JP2007517496A - Citrus sesquiterpene synthase, method for its production, and method of use - Google Patents

Abstract

  The present invention relates to citrus sesquiterpene synthases, which are important enzymes in the production of valencene, a sesquiterpene aromatic compound. Specifically, the present invention relates to a nucleic acid sequence encoding a valencene synthase derived from an angiosperm species, in particular from a citrus plant, a vector containing the sequence, a host cell containing the sequence, and a transgenic expressing the sequence. Related to plants. The invention further relates to a method of producing recombinant valencene synthase, its products and uses thereof.

Description

  The present invention relates to an important enzyme, citrus sesquiterpene synthase, in the production of valencene, a sesquiterpene aromatic compound. Specifically, the present invention relates to a nucleic acid sequence encoding a valencene synthase derived from an angiosperm species, in particular from a citrus plant, a vector containing the sequence, a host cell containing the sequence, and a transgenic expressing the sequence. It relates to plants and microorganisms. The invention further relates to a method of producing recombinant valencene synthase, its products and uses thereof.

  Flavor and aroma have always been important in human culture, many of which are derived from plants. Citrus plant species are listed as the most aromatic plants. The flavor and aroma of citrus plant species is composed of a complex combination of soluble compounds, mainly acids, sugars, and flavonoids, and volatile compounds. The latter usually consists of monoterpenes and sesquiterpenes, which are secondary metabolites obtained from the enzymatic activity of valencene synthase, which are the main components of citrus essential oil.

  The profiles of volatile terpenoids in various citrus plant species and their importance as aroma compounds are well known in the art. Efforts have been made to increase the level of volatile terpenoids in the citrus end product. For example, US Pat. No. 4,997,0085 discloses a method of making an improved aqueous citrus essence by fractionation process, in which the aqueous citrus essence is passed through a solid adsorbent whereby a portion of the essence compound is adsorbed. From the agent into the first effluent, part remains on the adsorbent surface, and then the first effluent is recirculated to the adsorbent to recover the fraction of the remaining compound, A second effluent is generated. U.S. Pat. No. 4,973,485 discloses aqueous orange stripper essence and orange stripper oil with a higher ratio of more desirable orange flavor compounds to less desirable orange flavor compounds, these essences and oils (1) reduce the raw orange juice stream to about Heating to a temperature of 37.7-71 ° C; (2) stripping the heated raw juice at 37.7-71 ° C and a stripping column pressure of less than 9 inches Hg in absolute pressure; (3) concentrating stripped volatile materials; (4) centrifuging the concentrate in a continuous stacked disk hermetic centrifuge to obtain a clear two phase; (5) Water Obtainable by a method comprising the steps of retrieving the orange stripper phase. The methods disclosed in U.S. Pat. Nos. 4,977,0085 and 4,973,485 are directed to the production of desirable essence and oil from citrus fruits, but citrus fruits containing a higher proportion of the desired oil and essence innately. It does not address the issue of providing.

  There are many disclosures on methods of synthesizing aromatic compounds, including US Pat. Nos. 5,847,226 and 6,200,806. U.S. Pat. No. 5,847,226 discloses a method for preparing nootkatone, nootkatol or mixtures thereof in vitro by oxidizing valencene in the presence of an unsaturated fatty acid hydroperoxide in a suitable reaction medium. U.S. Pat. No. 6,200,861 discloses a method for producing nootkatone in vitro, comprising: (a) reacting valencene with a composition having laccase activity in the presence of an oxygen source to produce valencene hydro Producing a peroxide; (b) decomposing the hydroperoxide to form a nootkatone; and (c) recovering the nootkatone. However, attempts to provide cells or organisms that can produce nootkatone at the desired level have never been disclosed at any level. Furthermore, the complete physiological and biochemical pathways for the production of aromatic compounds in plants, as well as genetic regulation remain unclear.

  Terpenoids are found in all plants and include phytoalexins, pest control substances, toxins, growth regulators, pollinator attractants, photosynthetic pigments, and electron acceptors. Have various physiological roles. US Pat. No. 6,258,602 discloses the isolation and bacterial expression of a peppermint cDNA clone of sesquiterpene synthase that produces E-betafarnesene, an aphid alarm pheromone.

  Following the priority date of the present application by the inventors of the present invention, the isolation and expression of Cstps1, a gene encoding sesquiterpene synthase, was described in Sharon-Asa et al. (The Plant Journal, 36: 664-674, 2003). This disclosure is incorporated herein by reference in its entirety. Sharon-Asa et al. Have shown that the recombinant enzyme encoded by Cstps1 converts farnesyl diphosphate into a single sesquiterpene product identified as valencene.

  Bryan T., University of Kentucky A Ph.D. thesis by Greenhagen outlines the cloning and use of ruby grapefruit valencene synthase. The paper became generally available after the priority date of this application.

  It is only recently that biochemical and genetic regulation of fruit aroma has gained greater interest. Of the genes involved in fruit aroma, only a few have been described, and therefore little is known about the regulation of aroma formation in fruit. Although the status of such research limits the potential of natural fruit fragrances for use by the agriculture, food and cosmetic industries, they are highly desirable for the products of these industries.

  Thus, the need for specific genetic components involved in regulatory pathways directed at fruit aroma formation has been recognized and their identification would be extremely beneficial. It would then be further beneficial to provide host cells or organisms that can produce desirable amounts of fragrance compounds containing such fragrances.

  The present invention relates to an important enzyme in the production of sesquiterpene valencene, an aromatic compound found primarily in citrus plant species.

  The present invention provides a new member of the sesquiterpene synthase family, which is a terpene biosynthetic pathway that converts farnesyl pyrophosphate (also known as FPP, farnesyl diphosphate or FDP) to sesquiterpenes. concern. According to one aspect, the sesquiterpene synthase is a valencene synthase. The present invention provides polynucleotide sequences encoding sesquiterpene synthases, including recombinant DNA molecules. The present invention further provides vectors and host cells that express a vector comprising the polynucleotide of the invention, a host cell engineered to contain the polynucleotide of the invention, and a polynucleotide of the invention. Host cells that are engineered to be included. Thus, the present invention facilitates the production, isolation and purification of (i) a substantial amount of recombinant valencene synthase, or its primary and secondary products for later use. A method of expressing a recombinant sesquiterpene synthase, specifically valencene synthase; and (ii) expressing or expressing sesquiterpene synthase, specifically valencene synthase, in a microorganism or plant. A method of facilitating; and (iii) regulating the expression of sesquiterpene synthase, in particular valencene synthase, in an environment where such regulation of expression is desirable to produce this enzyme and its enzyme products and derivatives. provide.

