CN105039344A - DXR promoter for lily flower part peculiarities and wound inductions and application of DXR promoter - Google Patents

Abstract

The invention belongs to the technical field of gene engineering and particularly discloses a DXR promoter for lily flower part peculiarities and wound inductions and application of the DXR promoter. The nucleotide sequence of the promoter is shown in SEQ ID NO:2. The target gene regulated by the DXR promoter is only expressed in the flower tissue in transgenic tobacco, and the expression of the target gene is related to the flower development process and is induced by damage and jasmonic acid methyl ester. In addition, the DXR promoter can be connected to any plant transformation carrier and guided into lilies or other plant cells, the transgene flowery flavor containing the promoter and resistance can be obtained, and therefore the promoter can be used for production. Peculiar molecular markers can also be generated according to promoter sequence information, used for identifying lilies or other plant flowery flavors and resistance gene types and used for molecular marker auxiliary selective breeding, and therefore the selecting efficiency of breeding is improved.

Description

The DXR promotor of the special and wound induced in a kind of flower of Greenish Lily portion and application thereof

Technical field

The present invention relates to gene engineering technology field, particularly, relate to DXR promotor and the application thereof of the special and wound induced in a kind of flower of Greenish Lily portion.

Background technology

Promotor is positioned at structure gene 5 ' hold one section of energy identification of upstream and activate RNA polymerase, makes it to be combined exactly with template DNA, guarantee to transcribe accurately and effectively initial DNA sequence dna.It is the center of plant gene transcription regulation and control, is the key understanding gene transcription regulation mechanism and expression pattern.

Transcriptional profile according to promotor can be divided into: constitutive promoter, tissue or organ specific promoters and inducible promoter.Wherein, tissue specific promoter is also called organ-specific promoter, comprises fruit differential promotor, root-specific promoter, leaf specific promoter and floral organ specific promoter etc.Under the regulation and control of this kind of promotor, the expression of gene is often only limited to some specific organ or tissue position, and often shows the characteristic of developmental regulation.

Floral specific promoter can make goal gene specific expressed in spending, effectively can control goal gene specifically expressing and closely related with flower development process in spending, in addition, the synergy of the controlling elements such as many induction types can be also subject to during floral organ gene action.Petunia cHScontrolling element find one of them G-box, being the binding domain of associated transcription factor, is light, anoxybiosis and ABA response element, light and ultraviolet induction regulation and control, with flower specifically expressing relevant (Hong Yahui etc., 2003).After plant is subject to the physical abuse that artificial wound or insect cause, can produce some small-molecule substances and polysaccharide, they are as the expression of semiochemicals induction series of defence gene.Potato lesioned gene protease inhibitor gene Pin II promotor hinders the proximal end region of induced regions in promotor,-700 ~-195 sections and-90CaMV35S promotor are merged, find that chimeric promoters has the activity of wound induction, that therefore thinks that this section controls this gene hinders abduction delivering.

Floral organ specific promoter not only containing outside necessary conservative property cis element, also contains the characteristic sequences of some organizing specific types and inducible promoter.And this tissue specificity is usually based on specific tissue cellularity and chemical physics signal, by existing in this kind of promotor simultaneously, the kind of element of several control tissue specific expression, number and relative position etc. are common to be determined.

At present mainly constitutive promoter is adopted to the selection of promotor in transgenic technology, under the control of composition type expression promoter, foreign gene all can be expressed at all sites of transgenic plant and different etap, and continue, express efficiently, there is no Space-time speciality, cause the loss of energy, affect the surviving rate of positive plant, cause plant physiology and aberrant morphogenesis to change, thus the normal growth affecting plant is grown.Because organizing specific and inducible promoter can regulate and control the expression of downstream gene effectively, reduce the injury because the accumulation of foreign protein in transgenic plants causes himself to greatest extent.Pellegrineschi stress induced promoter rd29A drives the expression of DREB1A/CBF3, improves the patience of transgenic wheat to drought stress, and does not cause obvious deformity.

