CN107936104A

CN107936104A - Tree peony PsMYB12 transcription factors and its encoding gene and application

Info

Publication number: CN107936104A
Application number: CN201711479630.1A
Authority: CN
Inventors: 舒庆艳; 朱瑾; 刘政安; 王亮生
Original assignee: Institute of Botany of CAS
Current assignee: Institute of Botany of CAS
Priority date: 2017-12-29
Filing date: 2017-12-29
Publication date: 2018-04-20
Anticipated expiration: 2037-12-29
Also published as: CN107936104B

Abstract

The invention discloses tree peony PsMYB12 transcription factors and its encoding gene and application.Tree peony PsMYB12 transcription factors provided by the present invention, are following protein a) or b)：A) protein being made of the amino acid sequence shown in sequence in sequence table 1；B) the relevant protein as derived from a) is synthesized by the amino acid sequence shown in sequence in sequence table 1 by the substitution of one or several amino acid residues and/or missing and/or addition and with the formation of tree peony color spot and/or anthocyanin.Pass through VIGS silences and heterologous excessive transformation assay, the results showed that it can regulate and control the key gene expression in anthocyanin route of synthesis.Speculate and play an important roll in the synthesis and accumulation and the formation of color spot of its anthocyanin in tree peony piebald.The present invention is to clone specific expression gene in spot first and verify its function, and the molecular mechanism formed for spot color is laid a good foundation, and technical basis and thinking are provided with regulation and control for deep parsing peony flavonoids synthesis.

Description

Tree peony PsMYB12 transcription factors and its encoding gene and application

Technical field

The present invention relates to biological technical field, more particularly to tree peony PsMYB12 transcription factors and its encoding gene and application.

Background technology

Tree peony (Paeonia suffruticosa Andrews) is Paeoniaceae (Paeoniaceae), Paeonia (Paeonia) Section Moutan (Sec.Moutan DC) fallen leaves undershrub, because it spends elegant and poised posture and abundant color to form For traditional famous flower of China, occupy very important status in China or even world flower development history.Come by traditional colour system Division, tree peony pattern are broadly divided into red, powder, purple, white, yellow, black, green, blue, 9 big colour system of secondary color.The color spot of peony petal base portion It is one of its important characteristic, in addition to great ornamental value, color spot has become the weight of Varieties of Peony heap sort and Study on Evolution Will foundation.It is worth mentioning that Paeonia papaveracea (P.rockii) and part P. delavayi (P.delayvaii) in its wild species, with And the petal base portion of quite a few cultivar (Central Plains, Japan and American-European Breeds) carries obvious color spot.Northwest tree peony Kind spot color is more abundant, has seen the different color spots such as black, black purple, reddish brown, aubergine.

Chemical fundamentals on tree peony piebald colour generation is studied more deep.Studies have found that, northwest tree peony majority kind The non-spot part anthocyanin of petal is made of Pn3G5G, Cy3G5G and Cy3G, and Pn3G contents are very low, is practically free of Pg type colors Element；Cy types pigment is largely synthesized in petal base portion, infer Cy it is glycosylation, methylate, high-content and its petal base portion generate, It is the major reason for causing northwest Breeds that there is this feature of purple plague purpura.Zhang et al.(2007)(Zhang JJ,Wang LS,Shu QY,Liu ZA,Li CH,Zhang J,Wei XL,Tian DK(2007)Comparison of anthocyanins in non-blotches and blotches of the petals of Xibei tree peony.Sci Hortic The anthocyanin group of 35 non-spots of northwest Varieties of Peony and spot portion 114,104-111.) is analyzed using high-efficient liquid phase chromatogram technology Into, spot is identical with the anthocyanin species in non-spot, detects 6 kinds of anthocyanins, be respectively Pn3G5G, Pn3G, Cy3G5G, Cy3G, Pg3G5G and Pg3G；But the content of pigment has a bigger difference, pigment content in spot is apparently higher than non-spot；With Cy in spot Type glucosides is main component, based on 3G type pigments；Using Pn types glucosides as main component in non-spot, based on 3G5G type pigments. Cy types pigment is largely synthesized in peony petal base portion, result in the formation of spot color.In addition, Zhao Na and Yuan Tao (2013) (Zhao Na, Yuan The Chinese agronomy circular 29 of the Primary Study (2013) of great waves northwests Varieties of Peony valve primary colours spot form:192-197) to northwest tree peony Kind petal base portion color spot form has carried out Primary Study, including the color of color spot, position, size and shape etc., to grind The mechanism for studying carefully the formation of tree peony spot color provides morphologic basis.

The only a small amount of report of the Study on Molecular Mechanism that tree peony spot color is formed, to tree peony band purple plague purpura kind ' Jinrong ' transcription Group sequence analysis, obtains the gene of 1573 spots and differential expression in non-spot, has 933 up-regulated expression genes in purple spot, 640 genes for lowering expression, to the enzyme gene in wherein anthocyanidin route of synthesis, expression carries out fluorescence in spot and non-spot Quantitative analysis, the results showed that the expression of PsCHS, PsF3'H, PsDFR and PsANS in spot is significantly higher than non-spot, thus it is speculated that this four The common high expression of gene causes the formation of spot color.In addition, to Paeonia papaveracea and ' Feng Dan ' and its Hybrid F1 seville orange flower valve transcript profile Analysis, thus it is speculated that CHS, DFR, ANS and GST may play an important roll in Paeonia papaveracea spot color is formed, and 2 R2R3-MYB pass through Regulate and control the formation of CHS, ANS and GST regulation and control spot color, but lack experimental evidence.The gene formed to spot color not yet carries out function Identification and research, especially regulate and control the regulatory factor MYB family genes that spot color is formed and have no report.

Its family is divided into 4 classes i.e. 1R-MYB, R2R3-MYB, 3R-MYB and 4R- by the quantity according to MYB domains are repeated MYB, wherein R2R3-MYB transcription factors are one of transcription factor families maximum in plant, are proved wide participation Plant Secondary Materials Metabolism, hormone and the response of envirment factor and the growth and development to plant and degeneration-resistant response etc. have important regulative；And Presently found participation regulation and control anthocyanin synthesis and plant color spot form relevant main regulatory factor.

Regulation and control of the myb transcription factor to anthocyanidin synthesis relative enzyme gene have tissue specificity；One MYB regulatory factor The enzyme gene in multiple anthocyanidin route of synthesis can be regulated and controled, and the enzyme gene in some anthocyanidin route of synthesis may also be by more The regulation and control of a MYB regulatory factors；MYB classes regulatory factor is just to regulate and control to anthocyanidin synthesis majority, also there is negative regulation once in a while；Both may be used To cooperatively form the expression that MBW complexs carry out controlling gene with bHLH and WDR class transcription factors, can also individually be adjusted Control.