  The present invention further provides those skilled in the field of molecular biology, including, but not limited to, use as hybridization probes, PCR, chromosomal mapping, and gene mapping oligomers, and the like. Provided is a polynucleotide sequence encoding sesquiterpene synthase, in particular valencene synthase, characterized by converting farnesyl pyrophosphate (FPP) to valencene for use in various known methods and techniques .

  The present invention further provides a method for using an enzyme product of sesquiterpene synthase, in particular valencene, in industrial applications selected from agriculture, cosmetics and food.

  According to one aspect, the present invention provides an isolated polynucleotide comprising a polynucleotide sequence encoding a valencene synthase, which valencene synthase can convert FPP to valencene.

  According to one embodiment, the isolated polynucleotide comprises a nucleic acid sequence having at least 80%, preferably at least 90% homology to SEQ ID NO: 1 or its complementary strand.

  According to another embodiment, the isolated polynucleotide comprises a nucleic acid sequence capable of hybridizing to a nucleic acid sequence having at least 80%, preferably at least 90% homology to SEQ ID NO: 1 or its complementary strand. Including.

  According to yet another embodiment, the isolated polynucleotide comprises a nucleic acid encoding a valencene synthase comprising an amino acid sequence having at least 80%, preferably at least 90% homology to SEQ ID NO: 2. Including. According to some embodiments, the invention hybridizes to a nucleic acid sequence encoding a valencene synthase comprising an amino acid sequence having at least 80% homology, preferably at least 90% homology to SEQ ID NO: 2. Provided are isolated polynucleotides that can be formed.

  According to yet another embodiment, the isolated polynucleotide comprises a nucleic acid sequence encoding a valencene synthase comprising an amino acid sequence having at least 80% homology to SEQ ID NO: 2, wherein the amino acid comprises , Which contains at least one consensus motif of the sequence DXXXD (SEQ ID NO: 3) consisting of consecutive amino acids, wherein X corresponds to any amino acid. According to some embodiments, the present invention provides an isolated polynucleotide that can hybridize to the nucleic acid sequence.

  According to another aspect, the present invention provides an isolated polypeptide comprising an amino acid sequence having the activity of valencene synthase, wherein the activity is characterized in that farnesyl pyrophosphate can be converted to valencene.

  According to one embodiment, the isolated polypeptide comprises an amino acid sequence having at least 80% homology, preferably at least 90% homology to SEQ ID NO: 2.

  According to another embodiment, the isolated polypeptide encodes a valencene synthase comprising an amino acid sequence having at least 80% homology to SEQ ID NO: 2, wherein the amino acids are contiguous DDXXD It contains at least one consensus motif of the amino acid sequence (SEQ ID NO: 3), where X corresponds to any amino acid.

  The scope of the present invention encompasses homologues, analogs, variants, and derivatives, which include the ability of sesquiterpene synthase to convert farnesyl pyrophosphate (FPP) to valencene, these variants and modifications. Shorter, or longer polypeptides, proteins, and polynucleotides, and polypeptide analogs, protein analogs having one or more amino acid substitutions or nucleic acid substitutions, provided that It will be clearly understood that polynucleotide analogues include amino acid or nucleic acid derivatives known in the art, unnatural amino acids or nucleic acids, and synthetic amino acids or nucleic acids. In particular, any active fragments of active polypeptides or proteins, and extensions, conjugates, and mixtures are also disclosed in accordance with the principles of the present invention.

  According to one embodiment, the valencene synthase is derived from a citrus plant species, preferably orange.

  According to yet another aspect, the present invention provides an expression vector comprising a nucleic acid sequence encoding valencene synthase, wherein valencene synthase can convert FPP to valencene.

  According to one embodiment, the vector is a plasmid or a virus. According to some embodiments, the vector is selected from the group consisting of a promoter operably linked to a polynucleotide encoding valencene synthase, a selectable marker, a signal sequence, an origin of replication, an enhancer, and a transcription termination sequence. And at least one additional element.

  According to yet another aspect, the present invention provides a host cell comprising an expression vector, the expression vector comprising a nucleic acid sequence encoding valencene synthase, wherein valencene synthase can convert FPP to valencene.

  According to one embodiment, the host cell is a prokaryotic or eukaryotic cell. According to another embodiment, the host cell is a prokaryotic cell and a polynucleotide sequence comprising a nucleic acid sequence encoding valencene synthase is stably integrated into the genome. According to a preferred embodiment, the prokaryotic cell is a bacterial cell, preferably E. coli.

  According to yet another embodiment, the host cell produces at least one compound selected from the group consisting of valencene, a valencene metabolite other than nootkatone, and nootkatone.

According to yet another aspect, the present invention further provides a recombinant valencene synthase and a method of producing a recombinant valencene, the method comprising:
(A) culturing a host cell containing the expression vector, wherein the expression vector comprises a nucleic acid sequence encoding valencene synthase, and the valencene synthase is under conditions suitable for expression of the valencene synthase, A step that can convert FPP to valencene, and optionally,
(B) recovering the valencene synthase.

  According to an alternative embodiment, step (b) comprises recovering valencene.

  Valencene produced in a host cell according to the present invention may be used as a substrate for the production of another compound by an enzyme present in the host cell that is active downstream of valencene synthase in the terpene biosynthetic pathway. it can. Herein, such compounds are termed “valencene metabolites”.

According to another embodiment, step (b) comprises:
Recovering at least one valencene metabolite.

  According to a preferred embodiment, the at least one balletene metabolite is nootkatone.

  According to yet another embodiment, the host cell is a prokaryotic or eukaryotic cell.

