCAACCCACUUAUGGUGUUGGUUACC
AACCAUACAGAGUAGUAGUACUUUCUUUUGAACUUCUACAUGCACCAGCAA
CUGUUUGUGGACCUAAAAAGUCUACUAAUUUGGUUAAAAACAAAUGUGUC
AAUUUCAACUUCAAUGGUUUAACAGGCACAGGUGUUCUUACUGAGUCUAA
CAAAAAGUUUCUGCCUUUCCAACAAUUUGGCAGAGACAUUGAUGACACUAC
UGAUGCUGUCCGUGAUCCACAGACACUUGAGAUUCUUGACAUUACACCAUG
UUCUUUUGGUGGUGUCAGUGUUAUAACACCAGGAACAAAUACUUCUAACC
AGGUUGCUGUUCUUUAUCAGGGUGUUAACUGCACAGAAGUCCCUGUUGCU
AUUCAUGCAGAUCAACUUACUCCUACUUGGCGUGUUUAUUCUACAGGUUCU
AAUGUUUUUCAAACACGUGCAGGCUGUUUAAUAGGGGCUGAACAUGUCAA
CAACUCAUAUGAGUGUGACAUACCCAUUGGUGCAGGUAUAUGCGCUAGUU AUCAGACUCAGACUAAUUCUCAUCGGCGGGCACGUAGUGUAGCUAGUCAAU
CCAUCAUUGCCUACACUAUGUCACUUGGUGCAGAAAAUUCAGUUGCUUACU
CUAAUAACUCUAUUGCCAUACCCAUAAAUUUUACUAUUAGUGUUACCACAG
AAAUUCUACCAGUGUCUAUGACCAAGACAUCAGUAGAUUGUACAAUGUAC
AUUUGUGGUGAUUCAACUGAAUGCAGCAAUCUUUUGUUGCAAUAUGGCAG
UUUUUGUACACAAUUAAACCGUGCUUUAACUGGAAUAGCUGUUGAACAAG
ACAAAAACACCCAAGAAGUUUUUGCACAAGUCAAACAAAUUUACAAAACAC
CACCAAUUAAAGAUUUUGGUGGUUUUAAUUUUUCACAAAUAUUACCAGAU
CCAUCAAAACCAAGCAAGAGGUCAUUUAUUGAAGAUCUACUUUUCAACAA
AGUGACACUUGCAGAUGCUGGCUUCAUCAAACAAUAUGGUGAUUGCCUUG
GUGAUAUUGCUGCUAGAGACCUCAUUUGUGCACAAAAGUUUAACGGCCUU
ACUGUUUUGCCACCUUUGCUCACAGAUGAAAUGAUUGCUCAAUACACUUCU
GCACUGUUAGCGGGUACAAUCACUUCUGGUUGGACCUUUGGUGCAGGUGC
UGCAUUACAAAUACCAUUUGCUAUGCAAAUGGCUUAUAGGUUUAAUGGUA
UUGGAGUUACACAGAAUGUUCUCUAUGAGAACCAAAAAUUGAUUGCCAAC
CAAUUUAAUAGUGCUAUUGGCAAAAUUCAAGACUCACUUUCUUCCACAGCA
AGUGCACUUGGAAAACUUCAAGAUGUGGUCAACCAAAAUGCACAAGCUUU
AAACACGCUUGUUAAACAACUUAGCUCCAAUUUUGGUGCAAUUUCAAGUG
UUUUAAAUGAUAUCCUUGCACGUCUUGACAAAGUUGAGGCUGAAGUGCAA
AUUGAUAGGUUGAUCACAGGCAGACUUCAAAGUUUGCAGACAUAUGUGAC
UCAACAAUUAAUUAGAGCUGCAGAAAUCAGAGCUUCUGCUAAUCUUGCUG
CUACUAAAAUGUCAGAGUGUGUACUUGGACAAUCAAAAAGAGUUGAUUUU
UGUGGAAAGGGCUAUCAUCUUAUGUCCUUCCCUCAGUCAGCACCUCAUGGU
GUAGUCUUCUUGCAUGUGACUUAUGUCCCUGCACAAGAAAAGAACUUCACA
ACUGCUCCUGCCAUUUGUCAUGAUGGAAAAGCACACUUUCCUCGUGAAGGU
GUCUUUGUUUCAAAUGGCACACACUGGUUUGUAACACAAAGGAAUUUUUA
UGAACCACAAAUCAUUACUACACACAACACAUUUGUGUCUGGUAACUGUGA
UGUUGUAAUAGGAAUUGUCAACAACACAGUUUAUGAUCCUUUGCAACCUG
AAUUAGACUCAUUCAAGGAGGAGUUAGAUAAAUAUUUUAAGAAUCAUACA
UCACCAGAUGUUGAUUUAGGUGACAUCUCUGGCAUUAAUGCUUCAGUUGU
AAACAUUCAAAAAGAAAUUGACCGCCUCAAUGAGGUUGCCAAGAAUUUAA
AUGAAUCUCUCAUCGAUCUCCAAGAACUUGGAAAGUAUGAGCAGUAUAUA
AAAUGGCCAUGGUACAUUUGGCUAGGUUUUAUAGCUGGCUUGAUUGCCAU
AGUAAUGGUGACAAUUAUGCUUUGCUGUAUGACCAGUUGCUGUAGUUGUC UCAAGGGCUGUUGUUCUUGUGGAUCCUGCUGCAAAUUUGAUGAAGACGAC UCUGAGCCAGUGCUCAAAGGAGUCAAAUUACAUUACACAUAA (SEQ ID NO:
28).
[0118] In some embodiments, the SARS-CoV-2 spike protein is encoded by the nucleic acid sequence:
AUGUUUGUUUUUCUUGUUUUAUUGCCACUAGUCUCUAGUCAGUGUGUUAA UUUUACAACCAGAACUCAAUUACCCCCUGCAUACACUAAUUCUUUCACACG UGGUGUUUAUUACCCUGACAAAGUUUUCAGAUCCUCAGUUUUACAUUCAA CUCAGGACUUGUUCUUACCUUUCUUUUCCAAUGUUACUUGGUUCCAUGCUA UACAUGUCUCUGGGACCAAUGGUACUAAGAGGUUUGCUAACCCUGUCCUAC CAUUUAAUGAUGGUGUUUAUUUUGCUUCCACUGAGAAGUCUAACAUAAUA AGAGGCUGGAUUUUUGGUACUACUUUAGAUUCGAAGACCCAGUCCCUACU UAUUGUUAAUAACGCUACUAAUGUUGUUAUUAAAGUCUGUGAAUUUCAAU UUUGUAAUGAUCCAUUUUUGGGUGUUUAUUACCACAAAAACAACAAAAGU UGGAUGGAAAGUGAGUUCAGAGUUUAUUCUAGUGCGAAUAAUUGCACUUU UGAAUAUGUCUCUCAGCCUUUUCUUAUGGACCUUGAAGGAAAACAGGGUA AUUUCAAAAAUCUUAGGGAAUUUGUGUUUAAGAAUAUUGAUGGUUAUUUU AAAAUAUAUUCUAAGCACACGCCUAUUAAUUUAGUGCGUGGUCUCCCUCAG GGUUUUUCGGCUUUAGAACCAUUGGUAGAUUUGCCAAUAGGUAUUAACAU CACUAGGUUUCAAACUUUACAUAGAAGUUAUUUGACUCCUGGUGAUUCUU CUUCAGGUUGGACAGCUGGUGCUGCAGCUUAUUAUGUGGGUUAUCUUCAA CCUAGGACUUUUCUAUUAAAAUAUAAUGAAAAUGGAACCAUUACAGAUGC UGUAGACUGUGCACUUGACCCUCUCUCAGAAACAAAGUGUACGUUGAAAUC CUUCACUGUAGAAAAAGGAAUCUAUCAAACUUCUAACUUUAGAGUCCAACC AACAGAAUCUAUUGUUAGAUUUCCUAAUAUUACAAACUUGUGCCCUUUUG GUGAAGUUUUUAACGCCACCAGAUUUGCAUCUGUUUAUGCUUGGAACAGG AAGAGAAUCAGCAACUGUGUUGCUGAUUAUUCUGUCCUAUAUAAUUCCGC AUCAUUUUCCACUUUUAAGUGUUAUGGAGUGUCUCCUACUAAAUUAAAUG AUCUCUGCUUUACUAAUGUCUAUGCAGAUUCAUUUGUAAUUAGAGGUGAU GAAGUCAGACAAAUCGCUCCAGGGCAAACUGGAAAUAUUGCUGAUUAUAA UUAUAAAUUACCAGAUGAUUUUACAGGCUGCGUUAUAGCUUGGAAUUCUA ACAAUCUUGAUUCUAAGGUUGGUGGUAAUUAUAAUUACCUGUAUAGAUUG UUUAGGAAGUCUAAUCUCAAACCUUUUGAGAGAGAUAUUUCAACUGAAAU CUAUCAGGCCGGUAGCACACCUUGUAAUGGUGUUAAAGGUUUUAAUUGUU
ACUUUCCUUUACAAUCAUAUGGUUUCCAACCCACUUAUGGUGUUGGUUACC
AACCAUACAGAGUAGUAGUACUUUCUUUUGAACUUCUACAUGCACCAGCAA
CUGUUUGUGGACCUAAAAAGUCUACUAAUUUGGUUAAAAACAAAUGUGUC
AAUUUCAACUUCAAUGGUUUAACAGGCACAGGUGUUCUUACUGAGUCUAA
CAAAAAGUUUCUGCCUUUCCAACAAUUUGGCAGAGACAUUGCUGACACUAC
UGAUGCUGUCCGUGAUCCACAGACACUUGAGAUUCUUGACAUUACACCAUG
UUCUUUUGGUGGUGUCAGUGUUAUAACACCAGGAACAAAUACUUCUAACC
AGGUUGCUGUUCUUUAUCAGGGUGUUAACUGCACAGAAGUCCCUGUUGCU
AUUCAUGCAGAUCAACUUACUCCUACUUGGCGUGUUUAUUCUACAGGUUCU
AAUGUUUUUCAAACACGUGCAGGCUGUUUAAUAGGGGCUGAACAUGUCAA
CAACUCAUAUGAGUGUGACAUACCCAUUGGUGCAGGUAUAUGCGCUAGUU
AUCAGACUCAGACUAAUUCUCCUCGGCGGGCACGUAGUGUAGCUAGUCAAU
CCAUCAUUGCCUACACUAUGUCACUUGGUGUAGAAAAUUCAGUUGCUUACU
CUAAUAACUCUAUUGCCAUACCCACAAAUUUUACUAUUAGUGUUACCACAG
AAAUUCUACCAGUGUCUAUGACCAAGACAUCAGUAGAUUGUACAAUGUAC
AUUUGUGGUGAUUCAACUGAAUGCAGCAAUCUUUUGUUGCAAUAUGGCAG
UUUUUGUACACAAUUAAACCGUGCUUUAACUGGAAUAGCUGUUGAACAAG
ACAAAAACACCCAAGAAGUUUUUGCACAAGUCAAACAAAUUUACAAAACAC
CACCAAUUAAAGAUUUUGGUGGUUUUAAUUUUUCACAAAUAUUACCAGAU
CCAUCAAAACCAAGCAAGAGGUCAUUUAUUGAAGAUCUACUUUUCAACAA
AGUGACACUUGCAGAUGCUGGCUUCAUCAAACAAUAUGGUGAUUGCCUUG
GUGAUAUUGCUGCUAGAGACCUCAUUUGUGCACAAAAGUUUAACGGCCUU
ACUGUUUUGCCACCUUUGCUCACAGAUGAAAUGAUUGCUCAAUACACUUCU
GCACUGUUAGCGGGUACAAUCACUUCUGGUUGGACCUUUGGUGCAGGUGC
UGCAUUACAAAUACCAUUUGCUAUGCAAAUGGCUUAUAGGUUUAAUGGUA
UUGGAGUUACACAGAAUGUUCUCUAUGAGAACCAAAAAUUGAUUGCCAAC
CAAUUUAAUAGUGCUAUUGGCAAAAUUCAAGACUCACUUUCUUCCACAGCA
AGUGCACUUGGAAAACUUCAAGAUGUGGUCAACCAAAAUGCACAAGCUUU
AAACACGCUUGUUAAACAACUUAGCUCCAAUUUUGGUGCAAUUUCAAGUG
UUUUAAAUGAUAUCCUUUCACGUCUUGACAAAGUUGAGGCUGAAGUGCAA
AUUGAUAGGUUGAUCACAGGCAGACUUCAAAGUUUGCAGACAUAUGUGAC
UCAACAAUUAAUUAGAGCUGCAGAAAUCAGAGCUUCUGCUAAUCUUGCUG
CUACUAAAAUGUCAGAGUGUGUACUUGGACAAUCAAAAAGAGUUGAUUUU UGUGGAAAGGGCUAUCAUCUUAUGUCCUUCCCUCAGUCAGCACCUCAUGGU GUAGUCUUCUUGCAUGUGACUUAUGUCCCUGCACAAGAAAAGAACUUCACA ACUGCUCCUGCCAUUUGUCAUGAUGGAAAAGCACACUUUCCUCGUGAAGGU
GUCUUUGUUUCAAAUGGCACACACUGGUUUGUAACACAAAGGAAUUUUUA
UGAACCACAAAUCAUUACUACAGACAACACAUUUGUGUCUGGUAACUGUG
AUGUUGUAAUAGGAAUUGUCAACAACACAGUUUAUGAUCCUUUGCAACCU GAAUUAGACUCAUUCAAGGAGGAGUUAGAUAAAUAUUUUAAGAAUCAUAC AUCACCAGAUGUUGAUUUAGGUGACAUCUCUGGCAUUAAUGCUUCAGUUG
UAAACAUUCAAAAAGAAAUUGACCGCCUCAAUGAGGUUGCCAAGAAUUUA
AAUGAAUCUCUCAUCGAUCUCCAAGAACUUGGAAAGUAUGAGCAGUAUAU
AAAAUGGCCAUGGUACAUUUGGCUAGGUUUUAUAGCUGGCUUGAUUGCCA
UAGUAAUGGUGACAAUUAUGCUUUGCUGUAUGACCAGUUGCUGUAGUUGU
CUCAAGGGCUGUUGUUCUUGUGGAUCCUGCUGCAAAUUUGAUGAAGACGA CUCUGAGCCAGUGCUCAAAGGAGUCAAAUUACAUUACACAUAA (SEQ ID NO: 29).
[0119] In some embodiments, the SARS-CoV-2 spike protein is encoded by the nucleic acid sequence:
AUGUUUGUUUUUCUUGUUUUAUUGCCACUAGUCUCUAGUCAGUGUGUUAA
UCUUAGAACCAGAACUCAAUUACCCCCUGCAUACACUAAUUCUUUCACACG
UGGUGUUUAUUACCCUGACAAAGUUUUCAGAUCCUCAGUUUUACAUUCAA
CUCAGGACUUGUUCUUACCUUUCUUUUCCAAUGUUACUUGGUUCCAUGCUA
UACAUGUCUCUGGGACCAAUGGUACUACGAGGUUUGAUAACCCUGUCCUAC
CAUUUAAUGAUGGUGUUUAUUUUGCUUCCACUGAGAAGUCUAACAUAAUA
AGAGGCUGGAUUUUUGGUACUACUUUAGAUUCGAAGACCCAGUCCCUACU UAUUGUUAAUAACGCUACUAAUGUUGUUAUUAAAGUCUGUGAAUUUCAAU UUUGUAAUGAUCCAUUUUUGGAUGUUUAUUACCACAAAAACAACAAAAGU
UGGAUGGAAAGUGGAGUUUAUUCUAGUGCGAAUAAUUGCACUUUUGAAUA
UGUCUCUCAGCCUUUUCUUAUGGACCUUGAAGGAAAACAGGGUAAUUUCA
AAAAUCUUAGGGAAUUUGUGUUUAAGAAUAUUGAUGGUUAUUUUAAAAUA
UAUUCUAAGCACACGCCUAUUAAUUUAGUGCGUGAUCUCCCUCAGGGUUUU
UCGGCUUUAGAACCAUUGGUAGAUUUGCCAAUAGGUAUUAACAUCACUAG GUUUCAAACUUUACUUGCUUUACAUAGAAGUUAUUUGACUCCUGGUGAUU CUUCUUCAGGUUGGACAGCUGGUGCUGCAGCUUAUUAUGUGGGUUAUCUU CAACCUAGGACUUUUCUAUUAAAAUAUAAUGAAAAUGGAACCAUUACAGA
UGCUGUAGACUGUGCACUUGACCCUCUCUCAGAAACAAAGUGUACGUUGAA
AUCCUUCACUGUAGAAAAAGGAAUCUAUCAAACUUCUAACUUUAGAGUCC
AACCAACAGAAUCUAUUGUUAGAUUUCCUAAUAUUACAAACUUGUGCCCU
UUUGGUGAAGUUUUUAACGCCACCAGAUUUGCAUCUGUUUAUGCUUGGAA
CAGGAAGAGAAUCAGCAACUGUGUUGCUGAUUAUUCUGUCCUAUAUAAUU
CCGCAUCAUUUUCCACUUUUAAGUGUUAUGGAGUGUCUCCUACUAAAUUA
AAUGAUCUCUGCUUUACUAAUGUCUAUGCAGAUUCAUUUGUAAUUAGAGG
UGAUGAAGUCAGACAAAUCGCUCCAGGGCAAACUGGAAAGAUUGCUGAUU
AUAAUUAUAAAUUACCAGAUGAUUUUACAGGCUGCGUUAUAGCUUGGAAU
UCUAACAAUCUUGAUUCUAAGGUUGGUGGUAAUUAUAAUUACCGGUAUAG
AUUGUUUAGGAAGUCUAAUCUCAAACCUUUUGAGAGAGAUAUUUCAACUG
AAAUCUAUCAGGCCGGUAGCAAACCUUGUAAUGGUGUUGAAGGUUUUAAU
UGUUACUUUCCUUUACAAUCAUAUGGUUUCCAACCCACUAAUGGUGUUGG
UUACCAACCAUACAGAGUAGUAGUACUUUCUUUUGAACUUCUACAUGCACC
AGCAACUGUUUGUGGACCUAAAAAGUCUACUAAUUUGGUUAAAAACAAAU
GUGUCAAUUUCAACUUCAAUGGUUUAACAGGCACAGGUGUUCUUACUGAG
UCUAACAAAAAGUUUCUGCCUUUCCAACAAUUUGGCAGAGACAUUGCUGAC
ACUACUGAUGCUGUCCGUGAUCCACAGACACUUGAGAUUCUUGACAUUACA
CCAUGUUCUUUUGGUGGUGUCAGUGUUAUAACACCAGGAACAAAUACUUC
UAACCAGGUUGCUGUUCUUUAUCAGGGUGUUAACUGCACAGAAGUCCCUG
UUGCUAUUCAUGCAGAUCAACUUACUCCUACUUGGCGUGUUUAUUCUACAG
GUUCUAAUGUUUUUCAAACACGUGCAGGCUGUUUAAUAGGGGCUGAACAU
GUCAACAACUCAUAUGAGUGUGACAUACCCAUUGGUGCAGGUAUAUGCGC
UAGUUAUCAGACUCAGACUAAUUCUCGUCGGCGGGCACGUAGUGUAGCUA
GUCAAUCCAUCAUUGCCUACACUAUGUCACUUGGUGCAGAAAAUUCAGUUG
CUUACUCUAAUAACUCUAUUGCCAUACCCACAAAUUUUACUAUUAGUGUUA
CCACAGAAAUUCUACCAGUGUCUAUGACCAAGACAUCAGUAGAUUGUACAA
UGUACAUUUGUGGUGAUUCAACUGAAUGCAGCAAUCUUUUGUUGCAAUAU
GGCAGUUUUUGUACACAAUUAAACCGUGCUUUAACUGGAAUAGCUGUUGA
ACAAGACAAAAACACCCAAGAAGUUUUUGCACAAGUCAAACAAAUUUACA
AAACACCACCAAUUAAAGAUUUUGGUGGUUUUAAUUUUUCACAAAUAUUA