Flower, as the important reproductive organ of plant, plays an important role utilizing plant hybrid advantage manual creation sterile line, in the genetically engineered research such as function of studying some genes particularly transcription factor with the Expression element of floral organ.Wherein anther specific expression promoter and pollen promotor serve very important effect.Utilize anther tapetum specific promoter tA29, A9deng structure male sterility gene, create male infertility plant and succeed at tobacco, rape etc.Chang little Li (2009) is by special for the colored portion be cloned into from lily cHSgene promoter proceeds in Arabidopis thaliana and finds, has specific expressed at the inflorescence position of transformed plant.Lewinsohn etc. (2001) adopt e8promotor, fans fairy maiden lISgene into Tomato, mellow fruit synthesizes and discharges the obvious S-phantol of fragrance and 8-hydroxyl phantol.Davidovich etc. (2007) adopt pGpromotor, lemon sieve alkene Geraniol synthetic enzyme (GES) gene is proceeded to tomato, and this gene overexpression in Transgenic tomato fruit causes the accumulation volume of Geraniol to increase, and successfully changes tamato fruit local flavor.In tobacco, import 3 lemon monoterpene synthase genes, under the regulation and control of constitutive promoter 35S, successful change of the content (El-Tameretal, 2003) of terpenoid; The AGPL1 promotor of watermelon and the fusion expression vector of sweet protein gene Brazzein are proceeded to tomato, by the regulation and control of AGPL1 fruit differential promotor, tamato fruit sweet taste quality (Yin Tao etc., 2009) is improve under the prerequisite not changing other proterties of fruit.

Along with the development of plant gene engineering technology, organizing specific and inducible promoter can be used for manual control target gene accurate expression under the specific developmental stage of plant, particular tissues organ and relevant adverse environmental factor, Crop Improvement resistance, improve flowers the local flavor viewed and admired shape, improve fruit and vegetables etc. in there is important application prospect.

Summary of the invention

Object of the present invention, in order to overcome the defect of the rarely seen report of research that is special to flower of Greenish Lily portion and wound induced promotor in prior art, provides the DXR promotor of the special and wound induced in a kind of flower of Greenish Lily portion.

Another object of the present invention is to provide a kind of flower of Greenish Lily portion DXR promotor that is special and wound induced changes the new variety of plant of the flower portion characteristic trait such as pattern, the fragrance of a flower and fertility and raising resistance application in cultivation.

The present invention is achieved above-mentioned purpose by the following technical programs:

A DXR promotor for the special and wound induced in flower of Greenish Lily portion, its nucleotide sequence is as shown in SEQIDNO:2.This promotor total length is 1015bp, and section length is respectively 534bp, 767bp and 969bp.DXR promotor gives flower of Greenish Lily floral base because DXR flower portion is special and wound induced expression characteristic.After DXR promoter sequence of the present invention and gus gene amalgamation and expression transformation of tobacco, target gene only spends tissue expression tobacco, and its expression is relevant with flower development process, and expresses in blade and be hurt and methyl jasmonate induction.

Through software analysis obtain described DXR promotor contain 3 the 5 ' end object fragment p-534 of series of deletions, p-767 and p-969, p-534, p-767 and p-969 sequence as shown in SEQIDNO:3 ~ 5.

A kind of recombinant vectors, described recombinant vectors is insert DXR promoter sequence (SEQIDNO:2) described above in the multiple clone site of the carrier that sets out.The described carrier that sets out can be all types of plant expression vectors often used in the art, and preferably, the present invention's plant expression vector used is pCAMBIA1300G plant expression vector.

A kind of recombinant vectors, described recombinant vectors is object fragment p-534, p-767 and the p-969 sequence of inserting 5 ' end series of deletions of DXR promotor described above in the multiple clone site of the carrier that sets out.The described carrier that sets out can be all types of plant expression vectors often used in the art, and preferably, the present invention's plant expression vector used is pCAMBIA1300G plant expression vector.

A kind of recombinant bacterium comprising recombinant vectors described above.A kind of clone comprising recombinant vectors described above.

DXR promotor is cultivating the application of the transgenic plant new variety changing the flower portion characteristic trait such as pattern, the fragrance of a flower and fertility.

Cultivate a method for the transgenosis fragrance of a flower or resistance plant, concrete steps are: will import containing recombinant vectors as above the vegetable cell that sets out, thus obtain the transgenosis fragrance of a flower or resistance plant that DXR promotor starts destination gene expression.

Preferably, described goal gene is gus gene.

The present invention comprises equally and the promoter fragment of three kinds of length is connected as dominant structural moieties the mosaic gene that upper suitable objective function gene formed effectively, and in genome, comprise the plant of this promoter fragment and the seed of this kind of plant.