The content of the invention

In order to make up the deficiency in above field, the present invention provides tree peony myb transcription factor, entitled PsMYB12, source In Varieties of Peony ' Qinghai Lake silver ripple ' (Paeonia suffruticosa ' Qing hai hu yin bo ').

Tree peony transcription factor PsMYB12 provided by the present invention, is following protein a) or b)：

A) protein being made of the amino acid sequence shown in sequence in sequence table 1；

B) by the amino acid sequence shown in sequence in sequence table 1 by one or several amino acid residues substitution and/or Lack and/or add and formed with tree peony color spot and/or anthocyanin synthesizes the relevant protein as derived from a).

The encoding gene of the albumen falls within protection scope of the present invention.

The encoding gene is following 1) or 2) or 3) or 4) shown：

1) its nucleotide sequence is DNA molecular shown in sequence 2 in sequence table；

2) its nucleotide sequence is DNA molecular shown in sequence 3 in sequence table；

3) under strict conditions with 1) or 2) DNA molecular of the DNA molecular hybridization limited；

1) or 2) or 3) 4) DNA molecular of the DNA molecular with more than 90% homology with limiting.

Expression cassette, recombinant expression carrier, transgenic cell line or recombinant bacterium containing the encoding gene fall within this hair Bright protection domain.

Present invention also offers a kind of method of prepare transgenosis plant, include the following steps：By the encoding gene Importing is set out in plant, obtains genetically modified plants；Compared with the plant that sets out, the petal color change and/or flower of genetically modified plants The expression quantity of flavonoids route of synthesis related gene changes in valve.

The encoding gene is imported by recombinant expression carrier, and the recombinant expression carrier is by the encoding gene The set out multiple cloning sites of carrier pCXSN (T- carriers) of insertion obtain；

The plant that sets out is control tobacco；The genetically modified plants are transgene tobacco.

Compared with compareing tobacco, petal darkens the transgene tobacco；The transgene tobacco is with compareing tobacco phase Than the expression quantity of flavonoids route of synthesis related gene NtCHS and/or NtDFR and/or NtANS improves in petal.

The VIGS silencing systems of identification tree peony flavonoids route of synthesis related gene fall within protection scope of the present invention.

Identify the VIGS silencing systems of tree peony flavonoids route of synthesis related gene, comprising：Inserted on VIGS silent carriers Enter the recombinant vector that target gene obtains；The target gene is nucleotide sequence and/or sequence table shown in sequence 2 in sequence table Nucleotide sequence shown in middle sequence 3.

The VIGS silent carriers are Tobacco rattle virus TRV2 carriers；The tree peony flavonoids route of synthesis related gene For PsCHS and/or PsCHI and/or PsF3H and/or PsF3'H and/or PsFLS and/or PsANS and/or PsWD40 and/or bHLH。

The application of the albumen or the encoding gene in regulation and control anthocyanin synthesis falls within protection scope of the present invention.

The present invention has obtained the one of a MYB family gene from Cultivar ' Qinghai Lake silver ripple ' petal transcript profile Partial sequence, clones to have obtained total length and is named as PsMYB12 according to RACE technologies, and is existed by quantitative fluorescence analysis, this gene Specifically expressing in tree peony spot, in S2 phase expression quantity highests.Carrier for expression of eukaryon is built, transformation of tobacco, can activate tobacco Middle NtCHS, NtDFR and NtANS expression quantity, and Anthocyanin Content in tobacco petal is improved, there is pattern in transgene tobacco petal Plain uneven distribution.Using virus-mediated gene silencing PsMYB12, key gene in flavonoids route of synthesis can be reduced Including PsCHS, PsCHI and PsANS etc..Thus it is important to prove that the gene has the function that in the formation of tree peony piebald.

Specifically expressed PsMYB12 belongs to R2R3-MYB family genes in tree peony piebald, its ORF long 834bp, thus it is speculated that coding 278aa, is not very high with known species amino acid sequence homology, is up to 56%, cluster analysis shows that it belongs to S5 Asias man Race, may regulate and control the synthesis of procyanidine.Pass through VIGS silences and heterologous excessive transformation assay, the results showed that it can regulate and control flower Key gene expression in blue or green glycosides route of synthesis.Speculate synthesis and the shape of accumulation and color spot of its anthocyanin in tree peony piebald Play an important roll in.The present invention is to clone specific expression gene in spot first and verify its function, point formed for spot color Handset system is laid a good foundation, and technical basis and thinking are provided with regulation and control for deep parsing peony flavonoids synthesis.

Brief description of the drawings

Fig. 1 is Varieties of Peony ' Qinghai Lake silver ripple ' flowering process and spot coloring case.

Fig. 2 expands electrophoresis detection figure for ORF, and a left side is DNA marker, and the right side is target gene ORF-834bp.

Fig. 3 is compared (underscore represents R2R3 domains) for PsMYB12 homologous amino acid sequences.

Fig. 4 is PsMYB12 and other species homologous sequence cluster analyses in public database.

Fig. 5 is the expression that PsMYB12 develops different times in ' Qinghai Lake silver ripple ' spot.

Flavonoids synthesis related gene expression analysis in spot before and after the petal that Fig. 6 is VIGS silences PsMYB12；* it is p< 0.05；* is p<0.01.

Fig. 7 is agriculture bacillus mediated PsMYB12 genetic transformation tobacco processes, wherein A：Co-cultivation process；B：Induction differentiation Process；C：Break up six weeks clump buds；D：Root induction process.

Fig. 8 is the identification of PsMYB12 transformation of tobacco positive plants.Lane 1-6：Turn target gene tobacco, WT：Wild type Control.

Fig. 9 is transgenic positive strain leaf and the expression analysis result for spending middle PsMYB12.

Figure 10 is transgenosis and control tobacco phenotype.CK is control, and No.3, No.5, No.7 are transgenic line.

Figure 11 is transgene tobacco and compares the expression that flavonoids in petal synthesizes key gene.

