CN107653234A - A kind of ginger benzenoid form esters floral base is because of HcBSMT and its application - Google Patents

Abstract

The invention discloses a kind of ginger benzenoid form esters floral base becauseHcBSMTAnd its application.It is describedHcBSMTThe full length cDNA sequence of gene such as SEQ ID NO:Shown in 1；Full length DNA sequence such as SEQ ID NO:Shown in 2；Coded sequence such as SEQ ID NO:Shown in 3, the amino acid sequence such as SEQ ID NO of coding:Shown in 4.HcBSMTGene is expressed in dulcet ginger tissue, is not expressed in the ginger tissue of British plain spirits, and its expression is regulated and controled by flower development, and expression pattern is related to fragrance of a flower release.WillHcBSMTIn channel genes ginger or other plant cells, the tool fragrance of a flower transfer-gen plant of expressing said gene can be obtained；Specific molecular labeling can also be produced according to its gene sequence information, for identifying the fragrance of a flower genotype of Hedychium Koenig and its hybrid generation, for molecular marker assisted selection breeding, so as to improve the efficiency of selection of breeding, there is larger application prospect.

Description

A kind of ginger benzenoid form esters floral base becauseHcBSMTAnd its application

Technical field

The present invention relates to gene engineering technology field, more particularly, to a kind of ginger benzenoid form esters floral base becauseHcBSMTAnd its application.

Background technology

The fragrance of a flower is one of important aesthetic and commodity property of ornamental plant, is increasingly valued by people in recent years.Grind Study carefully and show, compared with the kind of British plain spirits, consumer more dotes on the flower variety with aromatic odor（Pichersky et al., 2007）.Show according to modern medicine study, the fragrance of a flower of many plants can make one that body and mind is pleasant, mind is peaceful, it is tired to alleviate Labor, inspire enthusiasm, play a part of certain health care and treatment disease（Yang Xuhang etc., 2001）.In addition, fragrant flower herb plant may be used also For extracting plants essential oil, to be widely used in cosmetics and pharmaceutical industry, there is larger commercial value.

The fragrance of a flower is many low molecule amounts, low boiling, the complex mixture of volatile lipophilic molecules composition（Dudarevaet al., 2008）.Up to the present, in more than 1000 kinds plants, more than 1700 kinds Volatile infochemicals are identified （Knudsen et al., 2006）.Wherein, benzenoid form ester type compound is a kind of important volatile materials for forming the fragrance of a flower, especially Its methyl benzoate and bigcatkin willow methyl esters are the important components for forming the fragrance of a flower, and they are present in the fragrance of a flower more than 100 kinds of plants （Effmert et al., 2005）.The biosynthesis of methyl benzoate originates in aromatic amino acid phenylalanine, and biology closes Into first committed step be by phenylalanine lyase（PAL）Catalysis, PAL make phenylalanine slough amino to form trans meat Cinnamic acid（Wildermuth, 2006）.Being transformed into volatile benzene ring type compounds by trans-cinnamic acid needs from propyl side chains Remove two carbon units, the course of reaction can be completed by two independent catalytic routes, beta oxidation approach and non-beta oxidation Approach（Boatright et al., 2004）.At present, for beta oxidation approach, trans-cinnamic acid is in peroxisome ATP- With reference to cassette transporter protein（PXAs）In the presence of, transported from kytoplasm to peroxisome（Bussell et al., 2014）, then by cinnamoyl CoA ligase（CNL）By trans-cinnamic acid thioesterification（Colquhoun et al., 2012； Klempien et al., 2012）, then pass through cinnamoyl coacetylase hydration dehydrogenase（CHD）Complete aquation and dehydrogenation step （Qualley et al., 2012）, finally in ketone ester acyl coenzyme A thiolase（KAT）Catalysis under form benzoyl-CoA （Van Moerkercke et al., 2009）.For non-beta-oxidative pathway, then using benzaldehyde as important intermediate product, lead to Cross benzaldehyde dehydrogenase（BALDH）By oxidation of Benzaldehyde into benzoic acid（Long et al., 2009）, however, trans-cinnamic acid The process for forming benzaldehyde is unclear.In final stage, the transmethylase of SABATH families then willS- adenosylmethionine （SAM）Methyl group be transferred on benzenoid form carboxylic acid, formed with aromatic odor benzenoid form esters fragrance of a flower material（D' Auria et al., 2003）.

SABATH is the distinctive transmethylase family of plant, is catalyzed the N atoms of plant small molecular or the first of carboxylic group Base, their sequence have very big difference with other types of transmethylase, therefore, form a kind of new methyl transfer Enzyme, two English alphabets of three member names found earliest being extracted respectively, are named as SABATH families, these three send out earliest Existing member is salicylic acid methyltransferase respectively（SAMT）, benzoic acid methyl transferase（BAMT）With theobromine synthase（D' Auria et al., 2003）.It is the member being found earliest in the family that fairy maiden, which fans SAMT, and it is catalyzed salicylic acid and SAM shapes Into gaultherolin（Ross et al., 1999）.Toad's-mouth BAMT utilizes benzoic acid generation methyl benzoate（Murfitt et al., 2000）.Some SABATH family members have bi-functional, i.e., have SAMT and BAMT activity, therefore, claim simultaneously It is salicylic acid/benzoic acid methyl transferase（BSMT）（Chen et al., 2003；Pott et al., 2004）.BSMT is The end enzyme of methyl benzoate biosynthesis, plays important regulating and controlling effect in methyl benzoate biosynthesis.At present, state Outer researcher is also only in arabidopsis（Chen et al., 2003）, petunia（Negre et al., 2003）With view and admire cigarette Grass（Hippauf et al., 2010）Etc. identifying the enzyme in several dicotyledons, and in monocotyledon report compared with It is few.

The content of the invention

At present, the domestic research formed to SABATH transmethylases with the fragrance of a flower is rarely reported, before present patent application Do not find to ginger benzenoid form esters floral base because report.Clone's floral base is because being before studying ginger fragrance of a flower formation mechenism Carry, theoretical foundation can be provided for the increase fragrance of a flower by disclosing the molecule mechanism that the ginger fragrance of a flower is formed.This is the method using genetic engineering Cultivate tool foundation for heavy florals new variety of plant and provide a brand-new approach.The purpose of the present invention is separation clone's middle carrying of ginger One control benzenoid form esters fragrance of a flower ingredient benzoic acid methyl esters geneHcBSMT。

Another object of the present invention is the protein for providing said gene coding..