According to promoter DNA sequence information provided by the invention, those skilled in the art can easily obtain equivalent promoter DNA sequence by the following method: (1) is obtained by database retrieval; (2) take promoter dna fragment as the genomic library acquisition that probe screens flower of Greenish Lily or other plant; (3) according to promoter DNA sequence information design oligonucleotides primer, obtain from the genome of flower of Greenish Lily or other plant by the method for pcr amplification; (4) obtain with gene engineering method transformation on the basis of promoter DNA sequence; (5) obtain by the method for chemosynthesis.

Promoter DNA sequence provided by the invention has important using value.One of application is that described promoter DNA sequence is connected to any one plant conversion carrier, with any one method for transformation, promoter DNA sequence is imported vegetable cell, can obtain and express the special and wound induced expression characteristic in described colored portion, thus be applied to production.Promoter DNA sequence construct of the present invention, in plant conversion carrier, can regulate and control the downstream gene of amalgamation and expression, thus strengthens the plant generation fragrance of a flower and strengthen the abilities such as resistance.

The Another application of promoter DNA sequence provided by the invention produces specific molecule marker according to described gene sequence information, includes but not limited to SNP(mononucleotide polymorphic), SSR(simple sequence repeats is polymorphic), RFLP(restriction enzyme length is polymorphic), that CAP(cuts amplified fragments is polymorphic).The fragrance of a flower genotype of flower of Greenish Lily or other plant can be identified with these marks, for molecular marker assisted selection breeding, thus improve the efficiency of selection of breeding.

Compared with prior art, the present invention has following beneficial effect:

The DXR promoter DNA sequence of clone is combined with control pattern, the fragrance of a flower and resistance objective function gene by the present invention, contribute to producing new pattern, the fragrance of a flower and resistance plant, and the chain problem that can not produce with bad gene in the genome occurred in traditional breeding technology, and breeding time can be shortened.In addition, the present invention can provide or apply new pattern that above-mentioned DXR promoter dna fragment obtains, the transfer-gen plant of the fragrance of a flower and resistance and corresponding seed further, and the plant transformed with recombinant chou of the present invention or the seed obtained by this kind of plant.By the mode of sexual hybridization, promotor of the present invention can be proceeded to other plant.

figure of description

The transgene tobacco GUS of Fig. 1 .DXR promotor and GUS amalgamation and expression is at different tissues expression specificity; A: different tissues GUS staining conditions; B: different tissues GUS enzyme activity determination.

The transgene tobacco GUS of Fig. 2 .DXR promotor and GUS amalgamation and expression is in the expression of floral organ different development stage; A: different development stage GUS staining conditions, wherein illustrating 1 is unopened bud; 2 is the petal of half-open position; 3 is the petal under state in full bloom; 4 petals that are the phase of withering; B: different development stage GUS enzyme activity situation.

Fig. 3. transgene tobacco GUS methyl jasmonate treatment in petal of different lengths fragment DXR promotor and GUS amalgamation and expression, the expression after injury process; A: GUS staining conditions in petal after different treatment; B: GUS enzyme activity situation in petal after different treatment; Diagram 1 is untreated petal, and 2 is the petal of methyl jasmonate treatment, and 3 is the petal that injury processes.

Transgene tobacco GUS methyl jasmonate in blade of Fig. 4 .DXR promotor and GUS amalgamation and expression, the abduction delivering of injury; A: after different treatment, turns GUS staining conditions in the blade of DXR different fragments; B: GUS enzyme activity situation in different treatment rear blade.

Fig. 5. the PCR of the transgenic tobacco plant of different lengths fragment DXR promotor and GUS amalgamation and expression detects and schemes; A:P-534 transfer-gen plant PCR detects (diagram 1 is positive control, and 2 is negative control); B:P-767 transfer-gen plant PCR detects (diagram 1 is positive control, and 12 is negative control); C:P-969 transfer-gen plant PCR detects (diagram 1,2 is positive control, and 16 is negative control).

Embodiment

The present invention is further described below in conjunction with Figure of description and specific embodiment.Described embodiment, only for explaining the present invention, is not intended to limit scope of the present invention.The test method used in following embodiment if no special instructions, is ordinary method; The material used, reagent etc. if no special instructions, are the reagent that can obtain from commercial channels and material.