Embodiment

Varieties of Peony ' Qinghai Lake silver ripple ' (Paeonia suffruticosa ' Qing hai hu yin bo ') used is come (Varieties of Peony ' Qinghai Lake silver ripple ' was recorded from Institute of Botany, Chinese Academy of Sciences's Beijing Botanical Garden resource garden The non-patent literature of (P.suffruticosa ' Qing Hai Hu Yin Bo ') is：Zhang J J,Wang L S,Shu Q Y,Liu Z A,Li C H,Zhang J,Wei X L,Tian D K.2007.Comparison of anthocyanins in Non-blotches and blotches of the petals of Xibei tree peony.Sci Hortic, 114： 104-111)).The petal (S1-S4) of different development stage.First according to petal coloring process and flowering process, by its point For 4 periods (S1-S4) (Fig. 1), i.e. S1 phases, whole petal is in yellow green, and spot does not occur at this time；, there is light red peach in the S2 phases Shape spot occurs, the still yellow green of the petal at non-spot；S3 phases, spot darken in aubergine, and the petal at non-spot is changed into white； S4 phases, spot color remain unchanged aubergine, and shape is in spindle, and the petal at non-spot is still white.

This research institute (recorded the tobacco Nc89 with tobacco Nc89 (Nicotiana tabacum cv.Nc89) seed The non-patent literature of (Nicotiana tabacum cv.Nc89) is：Du H,Wu J,Ji KX,Zeng QY,Bhuiyad MW, Su S,Shu QY,Ren HX,Liu ZA,Wang LS.2015.Methylation mediated by an anthocyanin O-methyltransferase,is involved in purple flower coloration in Paeonia.J Exp Bot 66(21):6563-77), preserved from laboratory.

The clone of embodiment 1, tree peony PsMYB12 genes

First, gene cloning

It is material using Cultivar ' Qinghai Lake silver ripple ' S2 phases petal, carries out gene cloning.

(1) plant Total RNAs extraction

With reference to the product description extraction vegetable material total serum IgE of Tiangeng company RNAprep Pure PlantKit, specific side Method is as follows：

1) petal of 50-100mg S2 phases is taken, after being fully ground into powder rapidly in liquid nitrogen, pours into 1.5mL's at once In EP pipes, the SL (adding 5% mercaptoethanol using preceding) of 500 μ L is added, the acutely vibration that is vortexed immediately mixes；

2) 12,000rpm centrifuges 2min；

3) supernatant is moved on the Filter column CS in collecting pipe, 12,000rpm centrifugation 2min, in careful absorption collecting pipe Supernatant into the 1.5mL EP pipes of new no RNase, suction nozzle, which is tried one's best, avoids contact with pellet cell debris in collecting pipe；

4) absolute ethyl alcohol of 0.4 times of supernatant volume is slowly added to, is mixed (at this time it is possible that precipitation), it is molten by what is obtained Liquid and precipitation are transferred in adsorption column CR3 together, and 12,000rpm centrifugation 15s, outwell the waste liquid in collecting pipe, adsorption column CR3 is put Into collecting pipe；

5) 350 μ L protein liquid removals RW1,12000rpm centrifugation 15s are added into adsorption column CR3, are outwelled useless in collecting pipe Liquid, adsorption column CR3 can be put into collecting pipe；

6) DNase I working solutions configure：Take 10 μ L DNase I storing solutions to be put into the EP pipes of new no RNase, add 70 μ L RDD solution are soft to mix；

7) the DNase I working solutions of 80 μ L are added into adsorption column CR3, room temperature places 15min；

8) protein liquid removal RW1,12000rpm the centrifugation 15s of 350 μ L is added into adsorption column CR3, is outwelled in collecting pipe Waste liquid, adsorption column CR3 is put into collecting pipe；

9) rinsing liquid RW (adding ethanol using preceding), 12, the 000rpm centrifugation 15s of 500 μ L are added into adsorption column CR3, The waste liquid in collecting pipe is outwelled, adsorption column CR3 is put into collecting pipe；

10) repeat step 9；

11) 12,000rpm centrifuges 2min, adsorption column CR3 is put into the EP pipes of a new 1.5mL without RNase, to The DEPC-H of 30-50 μ L sterilizings is vacantly added dropwise in adsorbed film middle part₂O, room temperature place 2min, and 12,000rpm centrifugation 1min, obtain To RNA solution；

12) agarose electrophoresis detection RNA quality (band of 7-15kb is mRNA and the band of hnRNA, 5kb are 28SrRNA, The band of 2kb is that the band of 18S rRNA, 0.1-0.3kb are 5S rRNA.Band unobvious represent that RNA is degraded).

13) by Nanodrop 2000 (Thermo) spectrophotometric determination, -70 DEG C save backup RNA ultimate densities.

(2) reverse transcription

Reverse transcription carries out (SMARTer RACE 5 '/3 ' Kit, TaKaRa) with reference to kit specification.Reverse transcription system and Program is shown in Table 1, table 2 and table 3.

1 reverse transcription system I of table

2 reverse transcription system II of table

1) after reverse transcription system II being reacted to 3min under the conditions of 72 DEG C 2min is reacted under the conditions of 42 DEG C.After cooling, letter Short centrifugation makes reaction system concentrate on tube bottom.

3 reverse transcription system III of table

2) system I, II are mixed with system III, reacts 90min under the conditions of being placed in 42 DEG C, it is anti-under the conditions of being placed on 70 DEG C Answer 10min.After the completion of reaction, 90 μ L of Tricine-EDTA Buffer are added, -20 DEG C is placed in and saves backup.

3) after obtaining gene 3' and 5' terminal sequence, by high-fidelity Takara LA Taq polymerases respectively from petal spot and Amplification obtains ORF in the cDNA that the RNA reverse transcriptions extracted in non-spot obtain.The primer for expanding ORF is as follows：PsMYB12F (Forward primer(5'-3'))：ATGGGAAGGGCTCCTTGTTGTTCAAA；PsMYB12R： ATAAGTGATATCTACTGCTGCTGCTGCTGC.PCR reaction systems and program are shown in Table 4-1, table 4-2 and table 5.

Table 4-1 PCR reaction systems I

Table 4-2 PCR reaction systems II

5 PCR response procedures of table

2nd, the recycling of target dna band is with being connected

(1) recycling of band

Target bar after amplification is recycled using EasyPure Quick Gel Extraction Kit (Quan Shijin), recycling Method is carried out with reference to kit specification.Specific method is as follows：

1) the target DNA band in Ago-Gel is cut, is put into the centrifuge tube of clean 1.5mL, weighs gel weight Amount, such as gel weight 100mg, can be considered 100 μ L, and so on.