CCAGAUCCAUCAAAACCAAGCAAGAGGUCAUUUAUUGAAGAUCUACUUUUC
AACAAAGUGACACUUGCAGAUGCUGGCUUCAUCAAACAAUAUGGUGAUUG CCUUGGUGAUAUUGCUGCUAGAGACCUCAUUUGUGCACAAAAGUUUAACG GCCUUACUGUUUUGCCACCUUUGCUCACAGAUGAAAUGAUUGCUCAAUACA CUUCUGCACUGUUAGCGGGUACAAUCACUUCUGGUUGGACCUUUGGUGCAG GUGCUGCAUUACAAAUACCAUUUGCUAUGCAAAUGGCUUAUAGGUUUAAU GGUAUUGGAGUUACACAGAAUGUUCUCUAUGAGAACCAAAAAUUGAUUGC CAACCAAUUUAAUAGUGCUAUUGGCAAAAUUCAAGACUCACUUUCUUCCAC
AGCAAGUGCACUUGGAAAACUUCAAAAUGUGGUCAACCAAAAUGCACAAG CUUUAAACACGCUUGUUAAACAACUUAGCUCCAAUUUUGGUGCAAUUUCA AGUGUUUUAAAUGAUAUCCUUUCACGUCUUGACAAAGUUGAGGCUGAAGU GCAAAUUGAUAGGUUGAUCACAGGCAGACUUCAAAGUUUGCAGACAUAUG UGACUCAACAAUUAAUUAGAGCUGCAGAAAUCAGAGCUUCUGCUAAUCUU GCUGCUACUAAAAUGUCAGAGUGUGUACUUGGACAAUCAAAAAGAGUUGA
UUUUUGUGGAAAGGGCUAUCAUCUUAUGUCCUUCCCUCAGUCAGCACCUCA UGGUGUAGUCUUCUUGCAUGUGACUUAUGUCCCUGCACAAGAAAAGAACU UCACAACUGCUCCUGCCAUUUGUCAUGAUGGAAAAGCACACUUUCCUCGUG AAGGUGUCUUUGUUUCAAAUGGCACACACUGGUUUGUAACACAAAGGAAU UUUUAUGAACCACAAAUCAUUACUACAGACAACACAUUUGUGUCUGGUAA CUGUGAUGUUGUAAUAGGAAUUGUCAACAACACAGUUUAUGAUCCUUUGC AACCUGAAUUAGACUCAUUCAAGGAGGAGUUAGAUAAAUAUUUUAAGAAU CAUACAUCACCAGAUGUUGAUUUAGGUGACAUCUCUGGCAUUAAUGCUUC AGUUGUAAACAUUCAAAAAGAAAUUGACCGCCUCAAUGAGGUUGCCAAGA AUUUAAAUGAAUCUCUCAUCGAUCUCCAAGAACUUGGAAAGUAUGAGCAG UAUAUAAAAUGGCCAUGGUACAUUUGGCUAGGUUUUAUAGCUGGCUUGAU UGCCAUAGUAAUGGUGACAAUUAUGCUUUGCUGUAUGACCAGUUGCUGUA GUUGUCUCAAGGGCUGUUGUUCUUGUGGAUCCUGCUGCAAAUUUGAUGAA GACGACUCUGAGCCAGUGCUCAAAGGAGUCAAAUUACAUUACACAUAA (SEQ ID NO: 30).
[0120] In some embodiments, the SARS-CoV-2 spike protein is encoded by the nucleic acid sequence:
ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTA CAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTT TATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTG TTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGG ACCAATGTTATTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGT
TTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTA
CTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAAT
GTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTT
TATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATT
CTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACC
TTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAA
TATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGCG
TGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAG
GTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAATTCTTCTTCAG
GTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACT
TTTCTATTAAAATATAATGAAAATGGAACCATTACAGATGCTGTAGACTGTGC
ACTTGACCCTCTCTCAGAAACAAAGTGTACGTTGAAATCCTTCACTGTAGAAA
AAGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATTGTT
AGATTTCCTAATATTACAAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACC
AGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCAACTGTGTTGC
TGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGG
AGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTC
ATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGA
AAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTAT
AGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACC
AGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCA
ACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAA
TTGTTACTCTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTA
CCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCAA
CTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTCAAT
TTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAA
GTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTACTGATGCTG
TCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTTCTTTTGGTG
GTGTCAGTGTTATAACACCAGGAACAAATACTTCTAACCAGGTTGCTGTTCTT
TATCAGGGTGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACT
TACTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGC
AGGCTGTTTAATAGGGGCTGAACATGTCAACAACTCATATGAGTGTGACATA
CCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCTCCTCG GCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTG
GTGCAGAAAATTCAGTTGCTTACTCTAATAACTCTATTGCCATACCCACAAAT
TTTACTATTAGTGTTACTACAGAAATTCTACCAGTGTCTATGACCAAGACATC
AGTAGATTGTACAATGTACATTTGTGGTGATTCAACTGAATGCAGCAATCTTT
TGTTGCAATATGGCAGTTTTTGTACACAATTAAACCGTGCTTTAACTGGAATA
GCTGTTGAACAAGACAAAAACACCCAAGAAGTTTTTGCACAAGTCAAACAAA
TTTACAAAACACCACCAATTAAAGATTTTGGTGGTTTTAATTTTTCACAAATA
TTACCAGATCCATCAAAACCAAGCAAGAGGTCATTTATTGAAGATCTACTTTT
CAACAAAGTGACACTTGCAGATGCTGGCTTCATCAAACAATATGGTGATTGCC
TTGGTGATATTGCTGCTAGAGACCTCATTTGTGCACAAAAGTTTAACGGCCTT
AATGTTTTGCCACCTTTGCTCACAGATGAAATGATTGCTCAATACACTTCTGC
ACTGTTAGCGGGTACAATCACTTCTGGTTGGACCTTTGGTGCAGGTGCTGCAT
TACAAATACCATTTGCTATGCAAATGGCTTATAGGTTTAATGGTATTGGAGTT
ACACAGAATGTTCTCTATGAGAACCAAAAATTGATTGCCAACCAATTTAATAG
TGCTATTGGCAAAATTCAAGACTCACTTTCTTCCACAGCAAGTGCACTTGGAA
AACTTCAAGATGTGGTCAACCAAAATGCACAAGCTTTAAACACGCTTGTTAA
ACAACTTAGCTCCAATTTTGGTGCAATTTCAAGTGTTTTAAATGATATCCTTTC
ACGTCTTGACAAAGTTGAGGCTGAAGTGCAAATTGATAGGTTGATCACAGGC
AGACTTCAAAGTTTGCAGACATATGTGACTCAACAATTAATTAGAGCTGCAG
AAATCAGAGCTTCTGCTAATCTTGCTGCTACTAAAATGTCAGAGTGTGTACTT
GGACAATCAAAAAGAGTTGATTTTTGTGGAAAGGGCTATCATCTTATGTCCTT
CCCTCAGTCAGCACCTCATGGTGTAGTCTTCTTGCATGTGACTTATGTCCCTGC
ACAAGAAAAGAACTTCACAACTTCTCCTGCCATTTGTCATGATGGAAAAGCA
CACTTTCCTCGTGAAGGTGTCTTTGTTTCAAATGGCACACACTGGTTTGTAAC
ACAAAGGAATTTTTATGAACCACAAATCATTACTACAGACAACACATTTGTGT
CTGGTAACTGTGATGTTGTAATAGGAATTGTCAACAACACAGTTTATGATCCT
TTGCAACCTGAATTAGACTCATTCAAGGAGGAGTTAGATAAATATTTTAAGAA
TCATACATCACCAGATGTTGATTTAGGTGACATCTCTGGCATTAATGCTTCAG
TTGTAAACATTCAAAAAGAAATTGACCGCCTCAATGAGGTTGCCAAGAATTT
AAATGAATCTCTCATCGATCTCCAAGAACTTGGAAAGTATGAGCAGTATATA
AAATGGCCATGGTACATTTGGCTAGGTTTTATAGCTGGCTTGATTGCCATAGT
AATGGTGACAATTATGCTTTGCTGTATGACCAGTTGCTGTAGTTGTCTCAAGG
GCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACGACTCTGAGCCA
GTGCTCAAAGGAGTCAAATTACATTACACATAA (SEQ ID NO: 36) [0121] In some embodiments, the SARS-CoV-2 spike protein is encoded by the nucleic acid sequence: (SEQ ID NO: 27).
[0122] In some embodiments, the SARS-CoV-2 spike protein of the British variant (B.1.1.7) as referred to herein comprises or consists of SEQ ID NO: 28.
[0123] In some embodiments, the SARS-CoV-2 spike protein of the South African variant (B.1.351) as referred to herein comprises or consists of SEQ ID NO: 29.
[0124] In some embodiments, the SARS-CoV-2 spike protein of the Indian variant (B.1.617) as referred to herein comprises or consists of SEQ ID NO: 30.
[0125] In some embodiments, the SARS-CoV-2 spike protein of the South American variant (C.37) as referred to herein comprises or consists of SEQ ID NO: 36.
[0126] In some embodiments, the SARS-CoV-2 spike protein is encoded by any one of SEQ ID Nos: 27-30, and 36.
[0127] In some embodiments, the SARS-CoV-2 of the Brazilian variant (P.l) as referred to herein comprises the nucleic acid sequence: CAUGACGUUCGUGUUGUUUUAGAUUUCAUCUAAACGAACAAACAAACUAA AAUGUCUGAUAAUGGACCCCAAAAUCAGCGAAAUG (SEQ ID NO: 31).
[0128] In some embodiments, the SARS-CoV-2 of the "original" SARS-CoV-2 variant, as described herein, comprises the nucleic acid sequence: CAUGACGUUCGUGUUGUUUUAGAUUUCAUCUAAACGAACAAACUAAAAUG UCUGAUAAUGGACCCCAAAAUCAGCGAAAUG (SEQ ID NO: 32).
[0129] In some embodiments, the method further comprises an additional step, comprising extracting RNA from the biological sample. In some embodiments, the method further comprises an additional step comprising performing a reverse transcription reaction using extracted RNA as a template for producing cDNA. In some embodiments, the method further comprises an additional step comprising extracting RNA from the biological sample and performing a reverse transcription reaction using extracted RNA as a template for producing cDNA. In some embodiments, the additional step proceeds step (a) of the herein disclosed method.
[0130] Methods for RNA extraction and/or reverse transcription are common and would be apparent to one of ordinary skill in the art. [0131] In some embodiments, the biological sample is derived or obtained from an environment or a subject.
[0132] In some embodiments, a biological sample derived or obtained from an environment is derived or obtained from: sewage, a water source, or soil.
Kit
[0133] In one embodiment, the present invention provides combined preparations. In one embodiment, “a combined preparation” defines especially a “kit of parts” in the sense that the combination partners as defined above can be dosed independently or by use of different fixed combinations with distinguished amounts of the combination partners i.e., simultaneously, concurrently, separately or sequentially. In some embodiments, the parts of the kit of parts can then, e.g., be used simultaneously or chronologically staggered, that is at different time points and with equal or different time intervals for any part of the kit of parts. The ratio of the total amounts of the combination partners, in some embodiments, can be used in the combined preparation.
[0134] According to some embodiments, there is provided a kit for determining the presence of SARS-CoV-2 RNA molecule in a biological sample, comprising at least one pair of primers capable of amplifying a cDNA molecule complementary to the SARS-CoV- 2 RNA molecule.