Another object of the present invention is to provide the expression vector containing said gene.

It is also an object of the present invention to provide said gene in generation molecular labeling and its in seed selection fragrance of a flower kind Application, the application in transgenosis fragrance of a flower plant is cultivated, and said gene coding protein preparing essence and medicine In application.

The above-mentioned purpose of the invention that is achieved by the following technical programs：

A kind of ginger benzenoid form esters floral base becauseHcBSMT, the full length cDNA sequence such as SEQ ID NO of the gene:Shown in 1, Full length cDNA sequence grows 1422 bp；The full length DNA sequence of gene such as SEQ ID NO:Shown in 2, full length DNA sequence length 1797 bp。

Ginger benzenoid form esters floral base becauseHcBSMTAssign ginger flower methyl benzoate fragrance, and ginger benzenoid form Esters floral base becauseHcBSMTIn dulcet ginger tissue expression, do not expressed in the ginger tissue of British plain spirits, and its table Up to being in notable positive correlation with flower development process.The gene coded sequence（CDS）Such as SEQ ID NO：Shown in 3, totally 1134 bp, is pushed away Survey it and encode 377 amino acid, its sequence such as SEQ ID NO:Shown in 4, molecular weight of albumen is 43 kDa, in this gene order In have multiple conservative SAM and phenyl carboxylic acid's substrate binding site.DNA sequence dna length is 1506 bp, comprising 4 intrones, is divided Wei Yu not be the 82nd~167,306~405,679~785,1059~1140, clipped position meets " GT-AG methods Then ".

Meanwhile the present invention also provide a pair be used for expand ginger benzenoid form esters floral base becauseHcBSMTPrimer, primer Sequence such as SEQ ID NO:Shown in 5~6.

A kind of recombinant vector, comprising above-mentioned ginger benzenoid form esters floral base becauseHcBSMT。

A kind of recombinant bacterium for including recombinant vector described in claim 5.

A kind of cell line for including recombinant vector described in claim 5.

Ginger benzenoid form esters floral base of the present invention becauseHcBSMTThe protein of coding can urge in vitro or in plant Change benzoic acid and SAM reaction generation methyl benzoates, be catalyzed salicylic acid and SAM reaction generation gaultherolins, its at 25 °C and The catalytic activity of maximum is shown under the conditions of pH 6.5, to substrate benzoic acid and salicylicKM values are respectively 87.73 ± 7.03 With 26.73 ± 3.88 μM.

Ginger benzenoid form esters floral base as described above becauseHcBSMTApplication, specially by the ginger benzenoid form esters fragrance of a flower GeneHcBSMTIt is connected in plant conversion carrier, is then introduced into ginger or other plant cells, obtains and express the ginger Benzenoid form esters floral base becauseHcBSMTTool fragrance of a flower transformed variety.

Ginger benzenoid form esters floral base as described above becauseHcBSMTApplication, specially according to the gene produce specificity Molecular labeling, for identify with the benzenoid form esters fragrance of a flower Hedychium Koenig filial generation.

Ginger benzenoid form esters floral base as described above becauseHcBSMTThe protein of coding is in essence and/or medicine is prepared Application.

The present invention equally includes willHcBSMTFloral base because dominant structural moieties effectively connect upper suitable regulation sequence The formed mosaic gene of row, and the seed of the plant comprising this gene and this plant in genome.This gene It can be natural or be fitted together to.For example, the fragment comprising the gene is connected with the promoter of a constitutive expression, should Promoter can be expressed with any period of cell development in any condition.The promoter of this constitutive expression includes flower coconut palm 35S promoter of cauliflower mosaic virus etc..On the other hand, can also by the promoter of the gene and tissue specific expression or The specific expressed promoter of developmental stage or the promoter connection of precise circumstances induction, these promoters are referred to as induction type startup Son.Therefore, the change of environment, the difference of developmental stage can change the expression of the gene, equally, can also be by the gene Expression is limited in some tissue, and the Resistant reaction for making to be induced by the gene obtains artificial control.Wherein environmental condition bag Attack, high/low temperature and light containing pest and disease damage etc., tissue and developmental stage include leaf, fruit, seed and flower etc..

According to provided by the inventionHcBSMTGene sequence information, those skilled in the art can be easy by the following method Ground obtain withHcBSMTEquivalent gene：（1）Obtained by database retrieval；（2）WithHcBSMTGenetic fragment is screened for probe The genomic library or cDNA library of ginger or other plants obtain；（3）According toHcBSMTGene sequence information designs few nucleosides Sour primer, obtained with the PCR methods expanded from the genome of ginger or other kindred plants, mRNA and cDNA；（4）HcBSMTTransformed and obtained with gene engineering method on the basis of gene order；（5）The gene is obtained with the method for chemical synthesis.

Ginger floral base provided by the invention becauseHcBSMTWith important application value.Using one of be will be describedHcBSMTGene order is connected to any plant conversion carrier, will with any method for transformationHcBSMTFloral base is because leading Enter ginger or other plant cell, the transfer-gen plant of the tool fragrance of a flower can be obtained, so as to applied to production.Gene of the present invention It is building up in plant conversion carrier, the gene or its regulating and controlling sequence can be suitably modified, can also be close in its transcription initiation Substitute the original promoter of gene with other promoters before numeral, plant produces the fragrance of a flower and enhancing is anti-so as to widen and strengthen The ability of property.

Floral base provided by the invention because another application be to produce specific point according to the gene sequence information Son mark, including but not limited to SNP（Mononucleotide polymorphic）、SSR（Simple sequence repeats are polymorphic）、RFLP（Restriction enzyme Length is polymorphic）、CAP（It is polymorphic to cut amplified fragments）.With these marks can identify the floral base of Hedychium Koenig and its hybrid generation because Type, for molecular marker assisted selection breeding, so as to improve the efficiency of selection of breeding.