2) the GSB gel solutions of 3 times of volumes are added, is placed in 55 DEG C of water-baths, is completely dissolved gel, can be added after thawing The isopropanol of 1 times of volume；

3) gel to be melted is down to room temperature, is put into centrifugal column, is stored at room temperature 1min, 10,000 × g centrifugation 1min, are abandoned Remove efflux；

4) 650 μ L WB solution are added, 10,000 × g centrifugation 1min, discard efflux；

5) 10,000 × g centrifuge 2min, remove remaining WB solution；

6) adsorption column is placed in new 1.5mL centrifuge tubes, uncaps and stand 1min, make remaining ethanol volatilization clean, to The center of column adds 30 μ L EB solution (65 DEG C of preheatings), is stored at room temperature 1min；

7) 10,000 × g centrifuge 1min eluted dnas, and the results are shown in Figure 2 for electrophoresis detection recycling, and it is standby to be put into -20 DEG C of refrigerators With

(2) connection and conversion of target dna band

The connection conversion of target stripe is as follows with reference to shop instruction, specific method：

1) 4.0 μ L recovery products are added in centrifuge tube, 1.0 μ L pEASY-T3 Cloning Vector are (purchased from full formula gold Bioisystech Co., Ltd), (20 DEG C -37 DEG C) reaction 5min of room temperature, after reaction, centrifuge tube is placed on ice.

2) connection product is added to containing 50 μ L Transl-T1 competent escherichia coli cells (purchased from full formula gold biology Technology Co., Ltd.) in (add connection product when competent cell just thaws), flick mixing, ice bath 30min.

3) 42 DEG C of heat shock 30s, are immediately placed on 2min on ice.

4) plus 300 μ L are balanced to the LB culture mediums of room temperature, 200rpm, 37 DEG C of incubation 1h.

5) 300 μ L bacterium solutions are equably applied on ready resistance culture base, 37 DEG C are incubated overnight.

6) picking white monoclonal bacterium colony is added to 400 μ L in the LB culture mediums of kanamycins (Kan) 0.1mg/mL, 200rpm, 37 DEG C of incubation 2h.

LB culture medium prescriptions：

In every 1,000mL systems, peptone 10g, yeast extract 5g, sodium chloride 10g, pH 7.0.If solid culture Base, adds 15g agar powders, autoclave sterilization.

3rd, PCR methods identification positive recombinant and sequencing

Template of the 2 μ L bacterium solutions as PCR reaction systems is taken, with M13 forward primers and reverse primer (M13F:5' TGTAAAACGACGGCCAGT3'；M13R:5'CAGGAAACAGCTATGACC3') identify recon, reaction system and program point 6 and table 7 are not shown in Table.

Table 6 identifies that the PCR reaction systems of recon are as follows：

Table 7 identifies the PCR response procedures of recon

Product is detected with 1.0% agarose electrophoresis 100V, EB dyeing.Target stripe after amplification used after cutting glue EasyPure Quick Gel Extraction Kit (Beijing Quanshijin Biotechnology Co., Ltd) are recycled, and take 4 μ L recycling productions Thing, 1 μ L pEASY-T3 carriers, 25 DEG C of connection 15min.Transformation and selection positive colony after the completion of connection, is used for after PCR is identified Sequencing.The sequencing data that the accuracy of sequence is cloned by 10 independent pEASY-T3 is verified, wherein more than 5 sequencings cloned Data unanimously think to represent correct sequence information.

As a result：The cDNA of the full length gene of acquisition is 1081bp, as shown in sequence 2 in sequence table；Wherein, sequence in sequence table Row 2 the 1st to the 834th from 5 ' ends are open reading frame, and open reading frame part is 834bp, such as the institute of sequence 3 in sequence table Show；Albumen in its polynucleotide shown in sequence 1, sequence 1 are made of 278 amino acid sequences.It is by the unnamed gene PsMYB12, the albumen encoded are named as PsMYB12.

Utilize online online software (https://blast.ncbi.nlm.nih.gov/) its amino acid sequence is carried out BlastP analyze, the results showed that, its with known species similitude below 56%, specifically with wild strawberry (Fragaria vesca) (NP_001295449) similitude reaches 56%, is 55% with cocoa (Theobroma cacao) TT2 like MYB similitudes, Reach 52% etc. with grape (Vitis vinifera) MYBPA1 (NP_001268160) similitude.Include intending south with known species Mustard (Arabidopsis thaliana) AtMYB12 (DQ224277), grape (Vitis vinifera) VvMYBF1 (ACT88298), apple (Malus domestica) MdMYB22 (AAZ20438), hybrid lily (Lilium hybrid) Ljmyb12 (BAF74782) and African Chrysanthemum (Gerbera hybrid) GhMYB1 (CAD87007) homologous amino acid sequence carry out more Compare again, they containing R2 R3 domain (Fig. 3).

The MYB 5-7 subfamilies that the tree peony PsMYB12 amino acid sequences cloned and known species are cloned Sequence is analyzed and builds systematic evolution tree (Fig. 4), the results show that each autohemagglutination of these three family members is one, S7 Asias man Adoption is one, regulates and controls the synthesis of flavones and flavonols, indicates the affinity between its same family member, S5 subfamilies What member disperseed gathers for three, and the PsMYB12 and grape VvMBPA1 (NM_001281231) of tree peony gather for one, belongs to S5 Asias Family, thus it is speculated that the synthesis of regulation and control procyanidine (Proanthocyanidins).

The expression of embodiment 2, PsMYB12 genes in peony petal development in different stages and different tissues compares

Cultivar ' Qinghai Lake silver ripple ' is divided into 4 stages (Fig. 1), the first two from the colourless phase to phase process in full bloom Period samples 1 time every two weeks, and each week sampling of latter two period is once.The petal of 3 plants of different plants is taken every time, as 3 solely Vertical experiment repeats.All samples are carried out to the extraction of total serum IgE, and reverse transcription is into cDNA, the template as quantitative fluorescent PCR.

First, RNA is extracted

RNA extraction method is the same as above-described embodiment 1.

2nd, reverse transcription

Reverse transcription carries out reverse transcription with reference to the product description of Tiangeng company FastQuant RT Kit, and method is as follows：

Since the RNA concentration extracted from more period samples is inconsistent and difference is larger, to keep product cDNA concentration Unanimously, it is 800ng to preset final reversion amount, establishes 20 μ L reaction systems.

Method is as follows：

1) template and reagent thaw

Template ribonucleic acid is thawed on ice, 5 × gDNA Buffer, FQ-RT Primer Mix, 10 × Fast RT Buffer、RNase-Free ddH₂O thaws for (15-25 DEG C) in room temperature, is immediately placed on ice after defrosting.Using it is preceding will be every kind of molten The concussion of liquid whirlpool mixes, and brief centrifugation remains in the liquid of tube wall to collect.

2) prepare genomic DNA and remove system

Genomic DNA removing body according to table 8 ties up to configures mixed liquor on ice, thoroughly mixes.Brief centrifugation, is placed in 42 ℃.It is incubated 3min.It is subsequently placed in and places on ice.

