CN114507679A - Pinus massoniana terpenoid substance synthesis related enzyme gene PmDXR and application of promoter thereof - Google Patents

Abstract

The invention discloses a pinus massoniana terpenoid substance synthesis related enzyme gene PmDXR and application of a promoter thereof, belonging to the technical field of plant genetic engineering. According to the invention, the pinus massoniana PmDXR gene is transformed into arabidopsis thaliana by utilizing agrobacterium mediation, and the DXR enzyme activity, chlorophyll a, chlorophyll b and carotenoid content of the transgenic arabidopsis thaliana are higher than those of wild arabidopsis thaliana. And cloning a promoter of the PmDXR gene from the pinus massoniana, wherein the nucleotide sequence is shown as SEQ ID NO.1, the PmDXR gene promoter can drive GUS genes to express in roots, stems and leaves of the Nicotiana benthamiana by constructing a pBI121-ProDXR vector and infecting the Nicotiana benthamiana through a transient transformation method, and the promoter has no obvious tissue specificity. The invention has important research value and application prospect in improving the pine resin yield character by utilizing the genetic engineering technology.

Description

Pinus massoniana terpenoid substance synthesis related enzyme gene PmDXR and application of promoter thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a pinus massoniana terpenoid substance synthesis related enzyme gene PmDXR and application of a promoter thereof.

Background

Pinus massoniana (Pinus massoniana) belongs to Pinaceae (Pinaceae) Pinus of Pinus, has straight trunk and red brown bark, and is divided into irregular scaly blocks; flattening or obliquely flattening the branches; most of the needle leaves are bundled by 2 needles, and the needle leaves are bundled by 3 thin needles and 12-20cm long; the leaf sheath is initially brown and then gradually turns gray-black, where it is stored. The hydrangea is cylindrical and grows in the bract armpit at the lower part of the new branch; the female globeflower grows singly or 2-4 flowers gather near the top end of the new branch; the cones are oval or conical oval, and have color changed before and after maturation, green before maturation, and brown when maturation. The pinus massoniana is widely distributed in Chinese pine species, and is distributed in 17 provinces (autonomous regions, directly prefectured cities) from Qinling mountains, south of Huaihe river and east of Yunobu plateau, so that the pinus massoniana has the characteristics of strong adaptability, high economic value and the like. The economic value of the masson pine is not only reflected in the aspect of materials, but also brings great economic benefit to China in the aspect of forest product processing. Masson pine can secrete a large amount of secondary metabolites which are mainly terpenoids and are called turpentine, and the turpentine is a basic raw material of rosin and turpentine industries and is widely used in industrial biological products such as solvents, disinfectants, cleaning products, spices, coatings and the like.

The terpenoid components in masson pine resin mainly comprise monoterpenes, sesquiterpenes and diterpenes, and are generally found in roots, stems, leaves and cones of pine trees. The rosin not only can bring huge economic benefits, but also has important effect on the defense system of the conifer. After coniferous trees are subjected to biotic or abiotic irritation, rosin can be released from the resin tract of the tree, and new rosin can be induced to synthesize. At present, the main 6 kinds of pine trees in China can collect the turpentine, but only masson pine, slash pine (Pinus elliottii), Yunnan pine (Pinus yunnanensis) and Pinus sylvestris (Pinus kesiya var. langbianensis) are used for the conventional resin collection, wherein 90% of the turpentine is collected from the masson pine. The China's rosin production area is mainly Guangxi, and investigation shows that the masson pine rosin yield in the Guangxi production area in 2010 can account for about 42% of the national rosin yield, and the total yield is about 30 ten thousand tons. In order to promote the development of the rosin industry, the method for screening and cultivating excellent seed materials with high grease yield and constructing a high-grease-yield industrial raw material forest by adopting an advanced technology is an effective way for improving the resource utilization rate of the rosin forest.

1-Deoxy-D-xylulose 5-phosphate reductoisomerization (1-Deoxy-D-xylulose 5-phosphate reductase DXR) is a key rate-limiting enzyme in MEP pathway, catalyzing the 2 nd reaction of MEP pathway, which requires cofactors Nicotinamide Adenine Dinucleotide Phosphate (NADPH), Mn²⁺、Co²⁺Or Mg²⁺Involved in converting 1-deoxy-D-xylulose 5-phosphate synthase (DXP) into 2-methylerythritol 4-phosphate (MEP), an important precursor in terpene synthesis. The MEP pathway is localized in plastids and is mainly involved in the biosynthesis of monoterpenes, diterpenes and tetraterpenoids. The MEP pathway for the production of prenyl pyrophosphate (IPP) and dimethylpropenyl Diphosphate (DMAPP) is mainly divided into 7 steps: a first step of catalyzing pyruvate and 3-phospho-glyceraldehyde by 1-deoxy-D-xylulose 5-phosphate synthase (DXS) to produce DXP; secondly, DXP is catalyzed by 1-deoxy-D-xylulose-5-phosphate reductoisomerase (DXR) to generate reduction reaction to generate MEP; in the third step, MEP is catalyzed by 2-methyl-D-erythritol-4-cytidine phosphoryl transferase (MCT) to generate 4- (5' -cytidine pyrophosphate) -2-C-methyl-D-erythritol (CDP-ME) in the presence of NADPH; fourthly, generating 4- (5 '-cytidine pyrophosphate) -2-C-methyl-D-erythritol-2-phosphate (CDP-MEP) by the phosphorylation of the CDP-ME through 4- (5' -cytidine pyrophosphate) -2-C-methyl-D-erythritol kinase (CMK); fifthly, generating 2-methyl-D-erythritol-2, 4-cyclic pyrophosphate (MECPP) by CDP-MEP under the action of 2-methyl-D-erythritol-2, 4-cyclic pyrophosphate synthase (MDS); sixthly, the MECPP forms 1-hydroxy-2-methyl-2-E-butenyl-4-pyrophosphoric acid (HMBPP) under the action of 1-hydroxy-2-methyl-2-E-butenyl-4-pyrophosphoric acid synthase (HDS); finally, HMBPP is catalyzed by 1-hydroxy-2-methyl-2-E-butenyl-4-pyrophosphate reductase (HDR) to form a terpenoid synthesis precursor IPP. Therefore, the method improves the content of downstream target products through the expression of DXR gene of the pinus massoniana, and has important significance for the genetic engineering breeding of pinus massoniana high-yield lipid.