Embodiment 1

The acquisition of DXR promoter sequence

S1. the extraction of flower of Greenish Lily petal STb gene: by the 0.1 ~ 0.2g flower of Greenish Lily plant petals powder transfer through liquid nitrogen grinding in 2.0mL centrifuge tube.Add the 2%CTAB solution of 1mL preheating, fully mix, 65 DEG C of water-baths 30 minutes; Every 10 minutes, put upside down and shake up once.Centrifugal 5 minutes of 12,000rpm, the new centrifuge tube of transfer supernatant to, then in centrifuge tube, add isopyknic phenol/chloroform/primary isoamyl alcohol (25:24:1) puts upside down several times, shakes gently to solution and becomes emulsification shape, 12,000rpm, centrifugal 5min, the centrifuge tube that transfer supernatant to is new.Repeat to add isopyknic phenol/chloroform/primary isoamyl alcohol (25:24:1) 1 time, 12,000rpm, centrifugal 5min.Get supernatant liquor, add the Virahol of 2/3 volume, place 30min for-20 DEG C.Add 1 × TE solubilize precipitation, add 1/10 volume NaAC(3mol/L) and 2 times of volume dehydrated alcohols, place more than 2h for-20 DEG C.12,000rpm, centrifugal 5min, abandons supernatant liquor, and precipitation washes 2 ~ 3 times with 70% ethanol, and drying at room temperature precipitates.With 50 ~ 100 μ l1 × TE solution precipitations.Get 2 μ lDNA samples, agarose gel electrophoresis detects DNA quality and concentration, the preservation of-20 DEG C, all the other samples.Consisting of of described CTAB solution: Tris100mM, NaCl1.4M, EDTA20mM, CTAB2%, mercaptoethanol 0.1%.

S2. hiTAIL-PCR technology clone is adopted dXR5 ' end upstream regulatory sequence of gene: according to the DNA sequence dna (SEQIDNO:1) of known flower of Greenish Lily DXR gene, at specificity nested primer sp1, sp2, sp3 that its 5 ' end design 3 is outside, arbitrary degenerate primer design is with reference to 5 arbitrary degenerate primer (Liu designed in (2007) documents such as Liu, 2007, BioTechniques, 43(5): 649-656).Concrete sequence is as follows:

sp1：5'-GAAGCGACTCATTTCTGACAGCGACC-3'（SEQIDNO:6）

sp2：5'-GCTAACTCTCTTCATACAGCTCATCCCCTTG-3'（SEQIDNO:7）

sp3：5'-GTCCATGAAAGAGACACCTCCCATCTCCGTCTGC-3'（SEQIDNO:8）

LAD-1：5'-ACGATGGACTCCAGAGCGGCCGCVNVNNNGGAA-3'（SEQIDNO:9）

LAD-2：5'-ACGATGGACTCCAGAGCGGCCGCBNBNNNGGTT-3'（SEQIDNO:10）

LAD-3：5'-ACGATGGACTCCAGAGCGGCCGCVVNVNNNCCAA-3'（SEQIDNO:11）

LAD-4：5'-ACGATGGACTCCAGAGCGGCCGCBDNBNNNCGGT-3'（SEQIDNO:12）

AC1：5'-ACGATGGACTCCAGAG-3'（SEQIDNO:13）

The system of amplification and program are with reference to the carrying out in (2007) documents such as Liu.Reclaim from agarose gel and be connected to pMD-19Tvector amplifying DNA fragmentation, Transformed E .coli.DH5 α

, enzyme checks order after cutting qualification.Sequencing sequence is as shown in SEQIDNO:2; Sequence shown in SEQIDNO:2 comprises the part ORF sequence of the gene after promotor DXR sequence and initiator codon, and the long 1015bp of sequence, as shown in SEQIDNO:2.

Submit the nucleotide sequence (shown in SEQIDNO:2) of promotor DXR to online promoter Analysis software, the cis-regulating element comprised in prediction promotor, found that: the nucleotide sequence of promotor DXR is divided into the object fragment of 35 ' end series of deletions; 35 ' end deletion sequence are respectively p-534, p-767 and p-969.P-534 length is about shown in 534bp(SEQIDNO:3); P-767 is about shown in 767bp(SEQIDNO:4); P-969 is about shown in 969bp(SEQIDNO:5).