8 gDNA of table removes reaction system

3) reverse transcription system

Mixed liquor is prepared according to the reverse transcription reaction system of table 9.

9 reverse transcription reaction system of table

4) reverse transcription system mixed liquor is added in the reaction system of gDNA removal steps, fully mixed.42 DEG C of incubations 15min。

5) 95 DEG C of incubation 3min are placed on ice, and cDNA can be used for subsequent experimental, or Cord blood.

3rd, quantitative fluorescent PCR

Quantitative fluorescence analysis is (biochemical purchased from Tiangeng using SuperReal PreMix Plus (SYBR Green) kit Scientific and technological (Beijing) Co., Ltd).Carried out by LT STEPONE PLUS (LIFE TECHNOLOGIES companies of the U.S.) qPCR instrument. The relative expression analysis of mRNA transcripts for reference gene, carries out skill three times respectively with tree peony PsTublin genes (EF608942) Art repeats and biology repeats.Primer sequence is shown in Table 10.

10 tree peony PsMYB12 gene clonings of table and quantitative fluorescence analysis the primer list

4th, result：

A specifically expressed MYB family gene, which has been obtained, from ' Qinghai Lake silver ripple ' petal spot is named as PsMYB12, if Primer is counted, quantitative fluorescence analysis is carried out in petal spot and non-spot different times to it, its specifically expressing in spot is found, in the S2 phases There is peak value, relative expression quantity reaches 1101 ± 43.4 (Fig. 5).It is probably the important of regulation and control spot color formation to speculate this PsMYB12 Controlling gene.

Embodiment 3, VIGS silences PsMYB12

The virus that Tobacco rattle virus (TRV) is made of TRV1 and two chains of TRV2.VIGS carriers come from used in the present invention Tobacco rattle virus carrier (tobacco rattle virus, TRV), TRV1/TRV2 adopt for China Agricultural University ornamental plant (recording the non-patent literature of the carrier is with stress physiology laboratory professor Ma Nan present afterwards：Tian J,Pei H X, Zhang S,Chen J W,Chen W,Yang R Y,Meng Y L,You J,Gao J P,Ma N.2014.TRV-GFP:a modified Tobacco rattle virus vector for efficient and visualizable analysis Of gene function.J Exp Bot, 65：311-322.), it is with that selection markers of card and 35S promoter, pTRV2 bands There are the multiple cloning sites such as BamH I and Xho I.The virus of transformation is used to carry out correlative study.TRV1 is primarily served in plant The effect of Viral movement, TRV2 are expression vector, contain multiple cloning sites.

PsMYB12 is cloned about 200bp fragments and adds BamH I and Xho I double enzyme sites and replaces TRV2 carriers respectively Upper multiple cloning sites part, builds TRV2-PsMYB12 plant expression vectors.Convert bacillus coli DH 5 alpha and Agrobacterium GV3101 Positive colony is obtained, and passes through the correct sequence of sequence verification, it was demonstrated that is built successfully.Flower (S3 phases) is cut for taking out from plant Vacuum infestation, 4 days after infecting, sampling, spot and non-spot is separated, for quantitative fluorescence analysis.Specific method is as follows：

(1) structure of VIGS expression vectors

Primer is designed according to the cDNA sequence of target gene PsMYB12, clones target gene fragment and in target gene two End addition restriction enzyme site BamH I and Xho I, primer Myb12F/R sequences are shown in Table 10.

Pcr amplification reaction system and program are identical with cloning complete ORF in embodiment.Expand obtained purpose band and cut glue PEASY-T is connected after recycling₃Carrier (is purchased from Quan Shijin Bioisystech Co., Ltd), conversion Transl-T1 Escherichia coli impressions State cell (Trans1-T1 Phage Resistant Chemically Competent Cell, purchased from full formula gold biotechnology Co., Ltd), the LB resistant panels containing Amp (0.1mg/mL) are applied, are incubated overnight under the conditions of 37 DEG C, picking white single bacterium colony, shakes PCR detections are carried out after bacterium 2h, and upgrading grain carries out sequence verification, after verification sequence is correct, with restriction enzyme BamH I and Xho I double digestions simultaneously recycle.At the same time VIGS expression vectors TRV2 BamH I and Xho I double digestions and recycle, then by mesh Fragment be connected with linear carrier by T4 DNA ligases, build VIGS expression vectors.Digestion linked system and reaction condition With table 12,13.Connection product conversion DH5 α Bacillus coli cells (being century bio tech ltd purchased from health) afterwards test by sequencing Correct expression vector plasmid is demonstrate,proved, (Agrobacterium competent cell is purchased from freeze-thaw method conversion GV3101 Agrobacteriums competent cell Beijing Bo Maide gene technology Co., Ltd), obtain positive monoclonal Agrobacterium.Bacterium solution adds 50% glycerine and mixes after -80 DEG C save backup.

(2) degassing method infects tree peony bud and (refers to Tian J, Pei H X, Zhang S, Chen J W, Chen W, Yang R Y,Meng Y L,You J,Gao J P,Ma N(2014)TRV-GFP:a modified Tobacco rattle virus vector for efficient and visualizable analysis of gene function.J Exp Bot 65, 311-322.), specific method is：

1) by the positive monoclonal bacterium liquid activation of preservation, by 1:100 ratio takes activation bacterium solution to add the (0.1mg/ containing Kan ML) and in the LB fluid nutrient mediums of Rif (0.05mg/mL), 28 DEG C, 180rpm shaken cultivations to OD₆₀₀=1.0；

2) 6,000rpm, room temperature centrifugation 5min, collects thalline, abandons supernatant；

3) liquid (10mM MgCl are infected in configuration₂, 20mM acetosyringones, 10mM MES, pH 5.6) thalline is resuspended, use rifle Pressure-vaccum thalline is until it is uniformly suspended in and infects in liquid；

4) OD of resuspended bacterium solution is made with infecting liquid and adjust₆₀₀=1.0, and pTRV2-MYB12, pTRV1 and pTRV2 bacterium solution OD₆₀₀It is worth identical；

5) by pTRV2-MYB12 and pTRV1,1 ﹕ 1 is mixed pTRV2 and pTRV1 bacterium solutions respectively by volume, and dark place is stood 4h；

6) peony flowers band 5cm anthocaulus is cut, and is randomly distributed in different disposal, is immersed in bacterium solution, is evacuated to 0.7atm (atmospheric pressure), Negative pressure 10min, slowly deflate 20min.Each three flowers of processing are repeated 3 times；

7) petal after suction is rinsed with deionized water, removes unnecessary bacterium solution；

8) anthocaulus is not in deionized water, 8 DEG C, humidity 60% or so, light culture 1d；23 DEG C are transferred to afterwards, humidity 60% or so, cultivate 3 days；

9) 4 days post-samplings are infected, the spot of petal and non-spot are separated, extract detection sample as RNA, liquid nitrogen flash freezer is deposited In -80 DEG C.The expression of gene is detected afterwards relative to the change of blank control.PsMYB12 fluorescent quantitations primer is with reference to table Primer PsMYB12-qF/R in 10, other primers are with reference to table 11.Reaction system and program are the same as embodiment 2.