Disclosure of Invention

Aiming at the problems in the prior art, the invention aims to provide a pinus massoniana terpenoid substance synthesis related enzyme gene PmDXR and application of a promoter thereof.

In order to solve the technical problems, the technical scheme adopted by the invention is as follows:

an application of a promoter of masson pine terpenoid substance synthesis related enzyme gene PmDXR or masson pine terpenoid substance synthesis related enzyme gene PmDXR in masson pine high-yield genetic engineering breeding.

The pinus massoniana terpene substance synthesis related enzyme gene PmDXR has a nucleotide sequence shown in GenBank: MK 969119.1.

DXR is a key rate-limiting enzyme in MEP pathway, catalyzes the 2 nd reaction of MEP pathway, and is mainly involved in the biosynthesis of monoterpene, diterpene and tetraterpenoid compounds. The application synthesizes a key rate-limiting enzyme gene from terpenoids cloned from masson pine, and the key rate-limiting enzyme gene is named as PmDXR.

The upstream sequence 1600bp of the initiation codon ATG of the gene PmDXR is obtained by amplification by taking the masson pine genome DNA as a template, namely the promoter of the gene PmDXR of the masson pine terpene substance synthesis related enzyme, and the nucleotide sequence of the promoter is shown as SEQ ID NO. 1.

The use of the promoter of the masson pine terpene substance synthesis related enzyme gene PmDXR or the masson pine terpene substance synthesis related enzyme gene PmDXR in improving the content of plant photosynthetic pigments.

The use of the promoter of the masson pine terpene substance synthesis related enzyme gene PmDXR or the masson pine terpene substance synthesis related enzyme gene PmDXR in improving the activity of plant DXR enzyme.

Further, the plant is masson pine or arabidopsis thaliana.

The method comprises the steps of taking a model plant Arabidopsis thaliana as a receptor plant, successfully constructing a pCAMBIA1302-PmDXR overexpression vector, utilizing agrobacterium-mediated transformation to the Arabidopsis thaliana, culturing to obtain transgenic Arabidopsis thaliana, and then determining DXR enzyme activity and photosynthetic pigment content of the transgenic Arabidopsis thaliana.

The application of the promoter of the masson pine terpene substance synthesis related enzyme gene PmDXR in driving GUS gene to plant expression.

Further, the plant is masson pine or tobacco.

The promoter of a masson pine terpene substance synthesis related enzyme gene PmDXR is inserted into an expression vector pBI121 containing a GUS gene to replace the existing promoter in the expression vector to construct a pBI121-ProDXR vector, the tobacco is taken as an instant transformation object, the cloned pBI121-ProDXR vector is transferred into the tobacco by an instant transformation method and is cultured, and the PmDXR gene promoter can drive the GUS gene to express in roots, stems and leaves of the tobacco of the department.

Compared with the prior art, the invention has the beneficial effects that:

the invention takes model plants, namely, tobacco and arabidopsis thaliana as receptor plants, transforms a pinus massoniana PmDXR gene into arabidopsis thaliana by utilizing agrobacterium mediation, obtains transgenic arabidopsis thaliana by cultivation, wherein the activity of DXR enzyme, the content of chlorophyll a, the content of chlorophyll b and the content of carotenoid are all higher than those of wild type arabidopsis thaliana, and morphological observation shows that the transgenic and wild type arabidopsis thaliana which normally grow for 30 days have difference in growth of a bolt axis. And a pBI121-ProDXR vector is constructed, the Nicotiana benthamiana is infected by an instant transformation method, and GUS histochemical staining analysis is carried out. The result shows that the PmDXR gene promoter can drive GUS gene to express in the root, stem and leaf of Nicotiana benthamiana, and the promoter has no obvious tissue specificity. Has good practicability and good application prospect in plant breeding and stress resistance research.

Drawings

FIG. 1 is a tissue-specific expression profile of the PmDXR gene in Pinus massoniana; in the figure, R: a root; f: flower; and NS: young stems; and OS: old stems; NL: new leaves; ML: mature leaves; x: a xylem; p: a phloem;

FIG. 2 is a graph showing the expression of the PmDXR gene in different treated pinus massoniana seedlings; in the figure, (A) is mechanical injury treatment, (B) is 15% PEG6000 osmotic stress treatment, and (C) is 0mM H₂O₂Stress treatment, (D) 500. mu.M ETH treatment, (E) 1mM SA treatment; (F) treatment for 100. mu.M MeJA;

FIG. 3 is a diagram of the identification of transgenic Arabidopsis; in the figure, M is NormalRun^TM250bp-II DNA ladder; 1-14 are transgenic arabidopsis; 15 is wild type Arabidopsis thaliana; 16 is yangA sexual control pCAMBIA1302-PmDXR plasmid;