  According to yet another embodiment, the host cell is a prokaryotic cell and the polynucleotide sequence comprising the nucleic acid sequence encoding valencene synthase is stably integrated into the genome.

  According to yet another embodiment, the host cell produces at least one compound selected from the group consisting of valencene, a valencene metabolite other than nootkatone, and nootkatone. According to a preferred embodiment, the prokaryotic cell is a bacterial cell, preferably E. coli.

  According to yet another aspect, the present invention provides a plant comprising a polynucleotide sequence encoding a valencene synthase, wherein the valencene synthase can convert FPP to valencene.

  According to one embodiment, the polynucleotide sequence encoding valencene synthase is stably integrated into the genome of the plant.

  According to another embodiment, the plant produces at least one compound selected from the group consisting of valencene, a valencene metabolite other than nootkatone, and nootkatone.

  According to yet another aspect, the present invention provides valencene and valencene metabolites obtained by any one of the methods of the invention.

  According to yet another aspect, the present invention provides the use of valencene and valencene metabolites obtained by the method of the invention in an industrial application selected from the group consisting of agriculture, cosmetics and food.

  Other objects, features and advantages of the present invention will become apparent from the following description and drawings.

  The present invention relates to a new type of sesquiterpene synthase, in particular valencene synthase.

  In ancient civilizations, plants were grown and cherished not only for their nutritional value but also for their flavor, aroma, and medicinal properties. However, the development of large-scale commercial agriculture in Western civilization has highlighted commercial and market interests in plant production, such as long storage periods, appearance, and yield. The content of secondary metabolites, i.e. metabolites that do not have a clear role in metabolism and whose presence is limited to specific tissues, despite having a significant impact on nutritional value and aroma, Often overlooked. Recently, there has been an increased awareness of healthy and flavorful plant products. Fruits that are superficially attractive, neither flavor nor fragrance, are perceived as “artificial”, while fragrant fruits are perceived as more “natural”. There is increasing general interest in “returning” natural flavors and aromas to fruits, which is important for elucidating the biosynthetic pathways, enzymes, genes, and regulatory mechanisms involved. It emphasizes sex. The cosmetics and food industries are also seeking natural aromas and flavors.

  Citrus plant species are listed as the most aromatic plants. Citrus is second only to grapes in planting and growing around the world and an important supply of secondary metabolites (eg terpenoids, flavonoids, and other polyphenols) used for nutrition, health and industrial applications Is the source. Citrus flavors and aromas are composed of a complex combination of soluble compounds, mainly acids, sugars, and flavonoids, and volatile compounds. The latter usually consists of monoterpenes and sesquiterpenes, which are the main components of citrus essential oils, which accumulate in specific oil glands in the flavedo (outer part of the skin) and in the oil bodies in the juice sac.

  Usually, over 90% of the essential oil component obtained from citrus plant species is occupied by limonene, which is a monoterpene, but there are very small amounts of some unique sesquiterpene compounds, which are the flavor and aroma of citrus plant species. It has a great influence on. For example, the sesquiterpenes valencene, α- and β-sinensal are present in small amounts in orange and have an important role in the overall flavor and aroma of orange fruit. Nootkaton is an oxygenated sesquiterpene, a putative derivative of valencene, which has a minor role in essential oils but has a dominant role in the flavor and aroma of grapefruit.

  Monoterpenes and sesquiterpenes are listed as the most important secondary metabolites obtained from the enzymatic activity of valencene synthase and are involved in fruit and flower aromas. The backbone of the biosynthetic pathway leading to the production of monoterpenes and sesquiterpenes is common to all plant species, but the composition of terpenes is often dramatically different between species or even among varieties, thereby A variety of flavors has arisen in citrus cultivars. This diversity appears to stem primarily from the specific composition and expression of key enzymes in the biosynthetic pathway, namely terpene synthase and other modifying enzymes downstream. Homology analysis reveals that terpene synthases of different plant species are not highly conserved in sequence, but there are distinct domains that are conserved, which are significant structural and functional Suggests similarities. These conserved domains are the basis for the isolation of many genes encoding terpene synthases from various plants using degenerate primer-based RT-PCR.

  The study of fruit development and ripening has a long history, and most of these processes, especially those in climacteric fruits, have been revealed over these long years. However, interest in biochemical and genetic regulation of fruit aroma has increased since recently, and few genes involved in fruit aroma have been described, and as a result, the aroma in fruit Little is known about the regulation of formation. Although such research conditions limit the potential of natural fruit aromas to be used by agriculture, food and cosmetic industries, they are highly desirable products of these industries.

  The present invention discloses the isolation and characterization of key genes and the corresponding enzyme encoded by the key gene, namely valencene synthase, which is a key element of citrus fruit aroma formation . The in-vitro activity of the recombinant enzyme indicates a single sesquiterpene product identified as valencene. Studies on valencene accumulation and valencene synthase gene expression patterns indicate that valencene production in citrus fruits is regulated at the transcript level as follows. That is, (1) Valensen synthase expression is regulated by development and appears only at the final stage of the fruit ripening process and is closely correlated with Valensen accumulation, (2) Valensen accumulation, and Valensen synthase expression is responsive to ethylene treatment.

(Definition)
The terms “citrus” or “citrus plant species” are used interchangeably herein to define any plant or fruit of the genus Citrus, which grows in a warm area, A genus consisting of trees and shrubs of the Rutaceae family, often with thorns. Most citrus fruits are edible, such as orange, lemon, grapefruit, lime, kumquat, mandarin, and pomelo, and have a firm, thick, juicy pulp.

  As used herein, the terms “amino acids” (“amino acids” and “amino acids”) refer to all naturally occurring L-α-amino acids or their residues. Amino acids are specified by one-letter code or three-letter code.

  As used herein, the term “nucleotide” means a DNA or RNA monomer unit containing a sugar residue (pentose sugar), a phosphate, and a nitrogen-containing heterocyclic base. The base is linked to a sugar residue via a glycoside carbon (1 'carbon of a pentose sugar), and this combination of base and sugar is called a nucleoside. Nucleotides are characterized by bases, and the four types of bases in DNA are adenine (“A”), guanine (“G”), cytosine (“C”), thymine (“T”), and inosine (“I”). ). The four types of RNA bases are A, G, C, and uracil (“U”). The nucleotide sequences described herein comprise a linear sequence of nucleotides linked by a phosphodiester bond between the 3 'and 5' carbons of adjacent pentose sugars.