Compared with prior art, the invention has the advantages that：

Present invention obtains ginger benzenoid form esters floral base becauseHcBSMTIt is that ginger fragrance of a flower principal component methyl benzoate biology closes Into the key gene with release；The protein of the gene code can be catalyzed benzoic acid and SAM reactions in vitro or in plant Methyl benzoate is generated, is catalyzed salicylic acid and SAM reaction generation gaultherolins；By plant of the floral base because being transferred to no fragrance of a flower Thing, help to create new fragrance of a flower plant.Particularly can use transformation technology in plant add up multiple floral bases because, without Produce with the chain problem of bad gene in the genome occurred in traditional breeding technology, and breeding time can be shortened. Floral base because clone be overcome in traditional breeding method can not plant inter-species shift floral base because the problem of premise.In addition, this Invention can further provide for or the transfer-gen plant using the fragrance of a flower obtained using above-mentioned DNA fragmentation and corresponding seed, with And with the gene of the present invention or recombinant based on the gene plant converted or the seed obtained by this kind of plant.Can be with having Property hybridization mode by the present invention gene be transferred to other plant.

Brief description of the drawings

Fig. 1 be methyl benzoate Jiang Huazhong release rule andHcBSMTGene expression analysis；A：Methyl benzoate In the release rule of ginger Different Organs；B：Release rule of the methyl benzoate in different flower growth periods；C：HcBSMTIn ginger The expression analysis of flower Different Organs；D：HcBSMTIn the expression analysis of petal different development stage；SS：Style and column cap；A：Flower Medicine；F：Filigree；L：Lip；LP：Side lobe；Se：Sepal；Pe：Bennet；B：Bract；Le：Blade；Ri：Rhizome.

Fig. 2 is the outer functional analysis of HcBSMT recombinant protein bodies；A and B：HcBSMT is catalyzed benzoic acid（BA）And salicylic acid（SA） Generate the total ion chromatogram and mass spectrogram of product；C：The total ion chromatogram and mass spectrogram of methyl benzoate；D：Salicylic acid first The total ion chromatogram and mass spectrogram of ester；E and F：Empty vector control.

Fig. 3 is that HcBSMT functions are identified in tobacco leaf instantaneous conversion；A and B：EGFP as negative control,；C and D：Tobacco Blade instantaneous conversionHcBSMTAnd injection benzoic acid（BA）And salicylic acid（SA）Substrate generates the selection chromatography of ions figure of product；E： The selection chromatography of ions figure of methyl benzoate；F：The selection chromatography of ions figure of gaultherolin.

Fig. 4 is the biochemical analysis of HcBMST albumen；A：Impact analysis of the temperature to HcBMST catalytic activity；B：PH pairs The impact analysis of HcBMST catalytic activity；C：HcBMST is catalyzed the enzyme kinetic analysis of substrate benzoic acid；D：HcBMST is catalyzed bottom The enzyme kinetic analysis of thing benzoic acid.

Embodiment

The present invention is further described with specific embodiment below in conjunction with the accompanying drawings.Unless stated otherwise, adopted in embodiment Reagent and method are reagent commonly used in the art and method.

Embodiment 1HcBSMTThe acquisition of gene cDNA and DNA total lengths

S1. ginger petal RNA extraction：Ginger petal RNA extraction uses Trizol methods.0.1 g petal materials are weighed in liquid Rapid grind into powder in nitrogen, it is transferred in the centrifuge tube containing 1.0 ml Trizol, acutely vibration mixes, and is stored at room temperature 5 min.5 min are centrifuged in 4 °C of 12,000 g.Careful Aspirate supernatant, move into new centrifuge tube, add 200 μ l chloroforms, lid Tight centrifugation lid, mixes to emulsifying soln and is creamy white, be stored at room temperature 5 min.12,000 4 °C of g centrifuge 15 min.Draw Supernatant is transferred in another new centrifuge tube, adds isometric isopropanol, after the centrifuge tube that turns upside down fully mixes, at room temperature Stand 10 min.12,000 4 °C of g centrifuge 10 min.Careful supernatant discarding, with 75% ethanol, wash precipitation 2~3 times, 7,500 After 4 °C of 5 min of centrifugation of g, careful supernatant discarding.Open centrifugation lid, drying at room temperature precipitation a few minutes.After precipitation is dried, add Appropriate RNase-free water dissolving precipitation.

S2. the synthesis of the chains of cDNA first：Using ginger petal total serum IgE as template, M-MLV reverse transcriptase synthesis the is utilized One chain cDNA.1000 ng Total RNA, 1 μ l Oligo d (T) are added in microcentrifugal tube₁₈ Primers、1 μl DNTP (10 mM each), supplement RNase-Free H₂O to 10 μ l.Gently mix, after centrifuging the several seconds, 70 °C of water-baths 10 Min, the immediately min of ice bath 2.Sequentially add 4 μ l 5 × M-MLV buffer, 0.5 μ l RNase Inhitor (40 U/ μ L), 1 μ l M-MLV reverse transcriptase, supplement RNase-Free H₂O to 20 μ l.Slightly centrifuge, 42 °C of min of water-bath 60,70 °C of water 15 min inactivation reverse transcriptases are bathed, the min of cooled on ice 2, -20 °C save backup.

S3.cDNA full-length clones：Synthetic gene full-length clone primer HcBSMT-F：CCCGTAGTTCCATGCTCCAT, such as SEQ ID NO:Shown in 5；HcBSMT-R：GTTTCAATTTACGTCCACATCAGC, such as SEQ ID NO:Shown in 6.With ginger CDNA is template, using high-fidelity DNA polymerase KOD-plus（TOYOBO）Carry out pcr amplification reaction.Reaction condition is：94° C, the min of pre-degeneration 3；98 °C, 10 s are denatured, 68 °C, the min of annealing/extension 2,40 circulate；Last 68 °C, extend 10 min. 1.0% Ago-Gel is made using TBE buffer solutions, PCR primer is then entered into row agarose gel electrophoresis, under uviol lamp The Ago-Gel containing target DNA is cut out, the glue reclaim kit that work is given birth to using Shanghai carries out glue reclaim, is washed using 40 μ l De- liquid elution recovery product.Use rTaq archaeal dna polymerases（TaKaRa）Recovery product is carried out plus A end reactions, reaction condition are 72 °C of 30 min of insulation.Connection carrier uses pMD19-T（TaKaRa）, 16 °C of connections are overnight.By 10 μ l connection products and 100 μ l competent escherichia coli cell DH5 α are mixed, the min of ice bath 30.42 °C of heat shocks 90 s, the rapid min of ice bath 2.Add 1 ml liquid Body LB, mix and shake 1 h after 37 °C of shaking tables.Supernatant is removed in centrifugation, in the LB solid medium flat boards containing 100 μ g/ml Amp Surface applies 40 μ l X-gal（20 mg/ml）With 4 μ l IPTG（200 mg/ml）, then it is coated with appropriate conversion fluid.37 °C are fallen Put the h of culture 12~16.It is inoculated in the pipette tips of sterilizing from picking white single bacterium colony on LB solid mediums containing 100 μ g/mL In Amp LB fluid nutrient mediums, in 37 °C on temperature controlled water bath shaking table, 180 rpm are incubated overnight.Plasmid using Shanghai life work is small Extraction reagent kit extracts the plasmid for being incubated overnight bacterium, and double digestion identification is carried out to extracted plasmid.Using M13 sequencing primers to sun Property clone carry out sequencing analysis, obtainHcBSMTThe full length cDNA sequence of gene, such as SEQ ID NO:Shown in 1, its coded sequence （CDS）Such as SEQ ID NO:Shown in 3, thus it is speculated that its protein amino acid sequence, such as SEQ ID NO:Shown in 4.