Embodiment 2

DXR promotor and GUS amalgamation and expression transformation of tobacco

S1. according to the sequence of the DXR promotor of embodiment 1 acquisition, design packet contains xbaI and HindIIIthe primer for increase 35 ' end deletion sequence p-534, p-767 and p-969 of restriction enzyme site.Primer sequence is as follows:

The primer of amplification p-534:

p-534-F：5'-GGCAAGCTTACCATACATGTGACACACAG-3'（SEQIDNO:14）

The primer of amplification p-767:

p-767-F：5'-GGCAAGCTTCTGACCCGTTTATAAACGAG-3'（SEQIDNO:15）

The primer of amplification p-969

p-969-F：5'-GGCAAGCTTCCTCACAAGATAGACGATC-3'（SEQIDNO:16）

Downstream primer is:

R：5'-GGGCCTCTAGATTGAGGAGAGAGAAAGAGATAAG-3'（SEQIDNO:17）

S2.pCAMBIA1300G plant expression vector is used xbaI and HindIIIrestriction enzyme carries out double digestion, and 1% sepharose reclaims large fragment.Utilize T4DNA ligase enzyme that object fragment orientation is inserted into plant expression vector.To connect product conversion intestinal bacteria ( e.coli) DH5 α competent cell, cut through enzyme and after qualification of checking order, obtain three recombinant plant expression vectors.Preparation agrobacterium tumefaciens EHA105 competent cell, proceeds to Agrobacterium by above-mentioned recombinant plant expression vector.

S3. aseptic for tobacco blade is cut into the fritter of 0.5cm × 0.5cm, is seeded on inducing culture and carries out preculture, illumination cultivation 2 ~ 3d.Get the material after preculture 2 ~ 3d, add the Agrobacterium suspension bacteria liquid prepared, infect 5 ~ 10min, outwell bacterium liquid, take out explant and be placed in the bacterium liquid aseptic thieving paper sucking attachment, be again placed on former pre-culture medium, 28 DEG C of light culture 3d.Be transferred to by explant after Dual culture after antibacterial screening culture medium selects to cultivate 20d, the transformant of explant will produce resistant calli, be proceeded to by these materials on corresponding selective differentiation substratum and carry out differentiating bud cultivation.After screening culture medium is induced about 4 weeks, indefinite bud grows to more than 2cm, and the young shoot grown by leaf plate edge cuts from base portion and leaf dish, inserts on the root media containing Selective Pressure and carries out root culture.Plant to be planted long-living go out a large amount of root time, by tissue cultured seedling from group training room take out, unscrew bottle cap, at indoor placement 5 ~ 7d, shine 1 ~ 2h sun every day; Then take out young plant, clean the substratum on root system, be transplanted in sterilized compost, transplant the transparent plastics that back cover is with holes, to keep the humidity of 75 ~ 85%, 25 DEG C, illumination 1500 ~ 2500Lux, the photoperiod is with illumination every day 14 ~ 16h/8 ~ 10h h dark.Cultivate about 10 ~ 15d, move on to outdoor and carry out Adaptable growth.

S4.CTAB method extracts resistant plant leaves genomic DNA, with comprising of designing in advance xbaI and HindIIIthe DXR promotor special primer of restriction enzyme site carries out pcr amplification, and what can amplify band is positive plant.

Positive transfer-gen plant is detected through PCR, with not genetically modified plant as negative control, get the positions such as root, stem, leaf, petal, column cap and flower pesticide to dye, decolouring, observes gus protein and detects GUS enzymic activity in the colour developing situation of different organ and tissue and different development stage with employing chemoluminescence method.When different tissues GUS dyes, flower pesticide, column cap (Figure 1A), presents blueness in petal (Fig. 2 B); At leaf, without obvious blue in stem and root (Figure 1A), show that DXR promotor presents colored specifically expressing characteristic; The result of GUS enzyme assay simultaneously shows, GUS enzymic activity is expressed the highest in flower pesticide, and be secondly column cap and petal, in stem and leaf, enzyme activity is very low, sees Figure 1B, consistent with coloration result.The GUS coloration result of different development stage shows: unopened bud does not have blueness, half-open, bloom and present blueness with the petal under aging state, and petal blueness in full bloom the most obviously (Fig. 2 A).The result of GUS enzyme assay simultaneously also shows, unopened bud enzyme activity is very low, and along with petal is open, enzyme activity improves, and under state in full bloom, enzymic activity reaches the highest, and senescence phase declines (Fig. 2 B).