  The term “homology” or “percent identity” refers herein to the percentage of amino acids or nucleotides that occupy the same relative position when two amino acid sequences or two nucleic acid sequences are aligned side by side. Used interchangeably to define.

  The term “percent similarity” is a statistical measure of the degree of association between two compared protein sequences. The percent similarity is a chemical similarity (eg, whether the compared amino acids are acidic, basic, hydrophobic, aromatic, etc.) and / or compared to each pair of compared amino acids. Based on the evolutionary distance measured by the minimum number of base-pair changes necessary to convert a codon encoding one member of a pair of amino acids to a codon encoding the other member of the pair Calculated by a computer program that assigns numerical values. Calculations are made after the best-fit alignment of the two sequences has been created empirically by repeated comparison of all possible alignments (Henikoff et al., Proc Nat'l. Acad. Sci. USA 89: 10915- 10919, 1992).

  “Oligonucleotide” refers to a short-length single- or double-stranded sequence of deoxyribonucleotides linked via phosphodiester bonds. Oligonucleotides are chemically synthesized by known methods and purified on polyacrylamide gels.

  The term “sesquiterpene synthase” is used herein to mean an enzyme capable of catalyzing the production of sesquiterpenes from FPP. "Valenecene synthase" is used herein to mean an enzyme that catalyzes the production of sesquiterpene, valencene, from FPP.

  The terms “derivative”, “analog”, and “variant” are citrus fruits encoded by the citrus valencene synthase having the amino acid sequence set forth in SEQ ID NO: 2, or the polynucleotide set forth in SEQ ID NO: 1, respectively. It refers to a valencene synthase molecule having some difference in their sequence compared to valencene synthase, or a polynucleotide encoding them. Usually, a variant will have at least about 80% homology, preferably at least about 90% homology to the valencene synthase defined above, or a polynucleotide encoding it. Sequence variants of valencene synthase that are within the scope of the invention have “modifications”, ie, substitutions, deletions, and / or insertions at certain positions. Sequence variants of valencene synthase may be used to obtain enhancement of the desired enzyme activity or may be used to obtain altered substrate utilization or product distribution.

  A valencene synthase variant that includes a “substitution” has at least one amino acid residue in the valencene synthase sequence set forth in SEQ ID NO: 2 removed and a different amino acid inserted in its place instead. Is. The substitution may be a single substitution, in which case only one amino acid in the molecule is substituted, or they may be multiple substitutions, in which case two or more amino acids are substituted in the same molecule Is done. Substituting an amino acid with a side chain that is significantly different in charge and / or structure from a naturally occurring amino acid can cause a substantial change in the activity of the valencene synthase molecule of the invention. This type of substitution would be expected to affect the structure of the polypeptide backbone and / or the charge or hydrophobicity of the molecule in the substitution region.

  It will be expected that substitution of certain amino acids with side chains similar in charge and / or structure to the natural molecule will result in moderate changes in the activity of the valencene synthase molecule of the present invention. This type of substitution is referred to as a conservative substitution and would be expected to substantially alter neither the structure of the polypeptide backbone nor the charge or hydrophobicity of the molecule in the substitution region.

  A valencene synthase variant encompassing “insertion” has one or more amino acids inserted immediately adjacent to an amino acid at a specific position in the amino acid sequence of valencene synthase described in SEQ ID NO: 2. Is. Immediately adjacent to an amino acid means linked to either the α-carboxy or α-amino functional group of the amino acid. The insertion may be one amino acid or multiple amino acids. Usually the insert will consist of one or two conserved amino acids. An amino acid that is similar in charge and / or structure to an amino acid adjacent to the insertion site is defined as conservative. Alternatively, the insertion of amino acids having a charge and / or structure that is substantially different from the amino acids adjacent to the insertion site is also included in the invention.

  A valencene synthase variant comprising a “deletion” is one in which one or more amino acids in the amino acid sequence of valencene synthase set forth in SEQ ID NO: 2 have been removed. Usually, in a deletion mutant, one or two amino acids will be removed in a specific region of the valencene synthase molecule.

  The terms “biological activity”, “biologically active”, “activity”, and “active” refer to the ability of sesquiterpene synthase to convert farnesyl pyrophosphate (FPP) into a group of sesquiterpenes. Among them, valencene is the main and characteristic sesquiterpene synthesized by valencene synthase.

  The terms “encoding DNA sequence”, “encoding DNA”, “encoding nucleic acid sequence”, “encoding polynucleotide sequence” refer to the order or sequence of deoxyribonucleotides along the strand of deoxyribonucleic acid. The order of these deoxyribonucleotides determines the order of amino acids along the translated polypeptide chain. The DNA sequence thus encodes an amino acid sequence.

  As used herein, the term “hybridization” refers to any process by which a single strand of nucleic acid binds to a complementary strand through base pairing.

  As used herein, the term “stringent conditions” or “stringency” refers to hybridization conditions defined by nucleic acids, salts, and temperature. These conditions are well known in the art and can be varied to identify or detect the same or related polynucleotide sequences. A number of equivalent conditions, including low or high stringency, include sequence length and nature (DNA, RNA, base composition), target nature (DNA, RNA, base composition), environment (in solution) Or immobilized on a solid substrate), the concentration of salts and other components (eg, formamide, dextran sulfate, and / or polyethylene glycol) and the reaction temperature (from about 5 ° C. below the dissolution temperature of the probe to about Depends on factors such as within the range up to 25 ° C. One or more factors can be modified to produce low stringency conditions or high stringency conditions.

  The terms “replicatable expression vector” and “expression vector” refer to a piece of DNA, usually double stranded, into which a piece of foreign DNA can be inserted. Foreign DNA is defined as heterologous DNA, which is DNA that is not found in the host in nature. Vectors are used to transport foreign or heterologous DNA into appropriate host cells. Once inside the host cell, the vector can replicate independently of the host chromosomal DNA or simultaneously, producing several copies of the vector and the inserted (foreign) DNA. It becomes possible. In addition, the vector contains the elements necessary to allow translation of the foreign DNA into a polypeptide. In this way, a large number of molecules of the polypeptide encoded by the foreign DNA can be rapidly synthesized.