S4. DNA sequence dna is cloned：Use plant genome DNA extracts kit（TIANGEN）Extract ginger petal or leaf Piece genomic DNA.Using with identical cloning primer in S3, using genomic DNA as template, KOD-plus polymerize enzyme effect under Enter performing PCR amplification, PCR reaction conditions and the same S3 of subsequent cloning steps, obtainHcBSMTGenomic dna sequence, such as SEQ ID NO:Shown in 2.

The ginger benzenoid form esters fragrance of a flower substance-measuring of embodiment 2 andHcBSMTGene expression analysis

S1. ginger benzenoid form esters fragrance of a flower substance-measuring：Testing sample is sealed in and surveyed in device of air, while adds 1.728 μ g Certain herbaceous plants with big flowers acetoacetic ester after collecting flower aroma substance and the min of internal standard substance 30, inserts 50/30 μm of DVB/CAR/PDMS as internal standard Extracting head（Supelco）30 min are extracted, GC-MS detections is then carried out and weighs sample.Gas-chromatography（Agilent 7890A GC systerm）Condition is：Chromatographic column is HP-5MS (30 m × 0.25 μm)；Carrier gas is high-purity helium, and injector temperature is 250 °C, Splitless injecting samples, the ml/min of column flow 1, the parsing time is 3 min.Temperature programming：40 °C of post initial temperature, keep 2 Min, 250 °C of 5 min of holding are risen to 10 °C/min speed.Mass spectrum（Agilent 5975C MSD）Condition is：Interface temperature 220 °C of degree, electron bombardment ionization source EI voltages are 1000 V, 230 °C of ion source temperature, the eV of electron energy 70, quality of scanning scope 50 ~335 aum, the Information in Mass Spectra collected carry out the matching analysis using NIST storehouses Plays mass spectrum.Fragrance component calculation formula For：Constituent content（μg•gFW^-1•h^-1）=internal standard quality × component peak area/internal standard compound peak area/flower fresh weight.

S2.HcBSMTGene expression analysis：Use plant total RNA extraction reagent box（Magen）Carry out the different portions of ginger The extracting of position sample total serum IgE；Using the total serum IgE of Trizol methods extracting petal different development stage sample, specific method is the same as " implementation The S1 of example 1 ".1 μ g total serum IgEs are taken to utilize PrimeScript reverse transcription reagent box（TaKaRa）RNA reverse transcriptions are carried out, by reverse transcription It is used for real-time fluorescence quantitative PCR after 20 times of the cDNA product dilutions of gained.Existed using the softwares of Primer Premier 5.0HcBSMT3 ' the non-translational regions design fluorescence quantification PCR primer of gene, sense primer F：AGGAGAAAGCCAATCACACC, such as SEQ ID NO:Shown in 7；Anti-sense primer R：GGCATGATTCAGTTTGACAAG, such as SEQ ID NO:Shown in 8.Primer it is special Property by gel electrophoresis, sequencing and solubility curve examine, use calibration curve method detection each pair primer amplification efficiency and correlation Coefficient.Experiment uses ABI7500 quantitative fluorescent PCR systems, and reaction system is 20 μ l, wherein including 10 μ l iTaq Universal SYBR Green Supermix (Bio-Rad), 0.2 μM of up/down trip primer, 2 μ l cDNA templates and appropriate Pure water.Response procedures are 95 °C of pre-degeneration 30 s, subsequent 95 °C of denaturation 15 s, 55 °C of annealing 30 s, 72 °C of extension 30 s, 40 Circulation, solubility curve program are since 60 °C, with 1% programming rate to 95 °C.Each sample carries out technology three times and repeated. Ginger different parts expression analysis is screened using early stageACTAt the homogenization that sample room gene expression is carried out as reference gene Reason, sense primer F：GTATGTTGCTATTCAGGCTGTCC, such as SEQ ID NO:Shown in 9；Anti-sense primer R： GAAGAATGGCATGAGGTAGAGC, such as SEQ ID NO:Shown in 10.Before ginger petal different development stage expression analysis use Phase screeningRPSThe homogenization processing of sample room gene expression, sense primer F are carried out as reference gene： TTAGTAGCATCGGCTGCAATAAG, such as SEQ ID NO:Shown in 11；Anti-sense primer R：CTCTTTTGGGAAGACGGTTGAG, Such as SEQ ID NO:Shown in 12.Using 2^{- △ △ Ct}Method（Livak et al., 2001）Calculate relative expression's feelings of different sample rooms Condition.