[0135] In some embodiments, the at least one pair of primers is selected from: (i) a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 1, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 22; (ii) a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 2, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 3; (iii) a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 4, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 23; (iv) a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 6, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 7; (v) a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 9, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 10; (vi) a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 11, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 12; (vii) a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 16, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 17; (viii) a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 18, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 19; (ix) a first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 33, and a second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 34; and (x) any combination of (i) to (ix).
[0136] In some embodiments, the kit further comprises at least one probe molecule being a nucleic acid sequence capable of hybridizing to the cDNA molecule.
[0137] In some embodiments, the at least one probe consists of a nucleic acid sequence selected from: SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 5, SEQ IN NO: 8, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 35, and any combination thereof.
[0138] In some embodiments, the kit further comprises instructions for contacting the cDNA molecule complementary to the SARS-CoV-2 RNA molecule with: the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 1, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 22, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 24.
[0139] In some embodiments, the kit further comprises instructions for contacting the cDNA molecule complementary to the SARS-CoV-2 RNA molecule with: the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 2, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 3, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 25.
[0140] In some embodiments, the kit further comprises instructions for contacting the cDNA molecule complementary to the SARS-CoV-2 RNA molecule with: the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 4, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 23, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 5.
[0141] In some embodiments, the kit further comprises instructions for contacting the cDNA molecule complementary to the SARS-CoV-2 RNA molecule with: the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 6, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 7, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 8.
[0142] In some embodiments, the kit further comprises instructions for contacting the cDNA molecule complementary to the SARS-CoV-2 RNA molecule with: the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 9, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 10, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 13.
[0143] In some embodiments, the kit further comprises instructions for contacting the cDNA molecule complementary to the SARS-CoV-2 RNA molecule with: the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 9, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 10, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 14.
[0144] In some embodiments, the kit further comprises instructions for contacting the cDNA molecule complementary to the SARS-CoV-2 RNA molecule with: the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 11, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 12, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 15.
[0145] In some embodiments, the kit further comprises instructions for contacting the cDNA molecule complementary to the SARS-CoV-2 RNA molecule with: the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 16, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 17, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 20. [0146] In some embodiments, the kit further comprises instructions for contacting the cDNA molecule complementary to the SARS-CoV-2 RNA molecule with: the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 18, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 19, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 21.
[0147] In some embodiments, the kit further comprises instructions for contacting the cDNA molecule complementary to the SARS-CoV-2 RNA molecule with: the first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 33, the second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 34, and the probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 35.
[0148] In some embodiments, the kit further comprises instructions for: extracting RNA from a biological sample being derived or obtained from an environment or a subject, reverse transcribing the extracted RNA to cDNA, or any combination thereof.
[0149] In one embodiment, the present invention provides at least one pair of DNA primers capable of amplifying a nucleic acid molecule, e.g., SARS-CoV-2 RNA complementary DNA (cDNA), as described herein, in a polymerase chain reaction (PCR). In one embodiment, the present invention provides at least one pair of amplification DNA primers for PCR.
[0150] In some embodiments, the present invention further provides at least one probe, capable of hybridizing to a nucleic acid molecule, e.g., SARS-CoV-2 RNA complementary DNA (cDNA), as described herein, and of generating a detectable signal. In some embodiments, the detectable signal is correlative to the amount of the nucleic acid molecule, e.g., SARS-CoV-2 RNA complementary DNA (cDNA). In some embodiments, the probe is being hydrolyzed in the polymerase chain reaction (PCR). In some embodiments, hydrolyzed comprises 5’ to 3’ exonucleation. In some embodiments, hydrolyzed is by 5’ to 3’ exonuclease activity of a DNA polymerase. In some embodiments, the DNA polymerase is the DNA polymerase of the PCR amplification. In some embodiments, the probe comprises a dye. In some embodiments, the probe comprises a quencher. In some embodiments, the probe is detectable after being partially or fully hydrolyzed. In some embodiments, an intact probe is undetected. [0151] As used herein, the terms “exonuclease” or “exonucleation” refer to an enzyme or activity thereof, respectfully, capable of cleaving nucleotides one at a time from the terminal end of a nucleic acid chain.
[0152] In some embodiments, the probe comprises at least one DNA nucleotide. In some embodiments, the probe comprises at least one RNA nucleotide. In some embodiments, the probe comprises at least one locked nucleic acid (LNA) nucleotide. In some embodiments, the probe is a DNA probe. In some embodiments, the probe is an RNA probe. In some embodiments, the probe is an LNA probe. In some embodiments, the probe comprises: at least one DNA nucleotide, at least one RNA nucleotide, at least one LNA nucleotide, or any combination thereof.
[0153] The term “probe” refers to a labeled or unlabeled oligonucleotide capable of selectively hybridizing to a target or template nucleic acid under suitable conditions. Typically, a probe is sufficiently complementary to a specific target sequence contained in a nucleic acid sample to form a stable hybridization duplex with the target sequence under a selected hybridization condition, such as, but not limited to, a stringent hybridization condition. A hybridization assay carried out using the probe under sufficiently stringent hybridization conditions permits the selective detection of a specific target sequence. For use in a hybridization assay for the discrimination of single nucleotide differences in sequence, the hybridizing region is typically from about 8 to about 100 nucleotides in length. Although the hybridizing region generally refers to the entire oligonucleotide, the probe may include additional nucleotide sequences that function, for example, as linker binding sites to provide a site for attaching the probe sequence to a solid support or the like, as sites for hybridization of other oligonucleotides, as restriction enzymes sites or binding sites for other nucleic acid binding enzymes, etc. In certain embodiments, a probe of the invention is included in a nucleic acid that comprises one or more labels (e.g., a reporter dye, a quencher moiety, a fluorescent labeling, etc.), such as a 5 '-nuclease probe, a FRET probe, a molecular beacon, or the like, which can also be utilized to detect hybridization between the probe and target nucleic acids in a sample. In some embodiments, the hybridizing region of the probe is completely complementary to the target sequence. However, in general, complete complementarity is not necessary (i.e., nucleic acids can be partially complementary to one another); stable duplexes may contain mismatched bases or unmatched bases. Modification of the stringent conditions may be necessary to permit a stable hybridization duplex with one or more base pair mismatches or unmatched bases. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001), which is incorporated by reference, provides guidance for suitable modification. Stability of the target/probe duplex depends on a number of variables including length of the oligonucleotide, base composition and sequence of the oligonucleotide, temperature, and ionic conditions. One of skill in the art will recognize that, in general, the exact complement of a given probe is similarly useful as a probe. Exemplary probe nucleic acids include 5 '-nuclease probes, molecular beacons, among many others known to persons of skill in the art.