FIG. 4 is a diagram showing the measurement of relative expression of the PmDXR gene of transgenic Arabidopsis; in the figure, WT is a wild type Arabidopsis thaliana; R1-R12 is transgenic Arabidopsis;

FIG. 5 is a graph of a DXR enzyme activity assay; in the figure, WT is a wild type Arabidopsis thaliana; R1-R12 is transgenic Arabidopsis;

FIG. 6 is a graph of analysis of photosynthetic pigment content of transgenic plants and wild-type plants; in the figure, WT is a wild type Arabidopsis thaliana; R1-R12 is transgenic Arabidopsis;

FIG. 7 is a phenotypic observation of transgenic plants and wild type plants; in the figure, (A) is Arabidopsis rosette; (B) is the axis of the Arabidopsis thaliana; (C) drought-treated Arabidopsis; WT is wild type Arabidopsis thaliana, DXR is Arabidopsis thaliana overexpressing PmDXR; a is 20d of arabidopsis grown in soil before drought treatment, b is 15d of arabidopsis subjected to drought treatment, and c is 3 days of rehydration arabidopsis;

FIG. 8 is a diagram showing an amplification product of the PmDXR promoter; in the figure, M is DNAmarker, and PRO is PmDXR promoter;

FIG. 9 is an electrophoretic detection map of a recombinant plasmid;

FIG. 10 is a graph of GUS staining of different tissues;

FIG. 11 is a graph of a PmDXR promoter hormone stress response assay;

FIG. 12 is a subcellular localization map of the PmDXR protein; in the figure, A is a green fluorescence effect picture, B is a chloroplast autofluorescence effect picture, and C is a bright field effect picture; d is a superimposed field effect diagram.

Detailed Description

The invention is further described with reference to specific examples. All primer sequences described below are oriented 5 'to 3'.

Example 1 analysis of expression Pattern of Pinus massoniana PmDXR Gene (GenBank: MK969119.1)

Tissue-specific expression of PmDXR gene in masson pine

The expression of the PmDXR gene in different tissues (root, young stem, old stem, new leaf, mature leaf, flower, xylem and phloem) of pinus massoniana was analyzed by using the qRT-PCR technology (figure 1). Setting the expression level in the young stem as 1 shows that PmDXR is expressed in all tissues and has different expression in different tissues, and PmDXR is expressed most in xylem and has no significant difference with the expression level of PmDXR in mature leaves and roots and is significantly higher than the expression level of PmDXR in other tissues. In the whole view, xylem > root > mature leaf > new leaf > phloem > old stem > young stem > flower.

qRT-PCR reaction system (20. mu.l): 2. mu.l of cDNA; 10 μ l SYBR Green Master Mix; 0.4. mu.l qPmDXR-F; 0.4. mu.l qPmDXR-R; 7.2. mu.l ddH₂O。

The reaction procedure was as follows: 95 ℃; 2 min; 95 ℃; 10 sec; 55 ℃; 30 sec; 72 ℃; 30 sec; 40 cycles.

Second, expression of PmDXR gene in pinus massoniana seedlings treated differently

Respectively carrying out stress (mechanical injury, 15% PEG6000 osmotic stress and 10mM H) on two-year-old pinus massoniana seedlings₂O₂) And hormone treatment (500. mu.M ethh, 1mM salicylic acid SA and 100. mu.M methyl jasmonate MeJA) and sampling at different time periods. The qRT-PCR results under adversity stress (FIG. 2 (A) - (C)), showed that after the mechanical injury treatment, the expression level of the PmDXR gene was up-regulated to different degrees at other treatment times except 3h, and the expression level was the highest at 6h, which was 2.92 times that of the control group. In PEG6000 and H₂O₂After treatment, the expression level of the PmDXR gene decreased at each treatment time point. The qRT-PCR results under hormone induction treatment (fig. 2 (D) - (F)), showed that PmDXR was slightly up-regulated at 6h treatment after ETH treatment. After SA treatment, the expression level of PmDXR was up-regulated at 6h, and the expression level was decreased at the other treatment time points. After the MeJA treatment, the expression level of the PmDXR gene decreased at each treatment time point.

Example 2 construction of Pinus massoniana PmDXR Gene expression vector and transformation of Arabidopsis thaliana

First, construction of vector

Activating 1ml of Escherichia coli liquid containing pCAMBIAl302 carrier stored at-80 deg.C, taking 1-4ml of overnight cultured bacterial liquid, and extracting plasmid with plasmid miniextraction kit. Taking 1 μ g of the extracted pCAMBIA1302 plasmid, performing single enzyme digestion by using Nco I restriction enzyme, designing a recombinant primer according to the two-end sequence of the pCAMBIA1302 vector after single enzyme digestion and the ORF sequence of PmDXR, and performing PCR amplification.

The linking system is as follows: adding 0.02 times base log (ng) of cloning vector linearized vector; 0.04 × insert base number (ng); 4 μ l of 5 × CE II Buffer; 2. mu.l of Exnase II; addition of ddH₂O to 20. mu.l.

The reaction mixture was placed in a PCR apparatus at 37 ℃ for 30min and then immediately placed on ice.

The successfully constructed recombinant vector plasmid is transformed into agrobacterium-competent cells GV3101 by the following method:

(1) add 10. mu.l of recombinant plasmid into 100. mu.l of Agrobacterium infected strain in ice-water mixed state, mix gently with the bottom of the tube, place on ice, liquid nitrogen, 37 ℃ water bath, ice bath for 5min each.