Benzenoid form esters fragrance of a flower substance-measuring and gene expression analysis result are shown in Fig. 1.As can be seen from the figure：The ginger fragrance of a flower Main benzenoid form esters fragrance of a flower material in composition is methyl benzoate.The main release position of methyl benzoate is side lobe, lip Valve, sepal and filigree, in addition, style and column cap, flower pesticide and bennet also have a small amount of release, and bract, blade and rhizome then detect Less than the release of methyl benzoate.During flower development, bud stage（0~16 h）It is nearly no detectable releasing for methyl benzoate Put, the phase is opened just（24 h）There is micro methyl benzoate detection, the phase in full bloom is opened into what is blossomed（40 h）Methyl benzoate Burst size gradually increase, and 48 h and 56 h burst size decrease, in declining period（64 h）Methyl benzoate burst size Reach highest.Quantitative fluorescent PCR analysis shows,HcBSMTGene is in floral organ specifically expressing, wherein in lip, side lobe and sepal Middle expression quantity is higher, and at non-floral organ position（Bract, blade and rhizome）Hardly express.During flower development,HcBSMTGene is not almost expressed in 0 h to 24h petal growth courses；From the petal half-open phase（32 h）Start, gene table Up to increasing sharply, in phase in full bloom and declining period（40~64 h）Keep higher expression.Result above shows,HcBSMTBase The expression of cause and the release of methyl benzoate are in extremely significantly correlated, explanationHcBSMTIt is the life of ginger fragrance of a flower principal component methyl benzoate Thing synthesizes and the key gene of release.

The external functional analyses of the HcBSMT of embodiment 3

S1. vector construction：According toHcBSMTThe cDNA sequence of gene, design includeEcoRI andNotThe special of I restriction enzyme sites is drawn Thing, sense primer F：GAATTCATGGGTTTGAAGGTGGAGCA, such as SEQ ID NO:Shown in 13；Anti-sense primer R：GCGGCCGCATACTCTTTTCTTCAAGGCAA TGAC, such as SEQ ID NO:Shown in 14.Entered using high-fidelity enzyme KOD-plus Performing PCR expands, and after amplified production is reclaimed, and pET-30a carriers are simultaneously in 37 °C of lower h of double digestion 3, digestion terminate after by DNA Fragment is purified.Purpose fragment after purification and carrier are utilized into T4 DNA ligases, carry out staying overnight connection at 16 °C, by even Thing of practicing midwifery is transformed intoE.coliDH5 α competence, after sequencing determination is errorless, recombinant plasmid is transferred to Rosetta2（DE3）pLysS Bacterial strain.

S2. expression of recombinant proteins and purifying：Picking single bacterium colony is inoculated in 5 ml LB（Containing 50 mg/l Kan, 34 mg/l Chl）In fluid nutrient medium, 37 °C of concussion and cultivates are stayed overnight.100 μ l seed liquors transfer in 100 fresh ml（Containing 50 mg/l Kan, 34 mg/l Chl）LB fluid nutrient mediums in, 37 °C of 180 rpm cultivate to OD values be 0.4~0.6, add 0.02 mM IPTG, 16 °C of 24~48 h of induction.Thalline is collected by centrifugation, with 5 ml lysis buffers（50 mM NaH₂PO₄, 300 mM NaCl, 10 mM imidazoles, pH 8.0）Suspension cell, be placed on ice ultrasonic disruption cell three times, 5 min every time.12000 rpm, 4 °C 10 min are centrifuged, supernatant are moved in new centrifuge tube, clean precipitation once with distilled water, then suspended with 5 ml lysis buffers Precipitation.Take supernatant to precipitate each 15 μ l respectively, carry out SDS-PAGE electrophoretic analysis.

S3. recombinant protein purification：Load 0.5 ml Ni-NTA His Bind Resins in chromatographic column（novagen）, 4 °C vertically stand overnight, and after resin precipitated is good, drain off internal liquid, add 5 ml distilled water, rinse 5~10 repeatedly It is secondary, 4 °C of precoolings.5 ml cells cracking supernatant is added in the chromatographic column of precooling, fully mixed, and low speed is on 4 °C of shaking tables With reference to 1 h.Liquid is flowed out, is collected in 15 ml centrifuge tubes, takes 15 μ l efflux, carries out SDS-PAGE analyses.Add 4 Ml lavation buffer solution（50 mM NaH₂PO₄, 300 mM NaCl, 20 mM imidazoles, pH 8.0）, wash chromatographic column twice, receive Cleaning solution of the collection per part, labeled as W1, W2,15 μ l are respectively taken to carry out SDS-PAGE analyses.Respectively with 0.5 ml elution buffer Liquid（50 mM NaH₂PO₄, 300 mM NaCl, 250 mM imidazoles, pH 8.0）Wash post four times, respectively with different collecting pipes according to The secondary eluent collected per part, is respectively labeled as E1, E2, E3, E4, respectively takes 15 μ L to carry out SDS-PAGE analyses.According to SDS- PAGE testing result, the higher elution fraction of purity and concentration is transferred in bag filter with pipettor, 4 °C are dialyzed overnight 2 It is secondary.Standard curve is made using bovine serum albumin, determines the protein concentration of purification of samples.

S4. enzymatic Function Identification：1 ml reaction solutions are prepared in glass reaction bottle（50 mM Tris-HCl, pH 7.0, 0.2 mM SAM, 100 mM KCl, 2 mM benzoic acid or salicylic acid and the recombinant protein of 10 μ g purifying）, after sealing, 25 °C of water Bathe 1 h.By 50/30 μm of DVB/CAR/PDMS extracting head（Supelco）Insert in the reaction bulb of sealing, 50 °C of water-bath head spaces are consolidated After the min of phase extraction 30, extracting head is inserted in GC-MS injection ports and analyzed, gas-chromatography and Mass Spectrometry Conditions are the same as " implementation The S1 of example 2 ".Methylate species is determined by the retention time and mass spectrogram that compare reaction product and standard items.

S5. enzymatic activity is analyzed：The standard reaction system and the same S4 of reaction condition of enzymatic activity analysis, by reaction solution It is placed under condition of different temperatures, influence of the analysis different temperatures to enzymatic activity.Prepare different pH 50 mM Tris-HCl Buffer solution, analyze influences of the different pH to enzymatic activity.Respectively with the benzoic acid of various concentrations（0~500 μM）And salicylic acid （0~500 μM）For substrate, HcBSMT is to substrate benzoic acid and salicylic enzyme kinetic properties for analysis.

Enzymatic functional analysis and catalytic activity analysis result are shown in Fig. 2 and 4.As can be seen from Figure 2：HcBSMT can be catalyzed benzene Formic acid and SAM reaction generation methyl benzoates, can also be catalyzed salicylic acid and SAM reacts and generates gaultherolin, and blank control Then detected without methylate, it is benzoic acid/salicylic acid methyltransferase to illustrate HcBSMT.As can be seen from Figure 4：HcBSMT exists The enzymatic activity of maximum is shown under the conditions of 25 °C and pH 6.5, to substrate benzoic acidKM values are 87.73 ± 7.03 μM, right Substrate is salicylicKM values are 26.73 ± 3.88 μM.