Transfer-gen plant and non-transfer-gen plant are scratched with the pocket knife of disinfecting and carries out damage experiment, after 20min, GUS staining examine and GUS enzyme assay.On the blade methyl jasmonate of 0.2mM being applied to transfer-gen plant and non-transfer-gen plant and petal, after 20min, GUS staining examine and GUS enzyme assay.GUS dyeing shows: after methyl jasmonate and injury process, and the blueness of petal is obviously than untreated petal Blue dark (Fig. 3 A), and three fragments compare simultaneously, and promoter fragment is longer, and blueness is darker.Untreated transgene tobacco leaf does not have blue appearance, and the blade after methyl jasmonate and injury process all presents obvious blueness.GUS enzyme activity result shows, after petal methyl jasmonate and injury process, GUS activity ratio is untreated to be significantly improved (Fig. 3 B).Untreated normal activities of enzymes in leaf is extremely low, but methyl jasmonate and injury process after, GUS enzymic activity is significantly increased, DXR-969 fragment enzyme activity the highest (Fig. 4 B).

SEQUENCELISTING

<110> Agricultural University Of South China

The DXR promotor of the special and wound induced in <120> flower of Greenish Lily portion and application thereof

<130>

<160>13

<170>PatentInversion3.3

<210>1

<211>1593

<212>DNA

The DNA sequence dna of <213> flower of Greenish Lily DXR gene

<400>1

cttatctctttctctctcctcaaatggcagccctgaagcttcctctgcagacggagatgg60

gaggtgtctctttcatggactctagcagagctaccttccaccccctcaaagtgggaattc120

atgcgatgaggaaggacaaggggatgagctgtatgaagagagttagctgctccatgcaac180

aggggcctccaccggcctggcctggccgggcggtttcggaaccgggccgcaagtcatggg240

acggtccgaagcctatatcgattgttggatcaacggggtcgattggaactcagactctgg300

acatagtggcagagaatccggataagttcagggtggtggcactagcagcgggatctaatg360

ttactctcttggctgatcaggtgaaaacatttaggccgcaattggtcgctgtcagaaatg420

agtcgcttcttggtgagctgaaagaagctctggctgatgctgattacaagccaattatca480

ttactggggaggaaggtgttgtcgaggttgctcggcacccagatgctgtcacggtagtta540

caggaatagttgggtgtgccggcttgaagcctaccgtagctgctattgaagcgggaaaag600

atatagccctagcaaacaaggagaccctgattgctggaggtccctttgtgcttccccttg660

ctcacaagcacaatgtgaaaattctcccagccgattcagaacattctgccatattccagt720

gtatccagggcttgccgagggtgcacttcgacgcatcatcttgactgcatctggaggagc780

cttcagggattgggatgttgaaaggctgaaagaagtgaaagttgctgatgctttgaaaca840

tccaaattggaatatggggaagaagattacagtagactctgctactcttttcaacaaggg900

tctagaagttattgaagctcactatctatttggggctgaatatgatgatgttgagattgt960

aatccatccacaatcaatcattcactcgatgattgagacacaggattcatcagtgctggc1020

tcagttgggatggcctgatatgcgcttaccaattctttacacgttgtcttggccagagag1080

aatttattgctcagagaaaacatggcctcgacttgatctttgcaagctcggctctctaac1140

ctttaaagctcctgataatgtgaaatacccatcaatggatctcgcctatgctgctgggcg1200

ggctggaggcaccatgactggagtcctcagtgctgctaacgagaaggctgttgagttgtt1260

tatcgacgaaaaaattagctatctggacatttttaaggttgtggaggcaacatgtgacgc1320

acatcggaatgagttggtccttcatcctactctggaggagatcattcactatgacctgtg1380

ggctcgggacttcgcagctaatttaaaactatcttctggcttgagtccagttcctgtatg1440

agtacttcgtctcattcattgcgatgtagccctcggactcgagacttgacatttccgcat1500

aaatcggtagttgtgtatatggctcccgtgtgtagcaatgactatcagggtaatgtatct1560

tttatagtttatatagcaatcccaaaaaaaaaaaa1595

<210>2

<211>1015

<212>DNA