(2) Adding 700 mul LB liquid culture medium, placing on a constant temperature shaking table at 28 ℃ for shaking culture for 2.5 h.

(3) Sucking about 100 μ L of supernatant, spreading on a container containing 50 mg/L^-1Kanamycin (Kan), 25 mg. L^-1Rifampicin (Rif) was inverted on LB plate and cultured in 28 ℃ incubator for 2 d.

(4) And selecting the monoclonal colony with good growth state for PCR detection, carrying out amplification culture on the monoclonal colony with positive detection, adding 50% glycerol with the same volume into the bacterial liquid, and storing at-80 ℃ for subsequent experiments.

Seeding and culturing of arabidopsis

(1) And (3) seed disinfection of arabidopsis thaliana: putting an appropriate amount of Arabidopsis seeds into a 1.5ml centrifuge tube, adding 1ml of 75% ethanol into the centrifuge tube, turning over for 45sec, washing with sterile water, adding 1ml of 20% sodium hypochlorite, turning over for 5min, and repeatedly washing with sterile water for 5-6 times.

(2) Sowing: the sterilized Arabidopsis seeds were dibbled on 1/2MS medium with a 1ml pipette and cultured.

(3) And (3) culturing Arabidopsis thaliana: sealing the culture medium after seeding the arabidopsis seeds, culturing for 2d under the dark condition at the temperature of 4 ℃, and then placing in an artificial climate incubator until the arabidopsis seeds germinate and grow. After about one week, the well-grown Arabidopsis seedlings in the medium were transferred to nutrient soil (black soil: vermiculite: perlite ═ 6: 2: 1) for continuous culture, covered with preservative film, and the preservative film was removed on the third day.

Thirdly, transforming arabidopsis thaliana by inflorescence dip dyeing method

(1) In a clean bench, the agrobacterium liquid containing pCAMBIAl302-PmDXR recombinant plasmid is streaked and cultured in a culture medium containing 50 mg.L^-1Kan and 25 mg.L^-1Rif on LB plate.

(2) Single colonies with good growth status were picked and 5ml of 50 mg. multidot.L solution was added^-1Kan and 25 mg.L^-1Rif LB liquid medium, 28 degrees C temperature shaker 200rpm culture overnight.

(3) Inoculating 1ml of overnight cultured bacterial liquid into 50ml of 50 mg/L bacteria^-1Kan and 25 mg.L^-1In LB liquid medium of Rif, shake-cultured to OD₆₀₀About 0.8.

(4) Pouring the bacterial liquid into a 50ml sterile centrifuge tube, centrifuging at 5000rpm for 10min to collect thalli, and adding 50ml of previously prepared permeation buffer solution to suspend thalli precipitate.

(5) Selecting an arabidopsis thaliana plant which grows for about 4 weeks and shoots, removing opened buds, soaking inflorescences in an infection solution for dip dyeing for 30sec, and covering a preservative film after the dip dyeing is finished.

(6) Dark culture for 18-20h, washing with clear water, and culturing in incubator.

(7) After 7-10 days, repeating the steps 1-6 for infection again.

(8) And (3) harvesting transgenic T0 generation seeds after the seed pods of the Arabidopsis plants turn yellow, and properly controlling the watering times when the seeds are about to mature in order to promote the seed maturation.

Fourth, resistance screening of transgenic Arabidopsis plants

(1) Taking a proper amount of harvested T0 generation seeds to a 1.5ml centrifuge tube, adding 1ml of 75% ethanol into the centrifuge tube, turning over for 45sec, washing with sterile water, adding 1ml of 20% sodium hypochlorite, turning over for 5min, and repeatedly washing with sterile water for 5-6 times.

(2) Seeds are evenly dibbled by a 1ml liquid-transfering gun to the seed with the content of 30 mg.L^-1Hygromycin (Hyg) in 1/2MS medium, dark culture at 4 ℃ for 2 days, and culturing in a climatic incubator.

(3) After 2 weeks of culture, 2 green true leaves growing in the culture medium and resistant seedlings with normal root growth are transplanted into nutrient soil, covered by a preservative film, and the preservative film is removed on the third day.

(4) After the seeds are matured, the single plant is separately harvested to obtain seeds of T1 generations, and the sowing and screening are continued until seeds of T2 generations are harvested for the subsequent example operation.

Fifth, molecule level detection of transgenic arabidopsis

By performing primary resistance screening on 1/2MS (containing Hyg) culture medium, none of the negative plants which are not successfully transformed can grow normally, and the positive transgenic plants can grow normally. And (3) transferring the normally growing arabidopsis seedlings into nutrient soil for continuous culture, and extracting genome DNA and RNA by taking the leaves as materials. Firstly, genome DNA of wild type and transgenic arabidopsis thaliana is taken as a template to carry out PCR amplification, and the arabidopsis thaliana successfully transferred into the PmDXR gene can amplify a band with the same size as a plasmid amplification product (figure 3); then, the transcription level of the transgenic line successfully identified at the gene level is identified (figure 4), and the result shows that the expression levels of different transgenic plants are different, and in 12 transgenic arabidopsis thaliana (the numbers are respectively named as R1-R12), the arabidopsis thaliana plant with the number of R8 has the highest expression quantity, and then R12 and R3 are used.

The specific implementation steps are as follows:

(1) fresh leaves of arabidopsis are cut, DNAsecure novel plant genome DNA extraction kit (TIANGEN) is used for extracting arabidopsis genome DNA, and the extraction steps are strictly carried out according to the instruction. The concentration and OD260/280 ratio of the extracted Arabidopsis gDNA were determined using a ultramicro spectrophotometer.