  The terms “transformed host cell”, “transformed”, and “transformation” refer to the introduction of DNA into a cell. This cell is referred to as the “host cell”, which can be either prokaryotic or eukaryotic. Typical prokaryotic host cells include various strains of E. coli. Typical eukaryotic host cells are plant cells, yeast cells, insect cells, or animal cells. The introduced DNA is usually in the form of a vector containing an inserted DNA fragment. The introduced DNA sequence may be derived from the same species as the host cell or from a species different from the host cell, and may contain some foreign DNA and DNA from some host organism species. It may be a hybrid DNA sequence.

(New sesquiterpene synthase)
According to one aspect, the present invention relates to a polynucleotide encoding a sesquiterpene synthase, in particular a valencene synthase.

  A great variety has been found in citrus terpenoid aroma compounds. This diversity limits the effectiveness of the reverse genetics approach to isolate all genes involved in the biosynthesis of all such compounds. Therefore, isolation of the gene encoding terpene synthase was undertaken by exhaustive screening of mRNA isolated from high content target tissues. Because we have noticed that some important citrus sesquiterpene flavor compounds such as Valensen and Nootkaton accumulate towards fruit ripening and mainly in the flavedo, the target tissue is high in content As an example, a flavedo obtained from Valencia ™ orange (Citrus sinensis cv. Valencia), which was collected late in development for maturity, was selected. Partial cDNA fragments were isolated from Valencia ™ orange flaved mRNA using RT-PCR using degenerate primers based on short conserved sequence elements present in most monoterpene and sesquiterpene synthases . A PCR fragment of the expected size was cloned and sequenced. For full-length cDNA cloning, appropriate clones were selected that contained internal conserved sequence elements unique to terpene synthase. One full-length cDNA has a sequence similar to that of a plant sesquiterpene synthase, and this full-length cDNA was named Cstps1.

  According to one aspect, the present invention provides an isolated polynucleotide comprising a polynucleotide sequence encoding a valencene synthase, which valencene synthase can convert FPP to valencene.

  According to one embodiment, the isolated polynucleotide comprises a nucleic acid sequence having at least 80%, preferably at least 90% homology to SEQ ID NO: 1 or its complementary strand.

  According to another embodiment, the isolated polynucleotide comprises a nucleic acid sequence capable of hybridizing to a nucleic acid sequence having at least 80%, preferably at least 90% homology to SEQ ID NO: 1 or its complementary strand. Including.

  According to yet another embodiment, the isolated polynucleotide comprises a nucleic acid encoding a valencene synthase comprising an amino acid sequence having at least 80%, preferably at least 90% homology to SEQ ID NO: 2. Including.

  According to yet another embodiment, the isolated polynucleotide comprises a nucleic acid sequence encoding a valencene synthase comprising an amino acid sequence having at least 80% homology to SEQ ID NO: 2, wherein the amino acid comprises , Which contains at least one consensus motif of the sequence DXXXD (SEQ ID NO: 3) consisting of consecutive amino acids, wherein X corresponds to any amino acid.

  Isolation of the cDNA encoding valencene synthase allows the development of an efficient expression system for this functional enzyme; provides a valuable means of examining the developmental regulation of valencene biosynthesis; Allows study of reaction mechanisms; and allows transformation of a wide range of organisms to introduce valencene biosynthesis into de novo and to modify endogenous valencene biosynthesis.

  The present invention further relates to polypeptides having sesquiterpene synthase activity, particularly valencene synthase activity, and thus the polypeptides of the present invention are capable of converting FPP to sesquiterpenes, particularly valencene.

  According to another aspect, the present invention provides an isolated polypeptide having valencene synthase activity, wherein the activity is characterized by converting farnesyl pyrophosphate (FPP) to valencene.

  According to one embodiment, the isolated polypeptide comprises an amino acid sequence having at least 80%, preferably at least 90% homology to SEQ ID NO: 2.

  According to another embodiment, the isolated polypeptide encodes a valencene synthase comprising an amino acid sequence having at least 80% homology to SEQ ID NO: 2, wherein the amino acids are contiguous DDXXD It contains at least one consensus motif of the amino acid sequence (SEQ ID NO: 3), where X corresponds to any amino acid.

  The scope of the present invention encompasses homologues, analogs, variants, and derivatives, which include the ability of sesquiterpene synthase to convert farnesyl pyrophosphate (FPP) to valencene, these variants and modifications. Shorter, or longer polypeptides, proteins, and polynucleotides, and polypeptide analogs, protein analogs having one or more amino acid or nucleic acid substitutions, provided that And polynucleotide analogues and amino acids or nucleic acid derivatives known in the art, unnatural amino acids or nucleic acids, and synthetic amino acids or nucleic acids are clearly understood. In particular, any active fragments of active polypeptides or proteins, and extensions, conjugates, and mixtures are also disclosed in accordance with the principles of the present invention.

  According to one embodiment, the valencene synthase is derived from a citrus plant species, preferably orange.

  According to yet another aspect, the present invention provides an expression vector comprising a nucleic acid sequence encoding valencene synthase, which valencene synthase can convert FPP to valencene.

  Various types of vectors can be used in the practice of the present invention. The use of a particular vector type is performed as known to those skilled in the art and as described herein below, depending on the host cell in which expression is desired. Vectors usually have a polylinker region containing a replication site, a marker gene that provides phenotypic selection of transformed cells, one or more promoters, and several restriction sites for inserting foreign DNA. For example, commonly used plasmids for transformation of E. coli include pBR322, pUC18, pUC19, pUC118, pUC119, and Bluescript M13, all of which are described in Sambrook et al. Manual (Molecular Cloning: A Laboratory Manual), 3rd edition, 2001, Cold Spring Harbor Laboratory Press, Inc., sections 1.12 to 1.20. These vectors contain genes encoding ampicillin resistance and / or tetracycline resistance, which allow cells transformed with these vectors to grow in the presence of these antibiotics. However, many other suitable vectors carrying different genes encoding selectable markers are also available. Construction of appropriate vectors containing replication sequences, regulatory sequences, phenotypic selection genes, and DNA encoding the valencene synthase DNA of interest is performed using standard recombinant DNA manipulation techniques. As is well known in the art (see, for example, Sambrook et al., Supra), the isolated plasmid and DNA fragment are cleaved in a specific order, processed appropriately and ligated together to produce the desired vector. To do.