<213> artificial sequence

<400>2

cgatggactccagagcggccgcagcttcggaactcccacatatgtacctcacaagataga60

cgatctatgttggaattttagctttgctttcatcatattttcctcttaatttatcccaca120

aatcctacgaatatggttgaatatacttgatttcttggggctcgaaatatgaatcatatg180

atataattggttgagggagagatccgaaagaatatgaccttaggcgggctgataggttag240

ggctagggctgacccgtttataaacgagttggagatgccaacccaagctcgacttattta300

ataaacggatcgagttaggaccaggttggcggaccagactagattttgccagctttagtg360

caaatgttatatttgcgatttaaatgagatcaatggttaccaatgctgtatatgtgaatc420

tttttcctttaatggcaccaaaaaaactttataattatacggtaatgagtaaataactaa480

aaccatacatgtgacacacagtaaaagccactgattaattataatataagataccttttt540

tttggtcatattttctttgtagtaccattttaatagtaaattacgtcgacataaacaaag600

tgatgtttgtattcgtaaacacgttcccctttcaaactgattttactaaaagacaaattc660

ttccaataaatacactgcaacgcctaccgtcccaaacacaagcaagacctacccaattcc720

acccacacccaccatacaccttaaacaaacacaactcaaccacacaaccacgtgtcccaa780

acaaatacatgatcccaattaacagccgtgccacatcacgagtgaaagccaaaatgttcg840

agttcaaagtacgtattgaaccacccatccggctgggccggtgggtatgatccggtcgat900

agcactcagctccgtccaagtgattcctacttctcggcttcgtcttatctcacaccacct960

tcttctacatatactctctctctttcccccttcttatctctttctctctcctcaa1015

<210>3

<211>534

<212>DNA

<213>p-534

<400>3

accatacatgtgacacacagtaaaagccactgattaattataatataagatacctttttt60

ttggtcatattttctttgtagtaccattttaatagtaaattacgtcgacataaacaaagt120

gatgtttgtattcgtaaacacgttcccctttcaaactgattttactaaaagacaaattct180

tccaataaatacactgcaacgcctaccgtcccaaacacaagcaagacctacccaattcca240

cccacacccaccatacaccttaaacaaacacaactcaaccacacaaccacgtgtcccaaa300

caaatacatgatcccaattaacagccgtgccacatcacgagtgaaagccaaaatgttcga360

gttcaaagtacgtattgaaccacccatccggctgggccggtgggtatgatccggtcgata420

gcactcagctccgtccaagtgattcctacttctcggcttcgtcttatctcacaccacctt480

cttctacatatactctctctctttcccccttcttatctctttctctctcctcaa534

<210>4

<211>767

<212>DNA

<213>p-767

<400>4

ctgacccgtttataaacgagttggagatgccaacccaagctcgacttatttaataaacgg60

atcgagttaggaccaggttggcggaccagactagattttgccagctttagtgcaaatgtt120

atatttgcgatttaaatgagatcaatggttaccaatgctgtatatgtgaatctttttcct180

ttaatggcaccaaaaaaactttataattatacggtaatgagtaaataactaaaaccatac240

atgtgacacacagtaaaagccactgattaattataatataagataccttttttttggtca300

tattttctttgtagtaccattttaatagtaaattacgtcgacataaacaaagtgatgttt360

gtattcgtaaacacgttcccctttcaaactgattttactaaaagacaaattcttccaata420

aatacactgcaacgcctaccgtcccaaacacaagcaagacctacccaattccacccacac480

ccaccatacaccttaaacaaacacaactcaaccacacaaccacgtgtcccaaacaaatac540

atgatcccaattaacagccgtgccacatcacgagtgaaagccaaaatgttcgagttcaaa600

gtacgtattgaaccacccatccggctgggccggtgggtatgatccggtcgatagcactca660

gctccgtccaagtgattcctacttctcggcttcgtcttatctcacaccaccttcttctac720

atatactctctctctttcccccttcttatctctttctctctcctcaa767

<210>5

<211>969

<212>DNA

<213>p-969

<400>5

cctcacaagatagacgatctatgttggaattttagctttgctttcatcatattttcctct60

taatttatcccacaaatcctacgaatatggttgaatatacttgatttcttggggctcgaa120

atatgaatcatatgatataattggttgagggagagatccgaaagaatatgaccttaggcg180

ggctgataggttagggctagggctgacccgtttataaacgagttggagatgccaacccaa240

gctcgacttatttaataaacggatcgagttaggaccaggttggcggaccagactagattt300

tgccagctttagtgcaaatgttatatttgcgatttaaatgagatcaatggttaccaatgc360

tgtatatgtgaatctttttcctttaatggcaccaaaaaaactttataattatacggtaat420

gagtaaataactaaaaccatacatgtgacacacagtaaaagccactgattaattataata480