(2) And (3) carrying out PCR detection by taking the gDNA obtained in the first step as a template, 1302-CheckF as a front primer and 1302-PmDXR-R as a rear primer.

The primers have the following sequences:

1302-CheckF：ACAGTCTCAGAAGACCAAAGGGCA；

1302-PmDXR-R：ACTAGTCAGATCTACCATGGTCAGACTGTGGCAGGCTCCAAG。

PCR amplification reaction (50. mu.l): 2. mu.l of Arabidopsis gDNA; 25 mul 2 tea

Master Mix；2μl 1302-CheckF；2μl 1302-PmDXR-R；19μl ddH₂O。

Reaction procedure: 3min at 98 ℃; 15sec at 98 ℃, 15sec at 55 ℃, 1min at 72 ℃ and 35 cycles; 5min at 72 ℃; keeping at 4 ℃.

(3) Extracting total RNA of a positive plant detected by DNA level and carrying out reverse transcription to obtain cDNA, and detecting the relative expression quantity of the PmDXR gene in the transgenic arabidopsis thaliana by qRT-PCR, wherein the internal reference gene is Actin 2.

Taking a pinus massoniana seedling of a positive plant as a material, and extracting total RNA by using a polysaccharide polyphenol plant total RNA extraction kit (Tiangen Biochemical technology Co., Ltd.); when the 1% agarose gel electrophoresis picture of the total RNA of the masson pine shows that the band is clear, and the OD260/280 and the OD260/230 are between 1.8 and 2.1, the method can be used for gene cloning.

Using the extracted RNA as a template

The One-Step gDNA Removal and cDNA Synthesis SuperMix kit was used to synthesize the first strand cDNA according to the manual procedures.

qRT-PCR System and program set-up reference example 1.

Sixthly, determination of DXR enzyme activity and photosynthetic pigment content of transgenic arabidopsis thaliana

And (3) simultaneously culturing the arabidopsis seedlings with successful transgenosis and wild arabidopsis seedlings in an artificial climate incubator. The leaf of Arabidopsis thaliana was used as a material, and the DXR enzyme activity, chlorophyll a, chlorophyll b and carotenoid content of transgenic Arabidopsis thaliana were measured by Shanghai tripod Biotechnology Co., Ltd. The results of enzyme activity determination are shown in fig. 5, the DXR enzyme activities of the transgenic arabidopsis thaliana are all higher than that of the wild type arabidopsis thaliana, wherein the DXR enzyme activities of R5, R11 and R12 are significantly higher than that of the wild type arabidopsis thaliana. The enzyme activity of R5 was highest, which was 1.7 times that of the wild type, and the DXR enzyme activities of R11 and R12 were about 1.5 times that of the wild type. These results indicate that the enzymatic activity of DXR was enhanced by transforming Arabidopsis thaliana with the PmDXR gene. The results of photosynthetic pigment content determination are shown in FIG. 6, and the contents of chlorophyll a, chlorophyll b and carotenoid in transgenic Arabidopsis are all improved compared with wild type. The chlorophyll a content of the transgenic arabidopsis thaliana is 1.1-1.7 times that of the wild type, wherein the chlorophyll a contents of R1, R6, R7, R8 and R12 are obviously higher than that of the wild type, the chlorophyll a content of R12 is the highest and is 1.7 times that of the wild type, and the chlorophyll a content of R7 is next 1.4 times that of the wild type. The chlorophyll b content of the transgenic arabidopsis thaliana is 1.3-2.0 times of that of a wild type, except R5 and R11, the chlorophyll b content of other transgenic plants is obviously or extremely obviously higher than that of the wild type, and the chlorophyll b content of R4 is the highest. The carotenoid content of all the transgenic arabidopsis thaliana is remarkably or extremely remarkably higher than that of the wild type, the carotenoid content of the transgenic arabidopsis thaliana is 1.2-1.4 times that of the wild type, and the carotenoid content of R1 is the highest and reaches 210.4 pg/ml.

Seventh, phenotypic Observation of transgenic Arabidopsis

Transgenic Arabidopsis thaliana and wild type Arabidopsis thaliana were cultured under the same culture conditions, and after growing normally for 30d, differences in rosette and bolting axis growth were observed (FIG. 7). The phenotype observation does not find that the rosette growth of the arabidopsis with over-expression of PmDXR and the wild type arabidopsis has obvious difference, but the growth of the rachis has difference, and the rachis of the transgenic arabidopsis is obviously lower than that of the wild type arabidopsis. After the arabidopsis thaliana is subjected to drought treatment for 15d, the growth condition of the transgenic arabidopsis thaliana is better than that of the wild type arabidopsis thaliana when the water is deficient for 15d, and after the transgenic arabidopsis thaliana and the wild type arabidopsis thaliana are rehydrated for 3d, the transgenic arabidopsis thaliana and the wild type arabidopsis thaliana can be gradually recovered.

Example 3 cloning and transient expression of the PmDXR promoter fragment of Pinus massoniana in tobacco

Extraction of Pinus massoniana gDNA

The DNAsecure novel plant genome DNA extraction kit (TIANGEN) is used for extracting the genome DNA of the pinus massoniana seedling, and the specific operation steps are carried out strictly according to the instruction. After extraction, the concentration of the Pinus massoniana gDNA and the OD260/280 ratio were measured with a ultramicro spectrophotometer.