[0154] As used herein, “hybridization” refers to a reaction in which at least one polynucleotide reacts to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson-Crick base pairing, in any other sequence- specific manner.
[0155] In one embodiment, PCR comprises denaturing double-stranded DNA in a sample (to separate the complementary strands), annealing the primers to the dissociated DNA strands, and extension reaction from the primers catalyzed by a thermostable DNA polymerase, the cycle is then repeated.
[0156] In one embodiment, PCR comprises denaturing double-stranded DNA in a sample (to separate the complementary strands), annealing the primers to the dissociated DNA strands, annealing the probe to one of the dissociated DNA strands, extension reaction from the primers catalyzed by a thermostable DNA polymerase, 5’ to 3’ exonucleation of the probe hybridized to one of the dissociated DNA strands, and determining the amount of signal generated by the 5’ to 3’ exonucleation of the probe, the cycle is then repeated.
[0157] In one embodiment, a pair of DNA primers as described herein are specifically complementary to and hybridizing with opposite strands DNA with one to the left (5') and one to the right (3') of the target sequence within the SARS-CoV-2 RNA complementary DNA to be amplified. In one embodiment, the target sequence within the SARS-CoV-2 RNA complementary DNA to be amplified is a nucleic acid molecule encoding a spike protein, as described herein. In one embodiment, the target sequence within the SARS- CoV-2 RNA complementary DNA to be amplified is a nucleic acid molecule encoding a nucleocapsid protein as described herein. In one embodiment, the target sequence within the SARS-CoV-2 RNA complementary DNA to be amplified is a nucleic acid molecule located 3' downstream to a nucleic acid sequence encoding ORF8 and 5' upstream to a nucleic acid sequence encoding the nucleocapsid protein, as described herein. In one embodiment, the existence of a nucleic acid molecule as described herein in a biological sample, provides direct evidence for the presence of SARS-CoV-2 RNA in the biological sample as described herein.
[0158] In one embodiment, the absence of an amplification product resulting from contacting a biological sample suspected of comprising a SARS-CoV-2 RNA complementary DNA with oligonucleotides of the invention under PCR amplification conditions, indicates that the biological sample is devoid of SARS-CoV-2 RNA, SARS- CoV-2 RNA complementary DNA, or both.
[0159] In one embodiment, the biological sample comprises an environment derived biological sample. In some embodiments, the biological sample is obtained from the environment. In some embodiments, the biological sample is obtained or derived form a subject, such as, but not limited to a mammal, e.g., a human. In some embodiments, the subject is a human subject (as may be referred to herein as “clinical sample”). In some embodiments, an environment derived biological sample is derived or obtained from sewage. In some embodiments, an environment derived biological sample is derived or obtained from a water source. In some embodiments, a water source comprises: a lake, a water reservoir, a stream, a river, or a wastewater treatment or processing plant. In some embodiments, a water source comprises any body of water used by humans, or in proximity to a human settlement which is affected or connected to human activity. In some embodiments, a water source is polluted by human activity. In some embodiments, the water source comprises a lake, a stream, or a river that is polluted by water wastes provided by human activity, e.g., sewage, wastewater, treated water, or any equivalent thereof, or any combination thereof.
[0160] In one embodiment, a kit as described herein further comprises a DNA polymerase. In one embodiment, a kit as described herein further comprises a thermostable DNA polymerase.
[0161] In some embodiments, the DNA polymerase has a proof-reading activity. In some embodiments, the DNA polymerase has a 5’ to 3’ exonuclease activity. In some embodiments, the DNA polymerase is capable of digesting a probe molecule hybridized to a dissociated DNA strand. In some embodiments, the DNA polymerase is capable of digesting a probe molecule hybridized to a dissociated DNA strand simultaneously to its extension or polymerization activity.
[0162] In one embodiment, the kit as described herein comprises a PCR buffer. A nonlimiting example of a PCR buffer includes but is not limited to a buffer comprising: 5 to 100 mM Tris-HCl and 20 to 100 mM KC1. The PCR buffer may further comprise 10 to 100 mM Magnesium Chloride. In one embodiment, the kit as described herein comprises a dNTP mixture. In one embodiment, the kit as described herein comprise DNA Polymerase such as but not limited to Taq DNA Polymerase. In one embodiment, the kit as described herein comprise distilled water.
General
[0163] As used herein the term “about” refers to ± 10 %.
[0164] The terms "comprises", "comprising", "includes", "including", “having” and their conjugates mean "including but not limited to".
[0165] The term “consisting of means “including and limited to”.
[0166] The term "consisting essentially of" means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
[0167] The word “exemplary” is used herein to mean “serving as an example, instance or illustration”. Any embodiment described as “exemplary” is not necessarily to be construed as preferred or advantageous over other embodiments and/or to exclude the incorporation of features from other embodiments.
[0168] The word “optionally” is used herein to mean “is provided in some embodiments and not provided in other embodiments”. Any particular embodiment of the invention may include a plurality of “optional” features unless such features conflict.
[0169] As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof.
[0170] Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
[0171] Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases “ranging/ranges between” a first indicate number and a second indicate number and “ranging/ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
[0172] As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
[0173] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments unless the embodiment is inoperative without those elements.
[0174] The descriptions of the various embodiments of the present invention have been presented for purposes of illustration but are not intended to be exhaustive or limited to the embodiments disclosed. Many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments. The terminology used herein was chosen to best explain the principles of the embodiments, the practical application or technical improvement over technologies found in the marketplace, or to enable others of ordinary skill in the art to understand the embodiments disclosed herein.
[0175] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
EXAMPLES
[0176] Generally, the nomenclature used herein, and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological, and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds.) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Culture of Animal Cells - A Manual of Basic Technique" by Freshney, Wiley-Liss, N. Y. (1994), Third Edition; "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J., ed. (1984); “Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., eds. (1984); "Animal Cell Culture" Freshney, R. I., ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA (1990); Marshak et al., "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference. Other general references are provided throughout this document.
Materials and Methods
Primers and probes design