Embodiment 4HcBSMTInstantaneous conversion tobacco leaf

S1. vector construction and Agrobacterium-mediated Transformation：According toHcBSMTThe cDNA sequence of gene, design includeSacI andKpnI digestions position The special primer of point, sense primer F：GAGCTCATGGGTTTGAAGG TGGAGCA, such as SEQ ID NO:Shown in 15；Draw in downstream Thing R：GGTACCTTATACTCTTTTCTTC AAGGCAATG, such as SEQ ID NO:Shown in 16.Utilize high-fidelity enzyme KOD-plus Enter performing PCR amplification, after amplified production is reclaimed, double digestion is connected into pGreenII 62-SK carriers, converts DH5 α, and sequencing determines nothing After by mistake, recombinant plasmid is transferred to Agrobacterium GV3101psoup bacterial strains.

S2. Agrobacterium culture and tobacco instantaneous conversion：Picking Agrobacterium single bacterium colony is inoculated in containing Rif（50 μg/ml）+ Kan（50 μg/ml）LB fluid nutrient mediums in, 28 °C of 200 rpm concussion and cultivates ~ 24h.5,000 g centrifuge 10 min, abandon Clearly, with after pure water suspension bacteria liquid, 5,000 g centrifuge 10 min, abandon supernatant.Use permeabilization buffer（10 mM MES, pH 5.2,10 mM MgCl₂, 0.1 mM acetosyringones）Agrobacterium is resuspended to OD₆₀₀About 0.4,3 h are placed at room temperature.1 ml needle-less is noted Emitter draws agrobacterium suspension and carries out infiltration dip-dye to tobacco leaf, is positioned over after infecting in culturing room and continues to cultivate.

S3. tobacco leaf volatilization analyte detection：After cultivating 3 d, with 1 ml needleless injectors to having contaminated the cigarette of Agrobacterium Blade of grass piece infiltration 1 mM benzoic acid of injection or salicylic acid, whole strain tobacco are enclosed within 500 ml vial, SPME The h of method extracted tobacco volatile matter 6~12, GC-MS analyses, gas-chromatography and Mass Spectrometry Conditions are then carried out with " S1 of embodiment 2 ".It is logical Cross and compare the retention time and mass spectrogram of reaction product and standard items and determine the species of methylate.

The testing result of the volatile constituent of tobacco leaf is shown in Fig. 3, as can be seen from Figure 3：After instantaneous conversion EGFP, fluorescence It is observed that substantial amounts of green florescent signal, illustrates that this transformation system has higher transformation efficiency under microscope.It is instantaneous to turn ChangeHcBSMTGene, while after injecting substrate benzoic acid, a large amount of methyl benzoates generations can be detected in leaf volatiles；Wink When convertHcBSMTGene, while after injecting substrate salicylic acid, a large amount of gaultherolins lifes can be detected in leaf volatiles Into.Illustrate that HcBSMT also has catalysis benzoic acid generation methyl benzoate, catalysis salicylic acid generation salicylic acid first in plant The function of ester.

Sequence table

<110>Agricultural University Of South China

<120>A kind of ginger benzenoid form esters floral base is because of HcBSMT and its application

<130> 1713511ZBSH042

<141> 2017-10-17

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1422

<212> DNA

<213>Lily (Lilium brownii var. viridulum)

<400> 1

cccgtagttc catgctccat aaacctcaca tttcatactc accaaatcct caggccctca 60

gaagagtgtg tgtgtgagag agagggagaa agatgggttt gaaggtggag caagctcttc 120

acatggttgg gggttctggt gaaactagct acgccaccaa ctcgagactc caagagaagg 180

cgatctatcg aacgaagcct gtgttggcga ccaccatcga agaaatgtat aaagggttgc 240

tccctgagca tatggtcgtt gttgatcttg gttgctcttc tggttctaac acattcattg 300

tggtctctca ggtactcgac atcattgttg aactccgtcg tatgatggag atgaagaagc 360

cattggaggt gcaattcttc ttgaacgacc tcccagggaa tgacttcaac tatgtctttc 420

aatccctaga taagttcaag aacaaggtgg aggaggagag taagggggag ttgttggtgc 480

cgtattatgt ggtcggagtg gcaggatcat tctacgggag gcttttccct tgcgcgagtg 540

tccatttctt tcattcttcc tattgtctaa tgtggctctc acaggtcccc gaagagctag 600

agaacgacca aggtgtttca ctaaataaag gaaatatcta ttggacagaa acaagttcgt 660

cccaagtaga aaaagcatat cgagagcaat ataagaaaga ctttttgaca tttcttaggt 720

caagatatat agaactaaac attggaggtg gaatgatgtt gacatttcta ggaagaagaa 780

aaagaactcc cggtcacggt gacttatgtc atctttggag actacttgca gaagctctta 840

actcgatggt cttagaggaa atcataccag aagaaaaagt tagcaccttc aatttgccaa 900

tttacggacc ttcacttgaa gaggtgaagt ctataatcca tcacgaagga ttattcgatt 960

tggatcgagt agagatcttt gaatccagtt gggatccatt tgacgattca ggagatgatt 1020

cttttgatct atcaaactat acaaaaagtg cgaaaaatgt ggcggattgc attcgggctg 1080

tggtcgaacc cttgattgtg catcaatttg gagatgtcat acttgatgat ttattcacaa 1140

gatacgcgca gaatgttctg aaacaccttc tcaaggagaa agccaatcac accattttag 1200

tcattgcctt gaagaaaaga gtataaaatt cagcaaggaa aataaaggag aataaatatt 1260

ctgcaagaga atttgttatt attatcattc tcaaattagt tctcatgtga atctttttcg 1320

tttccttgtc aaactgaatc atgcccatcc taaaaatcaa gcattagata tgatcaaatt 1380

ttatatgata attttaaagc tgatgtggac gtaaattgaa ac 1422

<210> 2

<211> 1797

<212> DNA

<213>Lily (Lilium brownii var. viridulum)