Second, PmDXR gene promoter primer design

3 specific downstream primers pPmDXR-SP1, pPmDXR-SP2 and pPmDXR-SP3 with higher annealing temperature are designed according to the PmDXR gene sequence, wherein pPmDXR-SP2 is positioned at the inner side of pPmDXR-SP1, and pPmDXR-SP3 is positioned at the inner side of pPmDXR-SP 2. Specific primers pPmDXR-F and pPmDXR-R are designed according to the flanking sequences obtained by the sequencing result.

The primer sequences are as follows:

pPmDXR-SP1：GTGAAGATGGCAGAGTCGCAGGAA；

pPmDXR-SP2：GCGAGTGTAGGGTGGAGGCTTATT；

pPmDXR-SP3：GGGCGGAGGATAAGACAAAGAAGA；

pPmDXR-F：TGGTAATGCAATGAAGTTGGGAGG；

pPmDXR-R：GGGGTGGAAAGGGGCGGAGGATAA。

3 PCR amplification rounds are carried out according to Genome Walking kit instructions, and specific PCR reaction systems and program settings are as follows:

(1) first round PCR reaction solution (50. mu.l) was prepared as follows: 4. mu.l of gDNA; 8 μ l dNTP mix (2.5mM each); 5 μ l10 × LA PCR Buffer II (Mg)²⁺plus)；0.5μl LA Taq；1μl AP1 Primer；1μl SP1 Primer；30.5μl ddH₂O。

(2) The first round of PCR reaction conditions were as follows: 1min at 94 ℃; 1min at 98 ℃; 30sec at 94 ℃, 1min at 64 ℃ and 2min at 72 ℃ for 5 cycles; 94 ℃ for 30sec, 25 ℃ for 3min and 72 ℃ for 2 min; 30sec at 94 ℃, 1min at 64 ℃, 2min at 72 ℃, 30sec at 94 ℃, 1min at 44 ℃ and 2min at 72 ℃ for 15 cycles; 10min at 72 ℃.

(3) A second round of PCR reaction (50. mu.l) was prepared as follows: 1 mul of the first round PCR reaction solution; 8 μ l dNTP mix (2.5mM each); 5 μ l10 × LA PCR Buffer II (Mg)²⁺plus)；0.5μl LA Taq；1μl AP1 Primer；1μl SP2 Primer；33.5μl ddH₂O。

(4) The second round of PCR reaction conditions were as follows: 30sec at 94 ℃, 1min at 64 ℃, 2min at 72 ℃, 30sec at 94 ℃, 1min at 44 ℃ and 2min at 72 ℃ for 15 cycles; 10min at 72 ℃.

(5) A third PCR reaction (50. mu.l) was prepared as follows: mu.l of second round PCR reaction solution; 8 μ l dNTP mix (2.5mM each))；5μl 10×LA PCR Buffer II(Mg²⁺plus)；0.5μl LA Taq；1μl AP1 Primer；1μl SP3 Primer；33.5μl ddH₂O。

(6) The third round of PCR reaction conditions were as follows: 30sec at 94 ℃, 641min, 2min at 72 ℃, 30sec at 94 ℃, 1min at 64 ℃, 2min at 72 ℃, 30sec at 94 ℃, 1min at 44 ℃ and 2min at 72 ℃ for 15 cycles; 10min at 72 ℃.

(7) The PCR products are detected by gel electrophoresis, the target bands are recovered by cutting gel, the connection transformation and the positive detection refer to the operation process of the embodiment, and the bacteria liquid with positive bacteria detection is sent to Beijing Optimalaceae Biotech Limited for sequencing.

Third, verification of the sequence of the PmDXR promoter of Pinus massoniana

PCR amplification A PCR reaction (50. mu.l) to verify the full length of the promoter was as follows: 2. mu.l of gDNA; 25 mul 2 tea

Master Mix；2μl pPmDXR-F；2μl pPmDXR-R；19μl ddH₂O。

The PCR program was set up as follows: 3min at 98 ℃; 35 cycles of 98 ℃ for 15sec, 55 ℃ for 15sec, and 72 ℃ for 1 min; 5min at 72 ℃; keeping at 4 ℃.

The 1.2% agarose gel electrophoresis of the amplified product of the promoter of the PmDXR gene is shown in figure 8, and the detected nucleotide sequence is shown as SEQ ID NO. 1.

Construction of pBI121-ProDXR recombinant vector

Using pBI121-ProDXR-F and pBI121-ProDXR-R (ProDXR refers to promoter of PmDXR gene) as primer to make amplification to obtain PmDXR promoter fragment whose two ends have enzyme cutting sites, using Hind III and Xba I restriction enzymes to double-enzyme cut pBI121 plasmid, after the enzyme cut product is connected with inserted fragment, converting Escherichia coli competent cell Treliff^TM5d, PCR detection of monoclonal colonies (FIG. 9). And then sequencing and verifying the bacteria liquid with positive detection, wherein the sequencing result shows that the pBI121-ProDXR vector is successfully constructed.

The primer sequences are as follows:

pBI121-ProDXR-F：GACCATGATTACGCCAAGCTTTGGTAATGCAATGAAGTTGGGA；

pBI121-ProDXR-R：ACCACCCGGGGATCCTCTAGAGGGGTGGAAAGGGGCGGA。

the plasmid digestion reaction system (50. mu.l) was as follows: 1 μ g of pBI121 plasmid; 5. mu.l of 10 XQuickCut Buffer; 1 μ l Hind III; 1 μ l Xba I; addition of ddH₂O to 50. mu.l.