[0177] The original sequence of SARS-CoV-2 (NC_045512.2) was taken from NCBI database. British B.1.1.7 variant (EPI_ISL_742238), SA B.1.351 variant (EPI_ISL_736935), P.l variant (EPI_ISL_981709) and B.1.617 variant (EPI_ISL_1704637) sequences were taken from GISAID database (Shu and McCauley, 2017). The probe design focused on the S gene 21724-21828 bp location that includes the British deletion 69-70, or S gene 22243-22331 bp location that includes the SA deletion 241-243, or the end of ORF8 and the beginning of N gene 28227-28286 bp location that includes the P.l insertion, or S gene 21989-22083 bp location that includes the Indian deletion 157-158. All primers and probes were purchased through Integrated DNA Technologies (IDT). ZEN Quencher was added to the probes as a second, internal quencher in qPCR 5’-nuclease assay. To allow a possibility for duplex assay, SI probe was assigned a 6-carboxy-fluorescein (FAM) fluorophore and SA69 probe was assigned to Yakima Yellow (YakYel) fluorophore. SA241, SA157 and P.l probes were assigned with FAM as well.
RT-qPCR
[0178] RT-qPCR was executed using One Step PrimeScript III RT-qPCR mix using standard manufacture protocol (RR600 TAKARA, Japan). Each reaction mixture contains primers (0.5 pM each), probe (0.2 pM each), ROX reference dye and 5 pL of DNA or RNA (dfLO was added to a final volume of 20 pL reaction volume). RT-qPCR amplification was executed using Step One Plus real-time PCR system (Applied Biosystems, Thermo Scientific). In addition to what is described above, in each run, all RT-qPCR experiments included quality controls. The first control was using water samples instead of DNA/RNA (Non template control (NTC)). The second control, used for RNA extractions, was MS2 phage detection (Dreier et al., 2005).
Calibration curves and limit of detection determination
[0179] Calibration curves were performed on a known-positive DNA gene block. Five (5) different gene blocks were used; (1) containing SARS-CoV-2 S gene sequence as reported for Wuhan-Hu-1 (NC_045512.2); (2) containing S gene sequence matching the reported 69-70 deletion of the British variant (B.l.1.7) as well as the reported 241-243 deletion of the SA variant (B.1.351); (3) containing the end of ORF8 until the beginning of N gene carried on a plasmid matching the reported 4 nucleotides insertion of the Brazilian variant (P.l); (4) containing S gene sequence matching the reported 157-158 deletion of the Indian variant (B.1.617); and (5) N gene detection containing standard CDC positive control plasmid was purchased from Integrated DNA Technologies (IDT). Calibration of SI probe was performed using the first gene block, while calibration of SA69 probe and SA241 was performed using the second gene block with the relevant deletions. Calibration of P.l was performed with the third gene block and calibration of SA157 was performed with the fourth gene block. All N gene related calibrations were performed with the fifth gene block. Serial dilutions for the relevant gene block were prepared based on copy number calculations. The resulting Ct values were plotted against the log copy number of the S gene template. Each concentration was examined by a minimum of six repetitions and a standard deviation was calculated. Linear regression was performed between the log copy number and the Ct values from the RT-qPCR results.
Wastewater RNA extraction
[0180] For wastewater sampling, composite sewage samples from the wastewater treatment plant (WWTP) were immediately transferred to the lab under chilled conditions. The samples were kept at 4°C until processed. Direct or concentrated RNA was extracted twice according to manufacture protocol as described in the NucleoSpin RNA extraction kit (Macherey Nagel, Germany). The MS2 phage (105 copies) was added to the lysis buffer in each RNA extraction as internal control. RNA was eluted with 50 pL of RNase free water and kept at -80 °C.
Complex matrix detection
[0181] RNA extracted from wastewater sample, pre-determined as negative for SARS- CoV-2 using standard CDC’s detection sets, was supplemented with known concentrations of a desired gene block. The samples underwent the same RT-qPCR conditions as described for the calibration curves. Matrix pre-determined as negative, was constantly verified as negative in each assay without spiking. In each set, eight repetitions were performed for each viral concentration or control. Ct results were plotted to represent the new probes limit of detection in a complex environment. Wastewater concentration
[0182] A volume of two to five liter of 24 hr composite wastewater samples collected from the WWTP were shaken and mixed for 2 minutes manually. The samples were left standing for 15 minutes to ensure large particle settlement. The samples were then pumped at a rate of 10 L/min through a dialysis filter with a pore size 3-30 nm (NUFiltration©, Israel). The filter was backwashed with 0.07 to 0.15 Liter DW and collected directly to new 0.25 L bottle. After each sample concentration procedure, 2.5 liter of 0.01% hypochlorite solution was passed through the system followed by a 10 minute wash with DW to ensure no hypochlorite traces and new dialysis filter was placed for new batch concentration.
EXAMPLE 1
Improved primers and probes for SARS-CoV-2 N gene detection
[0183] When the SARS-CoV-2 emerged, the recommended detection method was through RT-qPCR analysis; a methodology that is still is the preferred method. Several different published primers-probe sets were used, aiming at different genes of the SARS- CoV-2 virus (such as N gene, E gene, S gene). Initially, the Centers for Disease Control and Prevention (CDC)’s, recommendation was to carry out RT-qPCR analysis using 3 sets of primers and probes, Nl, N2 and N3, all targeting the N gene. Apart from clinical testing, these CDC recommended primer sets were also examined on wastewater samples and demonstrated positive SARS-CoV-2 detection. However, after careful scrutiny of these published sequences, the inventors detected possible problems with annealing stability and thus suggested a modification of the published primer-probe to improve annealing stability.
[0184] Since the 3' end of a primer sequence is the transcription initiation point for the polymerase, it is preferable the 3' end of a primer will possess G/C for more stable annealing (3 hydrogen bonds, compared to only 2 between A/T pair). Thus, looking to improve the available sets of primers, when there was no G/C at the 3' end, the primers were shifted to include G/C. In addition, to improve the N3 set, the probe sequence was shifted as well in order to maintain close proximity to the forward primer. Based on this approach, all 3 of the recommended primers-probe sets were improved (Fig. 1A, and Table 1). Furthermore, the inventors also generated a fourth primers-probe termed “N4 new”. The new and improved sequences are presented in Table 1. Table 1. List of the oligonucleotides of the invention targeting the Nucleocapsid protein encoding gene.
Figure imgf000047_0001
[0185] Once designed, all primers-probe sets were thoroughly characterized and compared to the previously published CDC's sets (Nl, N2, and N3). Using dsDNA templates, a calibration curve was generated for each set (Fig. IB). A detection range of between 106 copies and 10° copies per pL was tested for each set. Employing linear regression on all calibration curves resulted in a good fit and allowed the determination of limit of detection (LOD) for each set (Table 2). Comparing each set to its improved version, LOD for CDC’s Nl vs. Improved Nl and CDC’s N2 vs. Improved N2 were the same (1 and 10 copies per pL respectively). For CDC’s N3 vs. Improved N3, a significant improvement was observed when LOD was reduced from 10 copies per pL to 1 copy per pL. The newly designed N4 set demonstrated LOD of 10 copies per pL.
Table 2. qPCR of different sets of improved and original CDC’s, on a SARS-CoV-2 synthetic gene.
Figure imgf000047_0002
Figure imgf000048_0001
EXAMPLE 2
New oligonucleotides provide improved detection in an environmental sample with increased amplification efficacy and sensitivity
[0186] Following basic characterization, further confirmation was sought after using a more complex environment for the RT-qPCR reaction. Detection of SARS-CoV-2 in wastewater is important with regards to the development of a quick early warning system for virus detection during the global pandemic. Thus, to test this ability wastewater matrix was collected from wastewater treatment plant in the city of Binyamina, Israel. All primers- probe sets were employed on the wastewater samples that had been pre -determined as negative for SARS-CoV-2 when examined using dsDNA template copies (Fig. 2). As can be seen in Fig. 2, results for the CDC's detection sets (Nl, N2, N3) were somewhat similar to previously published detection results.