  Vector components typically include, but are not limited to, one or more of a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence. The expression elements of these vectors differ in their strength and specificity. Any one of a number of suitable transcription and translation elements can be used, depending on the host and vector system used. For example, when cloning into a prokaryotic system, a promoter isolated from a prokaryotic genome (eg, a bacterial tryptophan promoter) can be used. Promoters produced by recombinant DNA or synthetic techniques can also be used to provide transcription of the inserted sequence.

  A “signal sequence” may be a component of a vector or may be part of a nucleic acid encoding a protein of the invention inserted into the vector. The signal sequence may be a naturally occurring sequence or a non-naturally occurring sequence. The signal sequence should be one that is recognized and processed by the host cell.

  “Replication origin” refers to a unique site at which the host organism begins to replicate.

  Cloning vectors and expression vectors preferably contain a selection gene, also referred to as a “selectable marker” or “selectable marker”. This gene encodes a protein necessary for the survival or growth of transformed host cells cultured in a selective culture medium. Host cells that have not been transformed with the vector containing the selection gene will not survive in the culture medium. Typical selection genes are proteins that confer resistance to antibiotics or other toxins, such as ampicillin, proteins that complement auxotrophic deficiencies, or proteins that supply important nutrients that cannot be obtained from complex media Code. One example of a selection scheme utilizes drugs that stop the growth of host cells. Cells successfully transformed with a heterologous gene express a protein that confers drug resistance, thereby surviving the selection strategy. Expression vectors used in prokaryotic host cells will contain sequences necessary for termination of transcription and stabilization of mRNA.

  Construction of a suitable vector containing one or more of the above components and containing the desired coding and regulatory sequences is done using standard ligation techniques. The isolated plasmid fragment or nucleic acid fragment is cleaved, subjected to appropriate treatment, and ligated again to produce the required plasmid.

  According to one embodiment, the expression vector comprises a nucleic acid sequence having at least 80%, preferably at least 90% homology to SEQ ID NO: 1 or its complementary strand.

  According to another embodiment, the expression vector comprises a nucleic acid sequence capable of hybridizing to a nucleic acid sequence having at least 80%, preferably at least 90% homology to SEQ ID NO: 1 or its complementary strand.

  According to yet another embodiment, the expression vector comprises a nucleic acid encoding a valencene synthase comprising an amino acid sequence having at least 80%, preferably at least 90% homology to SEQ ID NO: 2.

  According to yet another embodiment, the expression vector comprises a nucleic acid sequence encoding valencene synthase comprising an amino acid sequence having at least 80% homology to SEQ ID NO: 2, wherein the amino acid comprises a contiguous amino acid At least one consensus motif of the sequence DXXXD (SEQ ID NO: 3), wherein X corresponds to any amino acid.

  The present invention provides a method for producing, isolating, and purifying the valencene synthase according to the present invention and the product of its enzymatic activity.

According to yet another aspect, the present invention further provides a method of producing a recombinant valencene synthase comprising:
(A) culturing a host cell containing the expression vector, the expression vector comprising a nucleic acid sequence encoding valencene synthase, wherein the valencene synthase is FPP under conditions suitable for expression of said valencene synthase Can be converted to Valensen, with steps and, optionally,
(B) recovering the valencene synthase.

According to an alternative embodiment, step (b) comprises
Recovering a substantial amount of said valencene synthase.

According to another alternative embodiment, step (b) comprises
Recovering valencene.

  Valencene produced in a host cell according to the present invention can be used as a substrate for the production of another compound by an enzyme present in the host cell that is active downstream of valencene synthase in the terpene biosynthetic pathway. . Herein, such compounds are termed “valencene metabolites”.

According to another embodiment, step (b) comprises:
Recovering at least one valencene metabolite.

  According to a preferred embodiment, the at least one balletene metabolite is nootkatone.

  According to yet another embodiment, the host cell is a prokaryotic or eukaryotic cell.

  According to yet another embodiment, the host cell is a prokaryotic cell and the polynucleotide sequence comprising the nucleic acid sequence encoding valencene synthase is stably integrated into the genome. According to a preferred embodiment, the prokaryotic cell is a bacterial cell, preferably E. coli. According to yet another embodiment, the host cell produces at least one compound selected from the group consisting of valencene, a valencene metabolite other than nootkatone, and nootkatone.

  According to yet another embodiment, the polynucleotide sequence comprises a nucleic acid sequence having at least 80%, preferably at least 90% homology to SEQ ID NO: 1 or its complementary strand.

  According to another embodiment, the polynucleotide sequence comprises a nucleic acid sequence capable of hybridizing to a nucleic acid sequence having at least 80%, preferably at least 90% homology to SEQ ID NO: 1 or its complementary strand.

  According to yet another embodiment, the polynucleotide sequence comprises a nucleic acid encoding a valencene synthase comprising an amino acid sequence having at least 80%, preferably at least 90% homology to SEQ ID NO: 2.

  According to yet another embodiment, the polynucleotide sequence comprises a nucleic acid sequence encoding a valencene synthase comprising an amino acid sequence having at least 80% homology to SEQ ID NO: 2, wherein the amino acid sequence is contiguous At least one consensus motif of the sequence DXXXD (SEQ ID NO: 3) consisting of the amino acids, wherein X corresponds to any amino acid.

  The putative full-length amino acid sequence of the Cstps1 cDNA clone (SEQ ID NO: 2, FIG. 2) is characterized by monoterpene and sesquiterpene synthases, including the most conserved metal ion binding motif DDXXXD (SEQ ID NO: 3). A typical storage element is shown. Conserved sequence elements are boxed and the motif DDxxD (SEQ ID NO: 3), which is conserved in common for monoterpene synthase and sesquiterpene synthase, is underlined with asterisks.