11 VIGS silence PsMYB12 quantitative fluorescence analysis the primer lists of table

The result shows that：After the instantaneous silence PsMYB12 of VIGS technologies, its expression reduces 54.0%, PsCHS tables 82.7% is reduced up to amount, PsCHI, PsF3H, PsF3'H, PsFLS, PsANS and PsWD40 reduce 24.0% respectively, 39.4%th, 30.5%, 48.4%, 31.1% and 28.6%；PsDFR is reduced minimum, is 2.1%.The expression quantity of bHLH is not only Do not reduce, and increase 8.8%.Statistical analysis shows that the expression quantity in spot of PsCHS, PsFLS and PsANS are lowered, and Difference is extremely notable；PsCHI and PsF3H lowers expression, significant difference (Fig. 6).

Embodiment 3, eucaryon Overexpression vector structure and transformation of tobacco verification PsMYB12 gene functions

First, eucaryon Overexpression vector is built

For PSN1301, (public can obtain eucaryon Overexpression vector from Institute of Botany, Chinese Academy of Sciences, and it is true to record this The non-patent literature of core Overexpression vector PSN1301 is：Liu Qing, Tang Jiao, Zeng Juan, yellow bright, virgin Jian Hua, Huang Zhigang .2014. The clone of arabidopsis AtVQ29 genes is in progress with plant expression vector construction modern biomedicals, 14 (35):6814-6817.), Carry tobacco mosaic virus promoter CaMV35S, Hygromycin resistance marker's gene, multiple cloning sites.According to target gene sequence Row design primer, clones target gene fragment ORF and adds Xba I and Kpn I restriction enzyme sites at 5 '/3 ' ends respectively, by zero load Body and DNA fragmentation carry out double digestion respectively, and endonuclease reaction system is shown in Table 12.The primer of amplifying target genes fragment ORF is as follows： PsMYB12F(Forward primer(5'-3'))：ATGGGAAGGGCTCCTTGTTGTTCAAA；PsMYB12R(Reverse primer(5'-3'))：ATAAGTGATATCTACTGCTGCTGCTGCTGC.

12 double digestion system of table forms and dosage

Reaction condition is 37 DEG C, 2-4h.

Target gene is connected to very by the recycling of double digestion product with above-described embodiment 1 under the action of T4DNA ligases On core Overexpression vector, linked system is shown in Table 13.

13 linked system of table forms and dosage

Reaction condition is 25 DEG C, 15min.

2nd, convert Agrobacterium and obtain positive colony and sequence verification

Sequence verification correctly extracts plasmid, and Agrobacterium GV3101 competent cells are converted with freeze-thaw method, obtains positive agriculture Bacillus monoclonal, method are as follows：

A. the GV3101 Agrobacteriums competent cell of -80 DEG C of preservations is taken to melt in ice-water bath or room temperature；

B. the Plasmid DNA that 1 μ g need to convert is added under aseptic condition into the competent cell suspension just to have thawed, gently Mix, ice bath stands 10min；

C. centrifuge tube is placed in quick-frozen 5min in liquid nitrogen；

D. and then quickly centrifuge tube is placed in 37 DEG C of water-baths and keeps 5min；

E. centrifuge tube is put back to and keeps 5min in ice again；

F. the LB Liquid Cultures that 800 μ L antibiotic-frees are added under aseptic condition are based on 28 DEG C of shaken cultivation 2-3h；

G.5,000rpm centrifuges 1min and collects thalline, and thalline is resuspended after removing 600 μ L liquid, is evenly coated in that is mould containing card In the solid medium of element (Kan) 0.1mg/mL and rifampin (Rif) 0.05mg/mL, 28 DEG C of culture 48h；

H. picking monoclonal bacterium colony is 28 in the LB fluid nutrient mediums containing Kan (0.1mg/mL) and Rif (0.05mg/mL) DEG C shaken cultivation 3h, carries out PCR detections.PCR detection method is the same as embodiment 1.The primer is shown in Table 10 for MYB12F/R.

3rd, transformation of tobacco

(1) tobacco seed sterilisation step is as follows：

A. a certain amount of seed is taken to be put into the sterile EP pipes of 5mL.

B. plus 75% ethanol of 3mL, turn upside down and mix 1min, remove supernatant.

C. plus 3mL absolute ethyl alcohols, turn upside down and mix 3min, remove supernatant.In triplicate.

Above step is carried out in sterile super-clean bench.Tobacco seed is directly inoculated in MS culture mediums, is placed in the culture of tissue culture room.

(2) leaf disk method transformation of tobacco

A. by the positive monoclonal bacterium liquid activation of preservation, by 1:100 ratio takes activation bacterium solution to add the (0.1mg/ containing Kan ML) and in the LB fluid nutrient mediums of Rif (0.05mg/mL), 28 DEG C, 180rpm shaken cultivations to OD₆₀₀=0.5；

B. room temperature 6,000rpm centrifugation 4min, collect bacterial sediment, are resuspended and cleaned with MS-1 fluid nutrient mediums, residual to remove Thalline, is resuspended in equivalent MS-1 fluid nutrient mediums by the antibiotic stayed again after centrifugation, in case dip dyeing blade；

C. the blade of well-grown sterile tobacco seedling is taken, blade edge and main lobe arteries and veins is cut away, remainder is cut into 1cm²The fritter of left and right；

D. the tobacco leaf fritter cut is put into the bacterium solution of MS-1 suspensions, disseminates 10min, jiggle beneficial to bacterium solution Completely attach to limb edge wound；

E. the blade after dip dyeing is placed on aseptic filter paper, sucks remaining bacterium solution；

F. the blade for blotting bacterium solution is connected on the co-cultivation culture medium MS-1 tablets without antibiotic, is placed in 23 DEG C of environment Lower shading co-cultures 2 days；

G. after co-culturing, with containing 200mg/mL cephalosporins (Cef) and 200mg/mL carbenicillins (Carb) The remaining Agrobacterium of sterile water wash blade surface, after aseptic filter paper suck dry moisture, blade is transferred to differential medium On MS-2,26 DEG C of illumination cultivations；

H. after differentiating Multiple Buds, cut when breaking up seedling and growing to 2-3cm high, be transferred in 1/2MS root medias and induce Take root.