<400> 2

cccgtagttc catgctccat aaacctcaca tttcatactc accaaatcct caggccctca 60

gaagagtgtg tgtgtgagag agagggagaa agatgggttt gaaggtggag caagctcttc 120

acatggttgg gggttctggt gaaactagct acgccaccaa ctcgagactc caagtcgatc 180

aatgcaactc tctaaattgt attttctttt agtatctaaa tttataagta gattttgatt 240

atcatgtata catgctcagg agaaggcgat ctatcgaacg aagcctgtgt tggcgaccac 300

catcgaagaa atgtataaag ggttgctccc tgagcatatg gtcgttgttg atcttggttg 360

ctcttctggt tctaacacat tcattgtggt ctctcaggta aataggatgc tactccttga 420

gcaaattatg atcattgttg attttagttg ctcttttggt cctaactcct aacatattcc 480

ttgtggtctc tgatcaggta ctcgacatca ttgttgaact ccgtcgtatg atggagatga 540

agaagccatt ggaggtgcaa ttcttcttga acgacctccc agggaatgac ttcaactatg 600

tctttcaatc cctagataag ttcaagaaca aggtggagga ggagagtaag ggggagttgt 660

tggtgccgta ttatgtggtc ggagtggcag gatcattcta cgggaggctt ttcccttgcg 720

cgagtgtcca tttctttcat tcttcctatt gtctaatgtg gctctcacag gtacttaatt 780

aatctctctc taatagtata gtatcgacca actttaatat acataatact ttttcttctt 840

aattttacta atcatatata atttgaatct attataggtc cccgaagagc tagagaacga 900

ccaaggtgtt tcactaaata aaggaaatat ctattggaca gaaacaagtt cgtcccaagt 960

agaaaaagca tatcgagagc aatataagaa agactttttg acatttctta ggtcaagata 1020

tatagaacta aacattggag gtggaatgat gttgacattt ctaggaagaa gaaaaagaac 1080

tcccggtcac ggtgacttat gtcatctttg gagactactt gcagaagctc ttaactcgat 1140

ggtcttagag gtttgtattt aactaatttt atgattaaat atgtaaaaat gactgcaact 1200

aatgttgatt tttttttcct atatgtattt aggaaatcat accagaagaa aaagttagca 1260

ccttcaattt gccaatttac ggaccttcac ttgaagaggt gaagtctata atccatcacg 1320

aaggattatt cgatttggat cgagtagaga tctttgaatc cagttgggat ccatttgacg 1380

attcaggaga tgattctttt gatctatcaa actatacaaa aagtgcgaaa aatgtggcgg 1440

attgcattcg ggctgtggtc gaacccttga ttgtgcatca atttggagat gtcatacttg 1500

atgatttatt cacaagatac gcgcagaatg ttctgaaaca ccttctcaag gagaaagcca 1560

atcacaccat tttagtcatt gccttgaaga aaagagtata aaattcagca aggaaaataa 1620

aggagaataa atattctgca agagaatttg ttattattat cattctcaaa ttagttctca 1680

tgtgaatctt tttcgtttcc ttgtcaaact gaatcatgcc catcctaaaa atcaagcatt 1740

agatatgatc aaattttata tgataatttt aaagctgatg tggacgtaaa ttgaaac 1797

<210> 3

<211> 1134

<212> DNA

<213>Lily (Lilium brownii var. viridulum)

<400> 3

atgggtttga aggtggagca agctcttcac atggttgggg gttctggtga aactagctac 60

gccaccaact cgagactcca agagaaggcg atctatcgaa cgaagcctgt gttggcgacc 120

accatcgaag aaatgtataa agggttgctc cctgagcata tggtcgttgt tgatcttggt 180

tgctcttctg gttctaacac attcattgtg gtctctcagg tactcgacat cattgttgaa 240

ctccgtcgta tgatggagat gaagaagcca ttggaggtgc aattcttctt gaacgacctc 300

ccagggaatg acttcaacta tgtctttcaa tccctagata agttcaagaa caaggtggag 360

gaggagagta agggggagtt gttggtgccg tattatgtgg tcggagtggc aggatcattc 420

tacgggaggc ttttcccttg cgcgagtgtc catttctttc attcttccta ttgtctaatg 480

tggctctcac aggtccccga agagctagag aacgaccaag gtgtttcact aaataaagga 540

aatatctatt ggacagaaac aagttcgtcc caagtagaaa aagcatatcg agagcaatat 600

aagaaagact ttttgacatt tcttaggtca agatatatag aactaaacat tggaggtgga 660

atgatgttga catttctagg aagaagaaaa agaactcccg gtcacggtga cttatgtcat 720

ctttggagac tacttgcaga agctcttaac tcgatggtct tagaggaaat cataccagaa 780

gaaaaagtta gcaccttcaa tttgccaatt tacggacctt cacttgaaga ggtgaagtct 840

ataatccatc acgaaggatt attcgatttg gatcgagtag agatctttga atccagttgg 900

gatccatttg acgattcagg agatgattct tttgatctat caaactatac aaaaagtgcg 960

aaaaatgtgg cggattgcat tcgggctgtg gtcgaaccct tgattgtgca tcaatttgga 1020

gatgtcatac ttgatgattt attcacaaga tacgcgcaga atgttctgaa acaccttctc 1080

aaggagaaag ccaatcacac cattttagtc attgccttga agaaaagagt ataa 1134

<210> 4

<211> 377

<212> PRT

<213>Lily (Lilium brownii var. viridulum)