  Cstps1 is most similar to angiosperm sesquiterpene synthase and shows the highest level of similarity (61%) to citrus β-farnesene synthase (Maruyama et al., Biol Pharm Bull, 2001) Year, 24 (10): 1171-5), followed by cotton δ-kadinene synthase (50% similarity) (Chen et al., Arch. Biochem. Biophys, 1995, 324: 255-266).

  The deduced amino acid sequence of the citrus valencene synthase Cstps1 belongs phylogenetically to the group of angiosperm sesquiterpene synthases (FIG. 3), which are angiosperm and gymnosperm monoterpene synthase, sesquiterpene synthase, and diterpene. It was one of five distinct groups obtained in an unrooted phylogenetic analysis of synthase (BioEdit and Treeview software, Hall, Nucl. Acids. Symp. Ser, 1999, 41: 95-98; and Page, Compute Appl Biosci, 1996, 12 (4): 357-8). Among the angiosperm sesquiterpene groups, valencene synthase (Cstps1), citrus farnesene synthase (Maruyama et al., Ibid), and other citrus flowers isolated by the inventors of the present invention. The sesquiterpene synthase gene (Cmtps1) formed a distinct citrus subgroup.

  In addition to the natural valencene synthase amino acid sequence, sequence variants generated by deletions, substitutions, mutations, and / or insertions are also intended to be within the scope of the present invention. The valencene synthase amino acid sequence variant of the present invention can also be constructed by introducing a mutation into a DNA sequence encoding wild-type synthase, usually by using a technique called site-directed mutagenesis. Mutations can be introduced into nucleic acid molecules encoding the valencene synthase of the invention by various PCR techniques well known to those skilled in the art. For example, “PCR Strategies”, M.M. A. Edited by Innis et al., 1995, Academic Press, San Diego, Calif (Chapter 14); and "PCR Protocols: A Guide to Methods and Applications", M. et al. A. Innis, D.C. H. Gelfund, J.M. J. et al. Sninsky, and T.W. J. et al. See White Editing, Academic Press, NY (1990).

  As a non-limiting example, the two-primer system used in the Transformer site-directed mutagenesis kit manufactured by Clonetech can be used for site-directed mutagenesis into the valencene synthase gene of the present invention. Following denaturation of the target plasmid in this system, two primers are annealed simultaneously to the plasmid, one of these primers containing the desired site-specific mutation and the other in the plasmid. Contains a mutation at another position, resulting in removal of a restriction site. Second strand synthesis is then performed, whereby these two mutations are intimately linked, and the resulting plasmid is transformed into a mutS strain of E. coli. Plasmid DNA is isolated from the transformed bacteria, restricted with the appropriate restriction enzyme (thus linearizing the unmutated plasmid), and then reintroduced into E. coli and transformed. Make a conversion. This system allows for direct mutagenesis into the expression plasmid and does not require the addition or generation of single stranded phagemids. By closely linking the two mutations followed by linearization of the unmutated plasmid, the mutation efficiency is increased and screening can be minimized. After the first restriction site primer is synthesized, there is only one new primer that needs to be used in this method per mutation site. Instead of preparing each site-specific variant separately, a set of “designed degenerate” oligonucleotide primers can be synthesized to simultaneously introduce all of the desired mutations at a given site. Transformants can be screened by sequencing plasmid DNA across the mutated region, thereby identifying and selecting mutant clones. Subsequently, each mutant DNA can be restricted and analyzed (eg, by bandshift comparison with a non-mutated control) to confirm that no other modifications have occurred in the sequence.

In the design of certain site-specific mutations, usually non-conservative substitutions are first introduced (eg, Ala instead of Cys, His, Glu) to determine if the activity is greatly impaired as a result. It is desirable to do. The properties of the mutated protein are then examined with particular attention to the kinetic parameters K _m and k _cat as sensitive indicators for functional changes. From K _m and k _cat , changes in binding and / or the catalyst itself can be deduced by comparing them with natural enzymes. If the residue is found to be important for loss of activity or knockout, then a Glu to Asp substitution, a Cys to Ser substitution, or a His to Arg substitution that modifies the side chain length. Etc., conservative substitutions can be introduced. For hydrophobic segments, aromatics can be substituted with alkyl side chains, but in general, size changes are effective. If there is a change in the normal product distribution, it can indicate which step in the sequential reaction has been altered by the mutation. Modification of the hydrophobic pocket can be used to change the binding conformation to the substrate.

  Other site-specific mutagenesis techniques can also be utilized for the nucleotide sequences of the present invention. For example, as described in Sambrook et al. (Supra), section 15.3, DNA can also be used to generate deletion mutants of valencene synthase, followed by restriction endonuclease digestion followed by ligation. Similar strategies can be used to construct insertional variants as described in Section 15.3 of Sambrook et al.

  Oligonucleotide-specific mutagenesis can also be used to prepare substitution mutants of the present invention. This can also be conveniently used for the preparation of deletion mutants and insertion mutants of the present invention. This technique is well known in the art and is described, for example, by Adelman et al. (DNA 2: 183, 1983); and Sambrook et al., Ibid.

  In order to insert, remove or replace two or more nucleotides in the nucleic acid molecule encoding the valencene synthase of the present invention, an oligonucleotide having a length of at least 25 nucleotides is usually used. An optimal oligonucleotide will have 12-15 nucleotides that are perfectly matched on either side of the nucleotide encoding the mutation. To mutate a nucleic acid encoding the natural valencene synthase of the present invention, the oligonucleotide is annealed to a single-stranded DNA template molecule under suitable hybridization conditions. Thereafter, a DNA polymerizing enzyme, usually a Klenow fragment of E. coli DNA polymerase I, is added. This enzyme uses the oligonucleotide as a primer to complete the synthesis of the DNA-bearing strand. Thus, a heteroduplex molecule encoding a natural synthase in which one strand of DNA is inserted into a vector and a mutant synthase in which a second strand of DNA is inserted into the same vector Is formed. Next, this heteroduplex molecule is introduced into an appropriate host cell and transformed.