[0187] LOD is determined as the lowest detected copy number per pL in 90% of the tested cases. Given the complexity of the wastewater matrix, a reduction in LOD could be observed for all sets, CDC and Improved sets, except for in Improved N3 set. Compared to the calibration curves, while all the sets LOD rose to 100 copies per pL (compared to 10 or 1 copies concluded before), the Improved N3 was the only set that remained with a stable LOD value of 1 copy per pL. Comparison between the CDC’s sets and improved sets in a controlled wastewater sample, revealed that each improved set demonstrated better detection abilities than the original CDC's set, as expected. A hierarchy of sensitivity were given to the examined N gene detection sets as follows (best to poorest): Improved N3 > Improved N2 > N4 new > Improved Nl > CDC’s N3 > CDC’s N2 > CDC’s Nl. Thus the best set observed was Improved N3 with the ability to detect 1 copy per pL at 100% of the cases, an improved result when compared to other primers-probe sets reported in literature. [0188] Based on all characterizations performed, the improved N3 set demonstrated the best detection abilities out of all examined sets. It was then validated on various wastewater samples. Together with Improved N3 set, the CDC's N2 set was also added as a formerly approved control to each experiment (CDC’s N3 performed better than CDC’s N2, however N3 set was not recommended by the CDC after a few months of usage and only N 1 and N2 remained as officially approved). Out of 148 different wastewater samples, 17 were not detected by either set. For the remaining 131 samples, a ACt was calculated between CDC’s N2 Ct and Improved N3 Ct (Fig. 3). A positive ACt value means a better detection by the Improved N3 set, while a negative value indicates better detection by CDC’s N2. Out of 131 wastewater samples with a calculated ACt, the majority showed positive ACt, for the Improved N3 set indicating better detection by this set (Fig. 3). Moreover, in 13 samples Improved N3 detected SARS-CoV-2 while CDC’s N2 did not detect any signal. Only 2 samples showed the reverse, where CDC’s N2 detected a signal and Improved N3 did not. Matching the characterization results, Fig. 3 shows the ability of the improved N3 set to better detect SARS-CoV-2 in wastewater, as it systematically provided lower Ct values. Consequently, the Improved N3 primers-probe set is recommended and provides more sensitive virus detection and can be employed on various samples.
EXAMPLE 3
RT-qPCR detection of variants of concern B.l.1.7 and B.1.351
[0189] Existing detection methods for SARS-CoV-2 variants are either through NGS sequencing or indirect RT-qPCR assays. To improve rapid detection, we focused on the development of a direct RT-qPCR assay for detection of variants of concern, the British variant B .1.1.7 and South Africa (SA) variant B.1.351. These were deemed the most urgent variants in need for fast detection in Israel. Our design for RT-qPCR detection assays of these two variants (Fig. 4) is based on the differences in the S gene from the original SARS- CoV-2 sequence published (NC_045512.2). The B.l.1.7 S gene contains a deletion known as A69-70 and the B.1.351 S gene contains a deletion known as A241-243. Accordingly, our designed detection-probe set focused on these regions and presented in Fig. 4.
[0190] For B.l.1.7 detection, the designed set is located at the S gene 21724-21828 bp of the original sequence. Within this range, the original SARS-CoV-2 and B.l.1.7 sequences are completely identical, apart from 6 nucleotides deletions (Fig. 4A). Our main attempt was to create two separate detections to the amplified area, one corresponding to the original sequence (when using SI probe) and the other corresponding to the B.l.1.7 (when using the SA69 probe). Using designated primers (Table 3) to amplify the specified region surrounding the 6 nucleotides differences, amplification will be generated regardless of the variant. The probes can thus be used in a single duplex assay via separate wavelengths, where a signal signifies a direct detection of either the original sequence, of B.l.1.7, or a combination of the two if exist.
Table 3. List of the oligonucleotides of the invention targeting the Spike 1 protein encoding gene (of the “original variant”, the “British variant”, and the “south African” variant, as disclosed herein).
Figure imgf000050_0001
[0191] For B.1.351 detection, the designated detection region was chosen further along the S gene when compared to the B.l.1.7 detection region. Focusing on S gene 22243- 22331 bp of the original sequence, the original SARS-CoV-2 sequence is identical to the B.1.351 sequence except for a 9 nucleotide deletion (Fig. 4A). Using a detection set comprised of two primers meant to amplify the target region, a single probe (SA241 probe) was designed for the detection of the B.1.351 variant. The SA241 probe is meant to correspond only to the deletion of 9 nucleotides in the specified region characterizing B.1.315, therefore it will signal detection only when B.1.351 is present and will not correspond to the original or B.1.1.7 sequence.
[0192] To ensure functionality, the described sets of primers and probes underwent characterization. Initially, a calibration curve was generated for primers with the relevant probe separately, using dsDNA as a template. A detection range of between 106 copies and 10° copies per pL was tested for each set (Fig. 4B). Linear regression performed for the three probes demonstrated strong correlation and also validated the usage of the probe on the amplified fragment. An LOD could be determined for each primer-probe set and was identified as 101 copies per pL for all three sets (Table 4).
Table 4. List of Limit of detection, Linear regression R2, and Y intercept values based on calibration curves.
Figure imgf000051_0001
[0193] As with the initial N gene detection sets, basic characterization was followed with further confirmation to the described methodology using a more complex environment for the RT-qPCR reaction. Here as well, wastewater from Beer Sheva, Israel was used as the complex environment. All three probes were employed on wastewater samples predetermined as negative for SARS-CoV-2 with various dsDNA template copies (Fig. 5). As can be seen in Fig. 5, despite the wastewater matrix, SA69 maintained a LOD of 101 copies per pL. Unlike SA69 set, SI and SA241 sets’ LOD increased 10-fold to 102 copies per pL, meaning that the complexity of the wastewater matrix influenced detection performance. Despite the fact that LOD increased for two out of the three sets, all three detection sets have a LOD of 102 or lower, which corresponds to other utilized, functional RT-qPCR SARS-CoV-2 detection sets currently being used.
[0194] To examine the probes specificity and rule out possible false-positive cases, each set was tested with a negative control. For S 1 set, the negative control was comprised of a dsDNA template with the S gene with A69-70 and A241-243 nucleotides deletions. While for SA69 set and SA241 set, the original S gene sequence was used as negative control. As expected, none of the probes manifested a signal in the presence of a negative control and non-specific detection was not observed (Table 5).
[0195] Finally, the three sets, SI, SA69 and SA241 were tested on wastewater samples collected in February and March 2021 from different regions in Israel, (Table 5). The CDC’s N2 detection set was used as standard detection reference that can correspond to each of the variants as was the Improved N3 set. All samples were positive for N gene detection by the CDC’s N2 and Improved N3 detection sets, meaning all samples contained SARS-CoV-2. Examining detection ability of variants using this method showed that none of the samples were positive for the B.1.351 variant using the SA241 set. This indicated that the B.1.351 variant was absent from all wastewater samples. On the other hand, all regions apart from one resulted in detection by the SA69 set while the SI set had no signal. Such a result not only indicated that B.l.1.7 is present in most regions in Israel, but also that there was no detectible trace of the original SARS-CoV-2 NC_045512.2. Haifa was the only region where SI was detected, while SA69 was not, indicating the absence of B.l.1.7 and presence of the original NC_045512.2. The herein disclosed results correlated well with reports of the British variant B .1.1.7 outbreak in Israel.
Table 5. Detection sets results when employed on positive template, negative template or a waste water sample.
Figure imgf000052_0001
Figure imgf000053_0001
*WWTP - Wastewater treatment plant; ** ND - Not detected