MS-1 culture mediums：MS basis+30g/L sucrose, pH=5.8

MS-2 differential mediums：MS-1+BA(1.0mg/L)+NAA(0.2mg/L)+Hyg(20mg/L)+Cef(200mg/L) + Carb (200mg/L), pH=5.8

Root media：1/2MS+20g/L sucrose, pH=5.8.

(3) the PCR detections of transformed plant：

The extraction of transformed plant leaf DNA is comprised the following steps that using the CTAB methods of improvement：

After A.CTAB extracting solutions add 0.6% (v/v) mercaptoethanol, it is put into 65 DEG C of water-baths and preheats；

B. about 0.2g blades are weighed, with liquid nitrogen grinding into powder, the polyvinylpyrrolidone (PVP) of about 0.01g is added, divides Fill in about 100mg to 2mL EP pipes；

C. the CTAB extracting solutions that 800 μ L are preheated are added per EP pipes, after acutely vibration fully mixes, are put into 65 DEG C of water-baths 60min, therebetween every 10min jogs once；

D. EP pipes are taken out, are cooled to room temperature, add 800 μ L chloroforms/isoamyl alcohol, fully shake up 10min, 12,000rpm centrifugations 5min；

E. the supernatant after centrifugation is taken to add isometric chloroform/isoamyl alcohol into new 2mL EP pipes, fully shake up 10min, 12,000rpm centrifugation 5min；

F. after centrifuging, remove supernatant and managed to 1.5mL EP, the isopropanol for adding 2/3 volume is (pre- in -20 DEG C of refrigerators in advance It is cold), it is placed on after gently shaking up in 4 DEG C of refrigerators and precipitates 40min, then 12,000rpm centrifuges 10min；

G. supernatant is poured out after centrifuging, adds 70% ethanol of 1mL cleaning precipitation, 12,000rpm centrifugation 1min；

H. repeat step 7 is cleaned once；

I. pour out supernatant, after drying at room temperature DNA, about 20-30min (can not overdrying), add the dissolving of 100 μ L distilled waters DNA。

J.DNA concentration is measured with ultraviolet specrophotometer, and DNA mass is detected with 1.0% agarose gel electrophoresis, EB dyeing After photograph to record.DNA is spare under the conditions of being stored in -20 DEG C.

PCR system, program are with embodiment 1, and with 2.4, detection primer 12GF/R, is specifically shown in Table PCR product detection method Shown in 14：

Flavonoids route of synthesis related gene quantitative fluorescence analysis list of primers in 14 transgenic tobacco plant of table

As a result：Eukaryotic vector PSN1301 with PsMYB12 genes is transferred to by wild type cigarette by agrobacterium-mediated transformation Grass, by co-culturing, breaking up, the process (Fig. 7) such as root induction, obtains resistance tobacco with hygromycin selection, identifies and obtain through PCR Turn PsMYB12 gene masculines seedling 6 plants (Fig. 8).

Positive plant is subjected to transplanting seedling, to its leaf and the quantitative fluorescence analysis for spending middle PsMYB12 expression quantity to carry out, is obtained It is No.3, No.5 and No.7 (Fig. 9) that the strain higher to 3 plants of expression quantity is numbered respectively.Prove the PsMYB12 energy of external source tree peony Reach the normal transcription in tobacco and high expression, the relative expression quantity in transgenic line blade compare non-transgenosis 2403.9 ± 235.7 (No.3), 2235.8 ± 585.6 (No.5) and 13871.0 ± 949.5 (No.7) times；Expression in petal Amount is 6834.3 ± 152.2 times (No.3), 3015.9 ± 83.0 (No.5) of control, 20074.5 ± 776.4 (No.7).

The expression analysis of flavonoids route of synthesis gene in transgenic positive plant petal：

Observation of taking pictures is carried out to transgene tobacco and to control flower, it is seen that Magnifying chromoscopy is uneven in transgenic line petal It is even, in strain 7, one spend in have 2 petal colors deeper, 3 petals are shallower, and junction color is deeper between petal, flower Pigment has the trend extended downwardly along cylindrical fireworks, and uneven distribution (Figure 10) occurs in cylindrical fireworks.

The expression of flavonoids route of synthesis related gene has carried out fluorescent quantitation in transfer-gen plant and adjoining tree petal Analysis, after finding overexpression PsMYB12 genes, can raise the expression quantity of NtCHS, NtDFR and NtANS in tobacco petal (Figure 11).

Sequence table

<110>Institute of Botany, Chinese Academy of Sciences

<120>Tree peony PsMYB12 transcription factors and its encoding gene and application

<130> P170843/ZWY

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 278

<212> PRT

<213>Varieties of Peony ' Qinghai Lake silver ripple '（Paeonia suffruticosa 'Qing hai hu yin bo'）