Five, agrobacterium mediation method for instantaneously transforming tobacco

And (3) transforming the pBI121-ProDXR recombinant plasmid successfully constructed into an agrobacterium-infected competent cell EHAl05, and selecting a single colony for carrying out PCR identification on the bacterial liquid. Amplifying and culturing the monoclonal colony with positive detection to OD₆₀₀After about 0.8, the Nicotiana benthamiana is transformed, and the specific method is as follows:

(1) centrifuging at 5000rpm for 10min to collect thallus, adding 50ml of instantaneous conversion suspension to suspend thallus precipitate, and standing in dark for 3 hr.

(2) Preparing strong leaves of the tissue culture seedling of the Nicotiana benthamiana into leaf disks, cutting roots and stems of the Nicotiana benthamiana into small segments, and placing the prepared leaves, stems and roots in sterile water for later use in order to avoid water loss and wilting.

(3) And (3) sucking water on sterile filter paper, placing the prepared tobacco leaves, roots and stems in a heavy suspension, slightly shaking for about 10min, taking out the tobacco leaves, roots and stems with tweezers, sucking the tobacco leaves, roots and stems with the sterile filter paper, placing the infected tobacco leaves, roots and stems on a tobacco co-culture medium, and culturing for 24h under a dark condition.

Six, different hormone treatment tobacco leaf

After dark culture for 24 hours, tobacco leaves were transferred to a culture medium containing 100. mu. mol. L of each leaf^-1MeJA and 100. mu. mol. L^-1ABA、1mmol·L^-1Culturing GA on MS medium for 36h, and placing in MS medium₀Leaves on the medium served as control.

Hepta, beta-Glucuronidase (GUS) histochemical staining

Respectively putting leaves, roots and stems of Nicotiana benthamiana into a 5ml centrifuge tube, adding a proper amount of GUS staining solution, wherein the added GUS staining solution does not cover experimental materials, carrying out dark staining for 16h at 37 ℃, pouring off the staining solution, adding 70% ethanol for decolorization, changing the ethanol once every 3h, observing the staining condition of the tobacco under a stereoscopic microscope after the decolorization is finished, and taking a picture for recording. GUS histochemical staining analysis results show that the GV3101 empty strain negative control has no GUS blue signal, the GUS staining color of the root, stem and leaf of the pBI121 instantaneously transformed tobacco is deepest, and the root, stem and leaf of the pBI121-ProDXR instantaneously transformed tobacco are blue after GUS staining, but the staining color is lighter than that of the positive control pBI 121. Therefore, the proPmDXR can drive the GUS gene to express in the root, stem and leaf of tobacco.

The co-cultured tobacco leaves for 24 hours were transferred to a medium containing 100. mu. mol. L of each leaf^-1MeJA、100μmol·L^-1ABA、1mmol·L^-1And treating the GA in an MS culture medium for 36 hours, observing a dyeing result after GUS (glucuronidase) dyeing, and analyzing the influence of different hormones on the PmDXR promoter. The results show (FIG. 11) that after ABA and MeJA treatment, the ProDXR-driven GUS staining effect is stronger than that of the control, the color is darker than that of the untreated tobacco leaves, and the GUS staining effect after GA treatment is slightly weaker than that of the untreated tobacco leaves.

Example 4 subcellular localization of Pinus massoniana PmDXR protein

The pBI121-GFP vector contains a green fluorescent protein gene which can be used as a marker gene to be connected with a target gene for expression. Recombinant primers were designed based on the pBI121-GFP vector sequence and the ORF sequence of the PmDXR gene (deletion of the stop codon). The PmDXR-GFP is transformed into the lamina of the Nicotiana benthamiana by using a transient transformation method, dark culture is carried out in an artificial climate incubator for 2d, and the expression position of the fluorescent GFP in the cells is detected by using a laser confocal microscope. The results showed that the empty pBI121-GFP vector was localized in the whole tobacco leaf epidermal cells and that PmDXR-GFP was localized in the chloroplasts of tobacco leaf epidermal cells (FIG. 12).

The specific operation is as follows:

(1) in the content of 50 mg.L^-1Kan and 25 mg.L^-1Rif LB plate streaking culture containing PmDXR-GFP recombinant plasmid Agrobacterium.

(2) Single colonies with good growth status were picked up in 20ml containing 50 mg.L^-1Kan and 25 mg.L^-1In LB liquid medium of Rif, shake-cultured to OD₆₀₀About 0.8 (while culturing the strain P19).

(3) The bacterial solution was transferred to a 50ml sterile centrifuge tube and centrifuged at 5000rpm for 10min at 4 ℃ in a high speed refrigerated centrifuge to collect the bacterial cells.

(4) Adding the instantaneous transformation resuspension with the same volume as the bacterial liquid into a centrifuge tube, mixing uniformly by vortex, mixing with the P19 resuspension with the same volume, and standing at room temperature in a dark place for 3 h.

(5) The resuspension solution was injected into Nicotiana benthamiana leaves with a disposable syringe and incubated in the dark at room temperature for 48 h.

(6) Transient expression of GFP fusion protein in epidermal cells of Nicotiana benthamiana leaves was observed by confocal laser microscopy LSM 710.