[0196] Following the positive detection of B.1.1.7 in wastewater in Israel, the inventors wanted to learn when did the variant’s outbreak occur. Since wastewater samples from the city of Beer Sheva had been collected throughout the SARS-CoV-2 outbreak, this allowed the inventors to examine the time period from November 2020 until March 2021. All wastewater samples were subjected to N gene, SI and SA69 detection (Fig. 6). As can be seen in Fig. 6, the original SARS-CoV-2 NC_045512.2 was present without any trace of the B.l.1.7 variant until mid-January 2021. By the end of January 2021, B.l.1.7 had emerged in the wastewater and was already more abundant than the original NC_045512.2. By the end of February 2021, there was no trace of the original NC_045512.2, and the B.l.1.7 was the only variant detected. These results demonstrated the power of the new detection sets’ ability for discovery of variants of concern. Moreover, considering that unlike clinical samples, wastewater samples can contain several variants at the same time, these probes enabled the inventors to quantify and monitor several variants in a single wastewater sample is imperative.
[0197] An interesting observation presented in Fig. 6, was that the N gene detection constantly produced lower Ct values compared to S 1 detection. Upon the appearance of the B. l.1.7 variant the N gene and SA69 detection gaps were drastically reduced. This may imply different gene expression distributions or different durability of the RNA segments in the wastewater. As it is known that B.l.1.7 has a more potent expression than the original NC_045512.2, the fact that positive SA69 detection is closer to the N gene detection than the proximity of positive SI detection compared to N gene detection is understandable. However, these observations need further study and validation. In the meantime, this phenomenon may also affect the “drop-out” assays resulting in false-positives, reinforcing the need in direct detection. Overall, the displayed results indicated that the developed assay can be employed and will provide essential, direct detection abilities for B.l.1.7 and B.1.351 variants of concern.
EXAMPLE 4
RT-qPCR detection of variants of concern P.l (Brazilian) and B.1.617 (Indian)
[0198] The inventors have developed a direct RT-qPCR assay for detection of variants of concern, the Brazilian variant P.l and Indian variant B.1.617. These were believed to be the most urgent variants in need for fast detection in Israel. The herein disclosed design for RT-qPCR detection assays of these two variants (Fig. 7) is based on the differences in gene sequence from the original SARS-CoV-2 sequence published (NC_045512.2). The P.l variant contains an insertion located between the ORF8 region and the nucleocapsid gene, and the B.1.617 S gene contains a deletion known as A157-158. Accordingly, the herein disclosed designed detection-probe set focused on these regions and presented in Fig. 7.
[0199] For P.l variant detection, the designed forward primer is located at the end of ORF8 gene, and the reverse primer is located at the beginning of N gene, meaning 28227- 28286 bp of the original sequence. Within this range, the original SARS-CoV-2 and P.l sequences are completely identical, apart from a 4 nucleotides insertion (Fig. 7A). Using a detection set comprised of two primers meant to amplify the target region, a single probe (P.l probe) was designed for the detection of the P.l variant only (corresponding to the insertion). For B.1.617 detection, the designated detection region was chosen from within the S gene. Focusing on the S gene's 21989-22083 bp of the original sequence, the original SARS-CoV-2 sequence is identical to the B.1.617 sequence with the exception of a 6 nucleotides deletion (Fig. 7A). Using a detection set comprised of two primers meant to amplify the target region, a single probe (SAI 57 probe) was designed for the detection of the B.1.617 variant only (corresponding to the deletion; Table 6).
Table 6. List of the oligonucleotides of the invention targeting the Spike 1 protein encoding gene (of the “Brazilian variant”, and the “Indian variant”).
Figure imgf000054_0001
Figure imgf000055_0001
[0200] To ensure functionality, the described sets of primers and probes underwent characterization. Initially, a calibration curve was generated for primers with the relevant probe separately, using dsDNA as a template. A detection range of between 106 copies and 10° copies per pL was tested for each set (Fig. 7B). Linear regression performed for the three probes demonstrated strong correlation and also validated the usage of the probe on the amplified fragment. An LOD could be determined for each primer-probe set and was identified as 10° copies per pL for the two sets (Table 7).
Table 7. List of Limit of detection, Linear regression R2, and Y intercept values based on calibration curves.
Figure imgf000055_0002
[0201] Specificity of described sets was also examined through analysis of wastewater found positive for the original SARS-CoV-2 and the British Bl.1.7 variant. Both sets did not manifest a signal in such samples and were therefore found to be highly specific (Table 8). Table 8. Detection sets results when employed on positive template, negative template or a waste water sample.
Figure imgf000056_0001
*WWTP - Wastewater treatment plant; ** ND - Not detected; f Insertion positive template [0202] The basic characterization was followed with further confirmation to the described methodology using a more complex environment for the RT-qPCR reaction. Here as well, wastewater from Binyamina, Israel was used as the complex environment. The two probes were employed on wastewater samples pre-determined as negative for SARS-CoV-2 with various dsDNA template copies (Fig. 8). As can be seen in Fig. 8, despite the wastewater matrix, SAI 57 and P.l probes maintained high functionality with a LOD of 10° copies per pL.
[0203] Further, the inventors used the primers sets disclosed herein to determine the presence/absence of the British variant B.l.1.7 (SA69) Indian B.1.617 variant (SA157) in wastewater samples collected in Modi’in-Maccabim-Re’ut, Israel. [0204] The results show that only the SAI 57 was identified in the wastewater samples (Table 9).
Table 9. Modi'in-Maccabim-Re'ut city manholes detection for SARS-CoV-2 (N2 CDC), British variant (SA69) and Indian variant (SA157).
Figure imgf000057_0001
ND - Not detected
EXAMPLE 5
RT-qPCR detection of variant of concern Lambda (C.37)
[0205] The inventors developed a direct RT-qPCR assay for detection of Lambda variant. The herein disclosed design for RT-qPCR detection assay of this variant is based on the differences in spike protein gene sequence between the original SARS-CoV-2 (NC_045512.2) and the Lambda variant (GISAID ID EPI_ISL_2795719). The Lambda variant (also known as C.37) S gene, contains a deletion known as A246-252. Accordingly, the herein disclosed designed primers-probe detection set focused on this region as presented in Fig. 9, meaning the target sequence of 22256-22370 bp in the original sequence. Within this specified range, the original SARS-CoV-2 and Lambda sequences are completely identical, apart from a 21 nucleotides deletion (Fig. 9A). Using a detection set comprising two primers meant to amplify the target region, a single probe (PA246 probe) was designed for the detection of the Lambda variant only (corresponding strictly to the deletion in this region; Table 10). Table 10. List of the oligonucleotides of the invention targeting the Spike 1 protein encoding gene of the C.37 variant, e.g., “Lambda variant”).
Figure imgf000058_0001
0206] To ensure functionality, the described set of primers and probe underwent characterization. Initially, a calibration curve was generated for primers with the relevant probe, using dsDNA as a template. A detection range of between 106 copies and 10° copies per pl was tested (Fig. 9B). Linear regression performed demonstrated strong correlation and validated the usage of the probe on the amplified fragment. A limit of detection (LOD) could be determined as 102 copies per pl (Table 11). Specificity of the described set was also examined through analysis of wastewater found positive for the original SARS-CoV- 2, the British B 1.1.7 variant or the Delta B.1.617 variant. Moreover, a negative control for the SA246 set was tested in the form of a linear gene block corresponding to a part of the original variant's S gene. As expected, the SA246 set did not manifest a signal in any of these samples and was therefore found to be highly specific.
Table 11. List of Limit of detection, Linear regression R2, and Y intercept values based on a calibration curve.
Figure imgf000058_0002
[0207] The basic characterization was followed with further confirmation to the described methodology using a more complex environment for the RT-qPCR reaction. Here as well, wastewater from Lehavim, Israel was used as the complex environment. The primers-probe set employed on wastewater samples pre-determined as negative for SARS-CoV-2 with various dsDNA template copies (Fig. 9C). As can be seen in Fig. 9C, despite the wastewater matrix, SA246 probe maintained high functionality with a LOD of 102 copies per pl.
[0208] The invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.
[0209] All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation, or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.