<400> 4

Met Gly Leu Lys Val Glu Gln Ala Leu His Met Val Gly Gly Ser Gly

1 5 10 15

Glu Thr Ser Tyr Ala Thr Asn Ser Arg Leu Gln Glu Lys Ala Ile Tyr

20 25 30

Arg Thr Lys Pro Val Leu Ala Thr Thr Ile Glu Glu Met Tyr Lys Gly

35 40 45

Leu Leu Pro Glu His Met Val Val Val Asp Leu Gly Cys Ser Ser Gly

50 55 60

Ser Asn Thr Phe Ile Val Val Ser Gln Val Leu Asp Ile Ile Val Glu

65 70 75 80

Leu Arg Arg Met Met Glu Met Lys Lys Pro Leu Glu Val Gln Phe Phe

85 90 95

Leu Asn Asp Leu Pro Gly Asn Asp Phe Asn Tyr Val Phe Gln Ser Leu

100 105 110

Asp Lys Phe Lys Asn Lys Val Glu Glu Glu Ser Lys Gly Glu Leu Leu

115 120 125

Val Pro Tyr Tyr Val Val Gly Val Ala Gly Ser Phe Tyr Gly Arg Leu

130 135 140

Phe Pro Cys Ala Ser Val His Phe Phe His Ser Ser Tyr Cys Leu Met

145 150 155 160

Trp Leu Ser Gln Val Pro Glu Glu Leu Glu Asn Asp Gln Gly Val Ser

165 170 175

Leu Asn Lys Gly Asn Ile Tyr Trp Thr Glu Thr Ser Ser Ser Gln Val

180 185 190

Glu Lys Ala Tyr Arg Glu Gln Tyr Lys Lys Asp Phe Leu Thr Phe Leu

195 200 205

Arg Ser Arg Tyr Ile Glu Leu Asn Ile Gly Gly Gly Met Met Leu Thr

210 215 220

Phe Leu Gly Arg Arg Lys Arg Thr Pro Gly His Gly Asp Leu Cys His

225 230 235 240

Leu Trp Arg Leu Leu Ala Glu Ala Leu Asn Ser Met Val Leu Glu Glu

245 250 255

Ile Ile Pro Glu Glu Lys Val Ser Thr Phe Asn Leu Pro Ile Tyr Gly

260 265 270

Pro Ser Leu Glu Glu Val Lys Ser Ile Ile His His Glu Gly Leu Phe

275 280 285

Asp Leu Asp Arg Val Glu Ile Phe Glu Ser Ser Trp Asp Pro Phe Asp

290 295 300

Asp Ser Gly Asp Asp Ser Phe Asp Leu Ser Asn Tyr Thr Lys Ser Ala

305 310 315 320

Lys Asn Val Ala Asp Cys Ile Arg Ala Val Val Glu Pro Leu Ile Val

325 330 335

His Gln Phe Gly Asp Val Ile Leu Asp Asp Leu Phe Thr Arg Tyr Ala

340 345 350

Gln Asn Val Leu Lys His Leu Leu Lys Glu Lys Ala Asn His Thr Ile

355 360 365

Leu Val Ile Ala Leu Lys Lys Arg Val

370 375

<210> 5

<211> 20

<212> DNA

<213>Lily (Lilium brownii var. viridulum)

<400> 5

cccgtagttc catgctccat 20

<210> 6

<211> 24

<212> DNA

<213>Lily (Lilium brownii var. viridulum)

<400> 6

gtttcaattt acgtccacat cagc 24

<210> 7

<211> 20

<212> DNA

<213>Lily (Lilium brownii var. viridulum)

<400> 7

aggagaaagc caatcacacc 20

<210> 8

<211> 21

<212> DNA

<213>Lily (Lilium brownii var. viridulum)

<400> 8

ggcatgattc agtttgacaa g 21

<210> 9

<211> 23

<212> DNA

<213>Lily (Lilium brownii var. viridulum)

<400> 9

gtatgttgct attcaggctg tcc 23

<210> 10

<211> 22

<212> DNA

<213>Lily (Lilium brownii var. viridulum)

<400> 10

gaagaatggc atgaggtaga gc 22

<210> 11

<211> 23

<212> DNA

<213>Lily (Lilium brownii var. viridulum)

<400> 11

ttagtagcat cggctgcaat aag 23

<210> 12

<211> 22

<212> DNA

<213>Lily (Lilium brownii var. viridulum)

<400> 12

ctcttttggg aagacggttg ag 22

<210> 13

<211> 26

<212> DNA

<213>Lily (Lilium brownii var. viridulum)

<400> 13

gaattcatgg gtttgaaggt ggagca 26

<210> 14

<211> 33

<212> DNA

<213>Lily (Lilium brownii var. viridulum)

<400> 14

gcggccgcat actcttttct tcaaggcaat gac 33

<210> 15

<211> 26

<212> DNA

<213>Lily (Lilium brownii var. viridulum)

<400> 15

gagctcatgg gtttgaaggt ggagca 26

<210> 16

<211> 31

<212> DNA

<213>Lily (Lilium brownii var. viridulum)

<400> 16

ggtaccttat actcttttct tcaaggcaat g 31

Claims (10)

1. a kind of ginger benzenoid form esters floral base becauseHcBSMT, it is characterised in that the full length cDNA sequence of the gene such as SEQ ID NO:Shown in 1；The full length DNA sequence of gene such as SEQ ID NO:Shown in 2；Gene coded sequence such as SEQ ID NO:Shown in 3.

2. ginger benzenoid form esters floral base described in a kind of claim 1 becauseHcBSMTThe protein of coding, it is characterised in that institute State the amino acid sequence such as SEQ ID NO of albumen:Shown in 4.

3. one kind be used for expand ginger benzenoid form esters floral base becauseHcBSMTPrimer pair, it is characterised in that primer pair sequence Such as SEQ ID NO:5~6, SEQ ID NO:13~14 or SEQ ID NO:Shown in 15~16.

4. one kind be used for detect ginger benzenoid form esters floral base becauseHcBSMTFluorescence quantification PCR primer, it is characterised in that institute State primer sequence such as SEQ ID NO:Shown in 7~8.

A kind of 5. recombinant vector, it is characterised in that comprising ginger benzenoid form esters floral base described in claim 1 becauseHcBSMT。

A kind of 6. recombinant bacterium for including recombinant vector described in claim 5.

A kind of 7. cell line for including recombinant vector described in claim 5.

8. ginger benzenoid form esters floral base described in claim 1 becauseHcBSMTApplication, it is characterised in that by ginger benzenoid form Esters floral base becauseHcBSMTIt is connected in plant conversion carrier, is then introduced into ginger or other plant cells, is expressed The ginger benzenoid form esters floral base becauseHcBSMTTransformed variety.

9. ginger benzenoid form esters floral base described in claim 1 becauseHcBSMTApplication, it is characterised in that according to the gene produce Raw specific molecular labeling, for identifying the Hedychium Koenig filial generation with the benzenoid form esters fragrance of a flower.

10. ginger benzenoid form esters floral base described in claim 2 becauseHcBSMTThe protein of coding is preparing essence and medicine In application.