taagataccttttttttggtcatattttctttgtagtaccattttaatagtaaattacgt540

cgacataaacaaagtgatgtttgtattcgtaaacacgttcccctttcaaactgattttac600

taaaagacaaattcttccaataaatacactgcaacgcctaccgtcccaaacacaagcaag660

acctacccaattccacccacacccaccatacaccttaaacaaacacaactcaaccacaca720

accacgtgtcccaaacaaatacatgatcccaattaacagccgtgccacatcacgagtgaa780

agccaaaatgttcgagttcaaagtacgtattgaaccacccatccggctgggccggtgggt840

atgatccggtcgatagcactcagctccgtccaagtgattcctacttctcggcttcgtctt900

atctcacaccaccttcttctacatatactctctctctttcccccttcttatctctttctc960

tctcctcaa969

<210>6

<211>26

<212>DNA

<213> primer sp1

<400>6

gaagcgactcatttctgacagcgacc26

<210>7

<211>31

<212>DNA

<213> primer sp2

<400>7

gctaactctcttcatacagctcatccccttg31

<210>8

<211>34

<212>DNA

<213> primer sp3

<400>8

gtccatgaaagagacacctcccatctccgtctgc34

<210>9

<211>18

<212>DNA

<213> primer LAD-1

<400>9

acgatggactccagagcggccgcvnvnnnggaa18

<210>10

<211>18

<212>DNA

<213> primer LAD-2

<400>10

acgatggactccagagcggccgcbnbnnnggtt18

<210>11

<211>19

<212>DNA

<213> primer LAD-3

<400>11

acgatggactccagagcggccgcvvnvnnnccaa19

<210>12

<211>19

<212>DNA

<213> primer LAD-4

<400>12

acgatggactccagagcggccgcbdnbnnncggt19

<210>13

<211>16

<212>DNA

<213> primer AC1

<400>13

acgatggactccagag16

<210>14

<211>29

<212>DNA

<213> primer p-534-F

<400>14

ggcaagcttaccatacatgtgacacacag29

<210>15

<211>29

<212>DNA

<213> primer p-767-F

<400>15

ggcaagcttctgacccgtttataaacgag29

<210>16

<211>28

<212>DNA

<213> primer p-969-F

<400>16

ggcaagcttcctcacaagatagacgatc28

<210>17

<211>34

<212>DNA

<213> downstream primer

<400>17

gggcctctagattgaggagagagaaagagataag34

Claims (9)

1. a DXR promotor for the special and wound induced in flower of Greenish Lily portion, it is characterized in that, nucleotide sequence is as shown in SEQIDNO:2.

2. DXR promotor according to claim 1, is characterized in that, described DXR promotor contain the object fragment p-534 of 35 ' end series of deletions, p-767 and p-969, p-534, p-767 and p-969 sequence as shown in SEQIDNO:3 ~ 5.

3. a recombinant vectors, is characterized in that, described recombinant vectors is DXR promoter sequence described in the multiple clone site insertion claim 1 of the carrier that sets out.

4. a recombinant vectors, is characterized in that, described recombinant vectors is for inserting object fragment p-534, p-767 and the p-969 sequence of 5 ' end series of deletions of DXR promotor described in claim 2 in the multiple clone site of the carrier that sets out.

5. one kind comprises the recombinant bacterium of recombinant vectors described in claim 3 or 4.

6. one kind comprises the clone of recombinant vectors described in claim 3 or 4.

7. DXR promotor described in claim 1 is cultivating the application in the transgenosis fragrance of a flower or resistance plant kind.

8. cultivate a method for the transgenosis fragrance of a flower or resistance plant, it is characterized in that, import vegetable cell by containing the recombinant vectors described in claim 3 or 4, thus obtain the transgenosis fragrance of a flower or the resistance plant that DXR promotor starts destination gene expression.

9. method according to claim 8, is characterized in that: described goal gene is gus gene.