Claims

What is claimed is:
1. A method for determining the presence of SARS-CoV-2 RNA or a variant thereof in a biological sample comprising: a. providing a biological sample suspected of comprising a complementary DNA (cDNA) molecule complementary to SARS-CoV-2 RNA molecule; b. contacting said biological sample of step (a) with a pair of primers capable of hybridizing to said cDNA molecule, wherein said pair of primers comprises any one of: i. a first primer being an oligonucleotide consisting of the nucleic acid sequence GACCCCAAAATCAGCGAAATG (SEQ ID NO: 1), and a second primer being an oligonucleotide consisting of the nucleic acid sequence TCTGGTTACTGCCAGTTGAATCTG (SEQ ID NO: 22); ii. a first primer being an oligonucleotide consisting of the nucleic acid sequence TGATTACAAACATTGGCCGC (SEQ ID NO: 2), and a second primer being an oligonucleotide consisting of the nucleic acid sequence TGCCAATGCGCGACATTCCG (SEQ ID NO: 3); iii. a first primer being an oligonucleotide consisting of the nucleic acid sequence GGGAGCCTTGAATACACCAAAAG (SEQ ID NO: 4), and a second primer being an oligonucleotide consisting of the nucleic acid sequence TGTAGCACGATTGCAGCATTG (SEQ ID NO: 23); iv. a first primer being an oligonucleotide consisting of the nucleic acid sequence CAATTTGCCCCCAGCGCTTC (SEQ ID NO: 6), and a second primer being an oligonucleotide consisting of the nucleic acid sequence ATCCAATTTGATGGCACCTG (SEQ ID NO: 7); v. a first primer being an oligonucleotide consisting of the nucleic acid sequence GTTCTTACCTTTCTTTTCCAATGTTAC (SEQ ID NO: 9), and a second primer being an oligonucleotide consisting of the nucleic acid sequence CCATCATTAAATGGTAGGACAGGG (SEQ ID NO: 10);
58 vi. a first primer being an oligonucleotide consisting of the nucleic acid sequence AGATTTGCCAATAGGTATTAACATC (SEQ ID NO: 11), and a second primer being an oligonucleotide consisting of the nucleic acid sequence CTGAAGAAGAATCACCAGGAGTC (SEQ ID NO: 12); vii. a first primer being an oligonucleotide consisting of the nucleic acid sequence CATGACGTTCGTGTTGTTTTAG (SEQ ID NO: 16), and a second primer being an oligonucleotide consisting of the nucleic acid sequence CATTTCGCTGATTTTGGGGTCC (SEQ ID NO: 17); viii. a first primer being an oligonucleotide consisting of the nucleic acid sequence GTTTATTACCACAAAAACAACAAAAG (SEQ ID NO: 18), and a second primer being an oligonucleotide consisting of the nucleic acid sequence GGCTGAGAGACATATTCAAAAGTG (SEQ ID NO: 19); and ix. a first primer being an oligonucleotide consisting of the nucleic acid sequence GGTATTAACATCACTAGGTTTCAAAC (SEQ ID NO: 33), and a second primer being an oligonucleotide consisting of the nucleic acid sequence GATAACCCACATAATAAGCTGCAGC (SEQ ID NO: 34); and c. subjecting said biological sample contacted with said pair of primers of step (b) to PCR amplification and obtaining an amplification product, wherein said amplification product is indicative of the presence of said cDNA molecule in said biological sample, thereby determining the presence of the SARS-CoV-2 RNA or a variant thereof in the biological sample.
2. The method of claim 1, wherein said step (b) further comprises contacting said biological sample with a probe molecule being a nucleic acid sequence capable of hybridizing to said cDNA molecule, wherein said: step (b)(i) comprises contacting said biological sample with a probe being a nucleic acid molecule consisting of the nucleic acid sequence
ACCCCGCATTACGTTTGGTGGACC (SEQ ID NO: 24);
59 step (b)(ii) comprises contacting said biological sample with a probe being a nucleic acid molecule consisting of the nucleic acid sequence ACAATTTGCCCCCAGCGCTTCAG (SEQ ID NO: 25); step (b)(iii) comprises contacting said biological sample with a probe being a nucleic acid molecule consisting of the nucleic acid sequence TCACATTGGCACCCGCAATCCTGC (SEQ ID NO: 5); step (b)(iv) comprises contacting said biological sample with a probe being a nucleic acid molecule consisting of the nucleic acid sequence TTCTTCGGAATGTCGCGCATTGGC (SEQ ID NO: 8); step (b)(v) comprises contacting said biological sample with a probe being a nucleic acid molecule consisting of the nucleic acid sequence TGGTTCCATGCTATACATGTCTCTGG (SEQ ID NO: 13) or
TGGTTCCATGCTATCTCTGGGACC (SEQ ID NO: 14); step (b)(vi) comprises contacting said biological sample with a probe being a nucleic acid molecule consisting of the nucleic acid sequence CTAGGTTTCAAACTTTACATAGAAGTT (SEQ ID NO: 15); step (b)(vii) comprises contacting said biological sample with a probe being a nucleic acid molecule consisting of the nucleic acid sequence TTTCATCTAAACGAACAAACAAACTAAAAT (SEQ ID NO: 20); step (b)(viii) comprises contacting said biological sample with a probe being a nucleic acid molecule consisting of the nucleic acid sequence TGGATGGAAAGTGGAGTTTATTCTAGT (SEQ ID NO: 21); and step (b)(ix) comprises contacting said biological sample with a probe being a nucleic acid molecule consisting of the nucleic acid sequence TTACTTGCTTTACATAATTCTTCTTCAGGT (SEQ ID NO: 35).
3. The method of claim 1 or 2, wherein said SARS-CoV-2 RNA molecule encodes a
SARS-CoV-2 nucleocapsid protein or a SARS-CoV-2 spike protein.
60
4. The method of claim 3, wherein said SARS-CoV-2 nucleocapsid protein is encoded by a nucleic acid sequence set forth in SEQ ID NO: 26.
5. The method of claim 3 or 4, wherein said SARS-CoV-2 spike protein is encoded by a nucleic acid sequence set forth in any one of: SEQ ID Nos: 27-30, and 36.
6. The method of any one of claims 1 to 5, wherein said SARS-CoV-2 RNA or a variant thereof comprises a nucleic acid sequence set forth in SEQ ID NO: 31.
7. The method of any one of claims 1 to 6, further comprising a step preceding step (a), said step comprises extracting RNA from said biological sample and performing a reverse transcription reaction using the extracted RNA as a template for producing said cDNA.
8. The method of any one of claims 1 to 7, wherein said biological sample is derived or obtained from an environment or a subject.
9. The method of claim 8, wherein said biological sample derived or obtained from an environment is derived or obtained from: sewage, a water source, or soil.
10. A kit for determining the presence of SARS-CoV-2 RNA molecule or a variant thereof in a biological sample, comprising at least one pair of primers capable of amplifying a cDNA molecule complementary to said SARS-CoV-2 RNA molecule, wherein said at least one pair of primers is selected from the group consisting of: i. a first primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 1, and a second primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 22; ii. a first primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 2, and a second primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 3; iii. a first primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 4, and a second primer being an
61 oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 23; iv. a first primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 6, and a second primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 7; v. a first primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 9, and a second primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 10; vi. a first primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 11, and a second primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 12; vii. a first primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 16, and a second primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 17; viii. a first primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 18, and a second primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 19; ix. a first primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 33, and a second primer being an oligonucleotide consisting of the nucleic acid sequence set forth in SEQ ID NO: 34; and x. any combination of (i) to (ix). The kit of claim 10, further comprising at least one probe molecule being a nucleic acid sequence capable of hybridizing to said cDNA molecule, wherein said at least
62 one probe consists of a nucleic acid sequence selected from the group consisting of: SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 5, SEQ IN NO: 8, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 35, and any combination thereof. The kit of claim 11, further comprising instructions for contacting said cDNA molecule complementary to said SARS-CoV-2 RNA molecule or said variant thereof with any one of: a. said first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 1, said second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 22, and said probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 24; b. said first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 2, said second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 3, and said probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 25; c. said first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 4, said second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 23, and said probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 5; d. said first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 6, said second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 7, and said probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 8; e. said first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 9, said second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 10, and said probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 13 or SQ ID NO: 14; f. said first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 11, said second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 12, and said probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 15; g. said first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 16, said second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 17, and said probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 20; h. said first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 18, said second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 19, and said probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 21; and i. said first primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 33 said second primer being an oligonucleotide consisting of a nucleic acid sequence set forth in SEQ ID NO: 34, and said probe consisting of a nucleic acid sequence set forth in SEQ ID NO: 35. The kit of any one of claims 10 to 12, wherein said SARS-CoV-2 RNA molecule comprises a nucleic acid sequence encoding SARS-CoV-2 nucleocapsid protein, spike protein, or both. The kit of claim 13, wherein said SARS-CoV-2 nucleocapsid protein is encoded by a nucleic acid sequence set forth in SEQ ID NO: 26. The kit of claim 13 or 14, wherein said SARS-CoV-2 spike protein is encoded by a nucleic acid sequence set forth in any one of: SEQ ID Nos: 27-30, and 36. The kit of any one of claims 10 to 15, wherein said SARS-CoV-2 RNA or a variant thereof comprises a nucleic acid sequence set forth in: SEQ ID NO: 31. The kit of any one of claims 10 to 16, further comprising instructions for any one of: extracting RNA from a biological sample being derived or obtained from an environment or a subject, reverse transcribing the extracted RNA to cDNA, and a combination thereof.
18. The kit of claim 17, wherein said biological sample being derived or obtained from an environment is derived or obtained from: sewage, a water source, or soil.
65
PCT/IL2021/051044 2020-08-25 2021-08-25 Oligonucleotides and methods of using same WO2022044011A1 (en)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US202063069777P 2020-08-25 2020-08-25
US63/069,777 2020-08-25
US202163150329P 2021-02-17 2021-02-17
US63/150,329 2021-02-17
US202163218324P 2021-07-04 2021-07-04
US63/218,324 2021-07-04

Publications (1)

Publication Number Publication Date
WO2022044011A1 true WO2022044011A1 (en) 2022-03-03

Family

ID=80354761

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2021/051044 WO2022044011A1 (en) 2020-08-25 2021-08-25 Oligonucleotides and methods of using same

Country Status (1)

Country Link
WO (1) WO2022044011A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114561496A (en) * 2022-04-28 2022-05-31 北京生物制品研究所有限责任公司 Primer and probe for identifying novel coronavirus Delta strain and application thereof
WO2022194756A3 (en) * 2021-03-15 2022-12-01 F. Hoffmann-La Roche Ag Compositions and methods for detecting severe acute respiratory syndrome coronavirus 2 (sars-cov-2) variants having spike protein mutations

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2720713C9 (en) * 2020-03-27 2020-05-18 Евгений Олегович Рубальский Set of synthetic oligonucleotides for detecting of coronavirus rna

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2720713C9 (en) * 2020-03-27 2020-05-18 Евгений Олегович Рубальский Set of synthetic oligonucleotides for detecting of coronavirus rna

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LI, D., ZHANG ET AL.: "Primer design for quantitative real-time PCR for the emerging Coronavirus SARS-CoV-2", THERANOSTICS, vol. 10, no. 16, 1 June 2022 (2022-06-01), pages 7150, XP055892463, DOI: 10.7150/thno.47649 *
PHELAN JODY, DEELDER WOUTER, WARD DANIEL, CAMPINO SUSANA, HIBBERD MARTIN L., CLARK TAANE G: "Controlling the SARS-CoV-2 outbreak, insights from large scale whole genome sequences generated across the world", BIORXIV, 26 May 2020 (2020-05-26), XP055909450, Retrieved from the Internet <URL:https://www.biorxiv.org/content/10.1101/2020.04.28.066977v3.full.pdf> DOI: 10.1101/2020.04.28.066977 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022194756A3 (en) * 2021-03-15 2022-12-01 F. Hoffmann-La Roche Ag Compositions and methods for detecting severe acute respiratory syndrome coronavirus 2 (sars-cov-2) variants having spike protein mutations
CN114561496A (en) * 2022-04-28 2022-05-31 北京生物制品研究所有限责任公司 Primer and probe for identifying novel coronavirus Delta strain and application thereof

Similar Documents

Publication Publication Date Title
Fraga et al. Real‐time PCR
EP2379753B1 (en) Single-cell nucleic acid analysis
Fraga et al. Real‐time PCR
WO2022044011A1 (en) Oligonucleotides and methods of using same
JP2013540436A (en) Method for detecting and / or quantifying human DNA
US20130084568A1 (en) Probe, and polymorphism detection method using the same
CN103534356A (en) Method for quantifying human dna using an internal control
JP2018528780A (en) Improved detection of short homopolymer repeats
JP2005518217A (en) Amplification of head loop DNA
US8222389B2 (en) Method for lowering both sequence variations and increase of base line effects in a diagnostic hybridisation assay, assay for performing such a method and probe for use in the assay
Lee et al. Detection of SARS-CoV-2 RNA through tandem isothermal gene amplification without reverse transcription
WO2008016334A1 (en) Multiplex analysis of nucleic acids
WO2009119331A1 (en) REAGENT COMPRISING PRIMER FOR DETECTION OF mRNA FOR CYTOKERATIN-7
EP1869218A2 (en) Nucleic acid detection
KR20060041664A (en) Norovirus detection reagent
US20230416824A1 (en) Systems for the detection of targeted gene variations and viral genomes and methods of producing and using same
US20190112636A1 (en) Methods and compositions for nucleic acid detection
US9315871B2 (en) Mutation detection probe, mutation detection method, method of evaluating drug efficacy, and mutation detection kit
JP2012503472A (en) Method for reducing the dependence of nucleic acid targets on sequence variations in diagnostic hybridization assays
CN110603328A (en) Quantitative PCR amplification primer pair and application thereof
CN110612355A (en) Composition for quantitative PCR amplification and application thereof
JP2005245434A (en) Detection reagent for norovirus
CN117448441A (en) Single nucleotide polymorphism isothermal typing method based on RNase HII enzyme dependency-locked nucleic acid-blocking probe-loop-mediated isothermal amplification
US10030263B1 (en) Multiplexed RNA qPCR assay
WO2023067110A1 (en) Methods and compositions for detection of mutant nucleic acid sequences

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21860756

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21860756

Country of ref document: EP

Kind code of ref document: A1