Sequence listing

<110> Nanjing university of forestry

<120> pinus massoniana terpenoid synthesis related enzyme gene PmDXR and application of promoter thereof

<130> 1

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1600

<212> DNA

<213> PmDXR Gene promoter (Artificial)

<400> 1

tggtaatgca atgaagttgg gagggggagg tcacgggttc gacctgccct ccgcccatcc 60

cttaatacat ttttccgccc attgaatttt ccattcaatt atttacatat atggggattt 120

ggatatagtt caatgccttt ggatttacta tggaattata tatatttcta aaaaatacaa 180

tttccacata atattcatca tgaacccata attccacctt ggaggacatt gggcaatttc 240

accttcacac agccaaattg gcaaatccta aagtgacact tgtcacaacc ttattggaaa 300

atactaaaga agattcccat catgctcact gtactgccat gtcatcattc tgtcctgttt 360

agaaaaacga acaacaggca ttttctcctt catccaaact cggtttttag tgaaacgaat 420

tgcattgtga tcgtcttgac gagacagaca cagtcgtaca tgtttcgagc caatacaaga 480

actttgattt tttgatgccc taaatttctc aacataacgc acccattccc aaagcacaaa 540

tgccaatggt caaaacccat taaaactaaa agtaatggaa tgctgcatat agtctatgcc 600

aaaatttttg gattaagcat gatccacttt aatagatgga atatcttctg cctgaaccac 660

aatgaagacc gactctaaga gatctttaag agtaagatgt gagagccatg ggtgtagggc 720

atccttaaag gatctagact gagaggaaga gggcacaccc cagcctttgg ctccatcgtt 780

taatcttgaa attaaaaagc ttgaagcatc cttggttatg ccataatcat cgagcaaatt 840

tctttcttga agctacctac cactgtgaag gagttgcata aacatggagg ggattcccat 900

ccgatcttga attctagcta cgagtgaaga gaccatgtta gcgaatttca cctaaatata 960

taaaataccc cctgagattg gtctcacaaa gaccaaaatg ttcaagaggt ttctgtcctc 1020

agcttgaatg catgaagaac cctatgacaa aagaagttcc ccttgatttc aatgatctac 1080

aacaattaca ccaagatgag ggggattcaa acaaaatgtc gagtcttgaa gcaaaaaatc 1140

ttccacaaac agggtggcag tggctcaagg cattagggtt tccatcgcga taactaaaaa 1200

cttcgattta atttttcata tttttattta tgaaaactac tcttaaaata aatctcaatt 1260

ctttatttct aataattatt aaaaatattt tgaaattatt aaattattaa aatattcggt 1320

tgcctggctc tctaggcaag gccccctcaa acgcacttta ctattatcaa gtcaacatca 1380

ttatcgagtc aacaccatta gttagttata tgtatagaag tgacacatgt acaacgggac 1440

atgaaaatta ttgacacagt ggaaatgggt agccgtggga aagatacccc tgtattttgg 1500

agtttagcgg aggaacgcaa atggcattcc gcatggtgtc caattccact actacattgc 1560

ttgattcttc tttgtcttat cctccgcccc tttccacccc 1600

<210> 2

<211> 24

<212> DNA

<213> 1302-CheckF(Artificial)

<400> 2

acagtctcag aagaccaaag ggca 24

<210> 3

<211> 42

<212> DNA

<213> 1302-PmDXR-R(Artificial)

<400> 3

actagtcaga tctaccatgg tcagactgtg gcaggctcca ag 42

<210> 4

<211> 24

<212> DNA

<213> pPmDXR-SP1(Artificial)

<400> 4

gtgaagatgg cagagtcgca ggaa 24

<210> 5

<211> 24

<212> DNA

<213> pPmDXR-SP2(Artificial)

<400> 5

gcgagtgtag ggtggaggct tatt 24

<210> 6

<211> 24

<212> DNA

<213> pPmDXR-SP3(Artificial)

<400> 6

gggcggagga taagacaaag aaga 24

<210> 7

<211> 24

<212> DNA

<213> pPmDXR-F(Artificial)

<400> 7

tggtaatgca atgaagttgg gagg 24

<210> 8

<211> 24

<212> DNA

<213> pPmDXR-R(Artificial)

<400> 8

ggggtggaaa ggggcggagg ataa 24

<210> 9

<211> 43

<212> DNA

<213> pBI121-ProDXR-F(Artificial)

<400> 9

gaccatgatt acgccaagct ttggtaatgc aatgaagttg gga 43

<210> 10

<211> 39

<212> DNA

<213> pBI121-ProDXR-R(Artificial)

<400> 10

accacccggg gatcctctag aggggtggaa aggggcgga 39

Claims (10)

1. An application of masson pine terpenoid substance synthesis related enzyme gene PmDXR in masson pine high-lipid-production gene engineering breeding.

2. An application of masson pine terpenoid substance synthesis related enzyme gene PmDXR in improving plant photosynthetic pigment content is provided.

3. An application of a pinus massoniana terpenoid substance synthesis related enzyme gene PmDXR in improving the activity of plant DXR enzyme.

4. Use according to any one of claims 1 to 3, wherein the plant is Pinus massoniana or Arabidopsis thaliana.

5. The application of the promoter of pinus massoniana terpene substance synthesis related enzyme gene PmDXR with the nucleotide sequence shown as SEQ ID NO.1 in pinus massoniana high-yield genetic engineering breeding.

6. The application of the promoter of masson pine terpene substance synthesis related enzyme gene PmDXR with the nucleotide sequence shown as SEQ D NO.1 in improving the content of plant photosynthetic pigments.

7. The application of the promoter of masson pine terpene substance synthesis related enzyme gene PmDXR with the nucleotide sequence shown as SEQ ID NO.1 in improving the activity of plant DXR enzyme.

8. Use as claimed in any one of claims 5 to 7 wherein the plant is Pinus massoniana or Arabidopsis thaliana.

9. The application of the promoter of the masson pine terpene substance synthesis related enzyme gene PmDXR in driving GUS gene to plant expression.

10. Use according to claim 9, wherein the plant is masson pine or tobacco.

Images