<400> 1

Met Gly Arg Ala Pro Cys Cys Ser Lys Val Gly Leu His Arg Gly Pro

1 5 10 15

Trp Thr Pro Arg Glu Asp Thr Leu Leu Ser Lys Tyr Ile Glu Ala His

20 25 30

Gly Glu Gly His Trp Lys Tyr Leu Pro Lys Lys Ala Gly Leu Leu Arg

35 40 45

Cys Gly Lys Ser Cys Arg Leu Arg Trp Met Asn Tyr Leu Arg Pro Asn

50 55 60

Ile Lys Arg Gly Asn Ile Thr Pro Asp Glu Asp Asp Leu Ile Met Arg

65 70 75 80

Leu His Ser Leu Leu Gly Asn Arg Trp Ser Leu Ile Ala Gly Arg Leu

85 90 95

Pro Gly Arg Thr Asp Asn Glu Ile Lys Asn Tyr Trp Asn Thr His Leu

100 105 110

Ser Arg Lys Leu Gln Asp Lys Lys Lys Leu Ser Leu Pro Pro Gln Pro

115 120 125

Pro Lys Lys Lys Lys Arg Asn Asp Lys Lys Lys Lys Lys Asn Thr Thr

130 135 140

Ile Thr Ser Arg Thr Arg Gln Thr Gln Val Ile Met Glu Glu Lys His

145 150 155 160

Thr Ile His Ala Pro Lys Ala Ile Arg Ile Thr Cys Asn Pro Asn Ile

165 170 175

Thr Ser Ser Ile Phe Asp Thr Arg Ser Val Tyr Ser Cys Ala Ser His

180 185 190

Ala Gly Phe Asp Ile Ile Ser Thr Glu Glu Ala Val Asn Asn Ile Ile

195 200 205

Pro Trp Ser Glu Asp Val Gly Val Gly Tyr Phe Ala Gly Asp Asp Asp

210 215 220

Asp Glu His His Tyr Leu Val Asn Ser Leu Ser Glu Thr Ser Leu Leu

225 230 235 240

Val Pro Thr Asn Cys Thr Thr Gln Asp Asn Ala Gln Val Leu Glu Arg

245 250 255

Leu Tyr Gln Glu Tyr Leu Gln Leu Leu Lys Thr Glu Glu Glu Glu Asn

260 265 270

Lys Gln Gln Gln Gln Gln

275

<210> 2

<211> 1081

<212> DNA

<400> 2

atgggaaggg ctccttgttg ttcaaaggtt ggattgcaca gaggtccatg gactcccaga 60

gaagacacat tgctttcgaa gtatattgaa gctcatggtg aaggccactg gaaatatttg 120

cccaaaaaag ctgggctact tagatgtggc aagagttgca ggttgagatg gatgaactat 180

ctaagaccaa atatcaagag agggaacata acccctgatg aggatgatct gataatgaga 240

ttgcactccc ttctgggaaa ccgatggtca ctcatcgctg gaagactccc tggtcgaacg 300

gataacgaga tcaagaatta ctggaacacc catctcagca gaaaactcca agacaaaaag 360

aaattatctc tgccaccgca accaccaaag aagaagaaaa gaaacgacaa gaagaagaag 420

aagaacacca ccatcaccag taggacgagg cagacgcagg tcataatgga ggagaagcac 480

acaatccacg ctccaaaggc cattaggatt acttgtaacc caaatataac aagcagtata 540

tttgacacca ggagtgtcta ctcttgtgca agtcatgcag ggtttgatat aattagtacg 600

gaagaagctg tcaataatat tattccatgg agtgaagatg tgggggttgg atactttgct 660

ggagatgatg atgatgaaca tcactatctt gtcaacagct tgtcagagac aagtctacta 720

gtacctacta attgtacaac acaagataac gcacaagtac tggagaggct ttaccaggaa 780

tatctgcaac tactcaagac agaagaagaa gagaataagc agcagcagca gcagtagata 840

tcacttatcc atgatatccg gtggacgcca tatgttttta aggtgggctt tatttttatc 900

ttcaccaata atcataccag tagcttattc gtccattgat tgccaacttg gacggcctct 960

caacctttga ataaattagt taagagaact cccacattat aattgtcaaa aaaaaaaaaa 1020

aaaaaaaaaa aaaagtactc tgcgttgata ccactgcttg ccctatagtg agtcgtatta 1080

g 1081

<210> 3

<211> 834

<212> DNA

<400> 3

atgggaaggg ctccttgttg ttcaaaggtt ggattgcaca gaggtccatg gactcccaga 60

gaagacacat tgctttcgaa gtatattgaa gctcatggtg aaggccactg gaaatatttg 120

cccaaaaaag ctgggctact tagatgtggc aagagttgca ggttgagatg gatgaactat 180

ctaagaccaa atatcaagag agggaacata acccctgatg aggatgatct gataatgaga 240

ttgcactccc ttctgggaaa ccgatggtca ctcatcgctg gaagactccc tggtcgaacg 300

gataacgaga tcaagaatta ctggaacacc catctcagca gaaaactcca agacaaaaag 360

aaattatctc tgccaccgca accaccaaag aagaagaaaa gaaacgacaa gaagaagaag 420

aagaacacca ccatcaccag taggacgagg cagacgcagg tcataatgga ggagaagcac 480

acaatccacg ctccaaaggc cattaggatt acttgtaacc caaatataac aagcagtata 540

tttgacacca ggagtgtcta ctcttgtgca agtcatgcag ggtttgatat aattagtacg 600

gaagaagctg tcaataatat tattccatgg agtgaagatg tgggggttgg atactttgct 660

ggagatgatg atgatgaaca tcactatctt gtcaacagct tgtcagagac aagtctacta 720

gtacctacta attgtacaac acaagataac gcacaagtac tggagaggct ttaccaggaa 780

tatctgcaac tactcaagac agaagaagaa gagaataagc agcagcagca gcag 834

Claims

1. a kind of albumen, is following protein a) or b)：

B) by substitution of the amino acid sequence shown in sequence in sequence table 1 by one or several amino acid residues and/or missing And/or add and synthesize the relevant protein as derived from a) with the formation of tree peony color spot and/or anthocyanin.

2. the encoding gene of albumen described in claim 1.

3. encoding gene according to claim 2, it is characterised in that：The encoding gene for it is following 1) or 2) or 3) or 4) It is shown：

4. expression cassette, recombinant expression carrier, transgenic cell line or recombinant bacterium containing encoding gene described in Claims 2 or 3.

5. a kind of method of prepare transgenosis plant, includes the following steps：Encoding gene described in Claims 2 or 3 is imported Set out in plant, obtain genetically modified plants；Compared with the plant that sets out, in the petal color change and/or petal of genetically modified plants The expression quantity of flavonoids route of synthesis related gene changes.

6. according to the method described in claim 5, it is characterized in that：

The encoding gene is imported by recombinant expression carrier, and the recombinant expression carrier is to be inserted into the encoding gene The multiple cloning sites of carrier pCXSN (T- carriers) of setting out obtain；

7. according to the method described in claim 6, it is characterized in that：The transgene tobacco is compared with compareing tobacco, petal face Discoloration is deep；The transgene tobacco compared with compareing tobacco, in petal flavonoids route of synthesis related gene NtCHS and/or The expression quantity of NtDFR and/or NtANS improves.

8. identify the VIGS silencing systems of tree peony flavonoids route of synthesis related gene, it is characterised in that：Comprising：In VIGS silences The recombinant vector that target gene obtains is inserted on carrier；The target gene be sequence table in nucleotide sequence shown in sequence 2 and/ Or nucleotide sequence shown in sequence 3 in sequence table.

9. the VIGS silencing systems of identification tree peony flavonoids route of synthesis related gene according to claim 8, its feature It is：The VIGS silent carriers are Tobacco rattle virus TRV2 carriers；The tree peony flavonoids route of synthesis related gene is PsCHS and/or PsCHI and/or PsF3H and/or PsF3'H and/or PsFLS and/or PsANS and/or PsWD40 and/or bHLH.

10. application of the encoding gene described in the albumen, Claims 2 or 3 described in claim 1 in regulation and control anthocyanin synthesis.