  Variants substituted with multiple amino acids can be generated in one of several ways. If those amino acids are located close together in the polypeptide chain, they can be mutated simultaneously by using one oligonucleotide that encodes all the desired amino acid substitutions. However, it is more difficult to generate a single oligonucleotide that encodes all the desired changes if those amino acids are located some distance from each other (eg, more than 10 amino acids away). It becomes. Instead, one of two alternative methods can be used. In the first method, a separate oligonucleotide is generated for each amino acid to be substituted. Subsequently, if the oligonucleotide is simultaneously annealed to the single-stranded template DNA, the second DNA strand synthesized from the template will encode all desired amino acid substitutions. One alternative to this involves two or more rounds of mutagenesis to produce the desired mutant. The first round is as described for a single mutant, using natural valencene synthase DNA as a template, and annealing to the template an oligonucleotide encoding the first of the desired amino acid substitutions, A heteroduplex DNA molecule is then generated. In the second round of mutagenesis, the mutant DNA generated in the first round of mutagenesis is used as a template. Thus, this template already contains one or more mutations. An oligonucleotide encoding the desired amino acid substitution to be added is then annealed to the template, and the resulting DNA strand is now mutated by both first and second round mutagenesis. Code. This mutant DNA can then be used as a template in the third round of mutagenesis, and so on.

  According to one presently preferred embodiment, the valencene synthase of the present invention is derived from a citrus plant species, in particular from orange, optionally from Valencia ™ orange.

  Valencia ™ Orange (Citrus sinensis cv. Valencia) is a late-ripe Spanish varieties of oranges, with a commercial harvest starting in April in Israel. Valencia ™ accumulation during the development and maturation of Valencia ™ orange was analyzed (FIG. 4). To that end, Valencia ™ orange fruits were harvested at monthly intervals during the 2003 season (FIG. 4A) or the 2001 season (FIG. 4B). In 2003, total RNA was extracted from fruit flavedos and subjected to quantitative RT-PCR analysis using Cstps1-specific primers (FIG. 4A). Results are presented with reference to amplification of the 18S ribosomal RNA reference gene.

  In 2001, total RNA was extracted from fruit flavedes and subjected to RNA blot analysis using the Cstps1 probe. Ribosomal RNA is visualized by ethidium bromide fluorescence and used as a loading reference for RNA blot analysis (FIG. 4B).

  A small peak of Valensen was observed in fruits collected during October. However, significant levels of valencene begin to be detected in January (about 1-2 months after fruit color breaks) and continue to accumulate until the fruit is fully mature (May). Using quantitative RT-PCR and RNA blotting, the level of Cstps1 transcript in Valencia ™ Orange was measured throughout the fruit development and ripening process. The Cstps1 transcription product begins to be detected in December (both detection systems) (FIGS. 4A-B) and continues to accumulate towards fruit ripening and is therefore in good agreement with the timing of Valensen accumulation .

  Citrus are classified as non-climacteric fruits, but ethylene is associated with various aspects of citrus fruit ripening. Therefore, the accumulation of valencene was monitored in Valencia ™ orange fruits collected during March and subjected to 7 days of ethylene treatment. Fruits that received ethylene treatment accumulated valencene to a level that was more than 20% above the level measured in air-treated fruits (FIG. 5A). Correspondingly, quantitative RT-PCR analysis showed that Cstps1 expression increased more than 8-fold in 48 hours ethylene treated fruits compared to air treated fruits. (FIG. 5B).

  The gene encoding valencene synthase can be incorporated into any organism capable of synthesizing terpenes and cell culture derived therefrom.

  The gene encoding valencene may be used for a variety of purposes, including but not limited to the generation of valencene synthase, the generation of valencene, the generation of downstream products of valencene, and the generation or modification of flavor and aroma compounds. It can be incorporated into living organisms.

  According to yet another aspect, the present invention provides a host cell comprising an expression vector comprising a nucleic acid sequence encoding valencene synthase, which valencene synthase can convert FPP to valencene.

  A host cell is transfected, preferably transformed with the above-described expression vector or cloning vector of the present invention, and modified so as to be suitable for induction of a promoter, selection of a transformant, or amplification of a gene encoding a desired sequence. Culture in traditional nutrient media.

  Transformation of host cells using expression vectors according to the present invention may be performed using any known method for introducing foreign nucleic acid sequences into prokaryotic or eukaryotic host cells. As a result of this transformation process, the inserted DNA is expressed, thereby causing a change in the transformed genetically modified cell, ie the recipient cell to a transgenic cell, and the like.

  Prokaryotic expression systems or eukaryotic expression systems can be used to generate valencene synthase and its product valencene and downstream valencene metabolites in the terpene biosynthetic pathway. Both expression systems contain the elements necessary for post-translational modifications that allow the enzyme's proper activity, as well as the substrates required for valencene synthesis and the enzymes for synthesizing downstream valencene metabolites.

  As known to those skilled in the art, E. coli strains, as well as other enterobacteriaceae such as Bacillus subtilis, Neisseria gonorrhoeae, Salmonella typhimurium or Serratia marcesans , And many other strains, including various Pseudomonas species and prokaryotes of the genus, are suitable as host cells for overexpressing the sesquiterpene synthase according to the present invention. Prokaryotic host cells or other host cells with a rigid cell wall are preferably transformed using the calcium chloride method, as described in Section 1.82 of Sambrook et al. Alternatively, electroporation can be used to transform these cells. Prokaryotic transformation techniques are well known in the art, for example, Dower, WJ, 12: 275-296, Plenum Publishing, in “Genetic Engineering, Principles and Methods”. Corp., 1990; and Hanahan et al., Meth. Enzymol., 204: 63, 1991.

  The reading frames encoded by Cstps1 are primarily similar to plant sesquiterpene synthases, they are contained in the cytoplasm, and apparently there are no sequences encoding transport peptides (Target P software: Emanuelsson et al., J Mol. Biol., 2000, 300: 1005-1016), so that the entire reading frame of Cstps1 was cloned into an expression vector to obtain a recombinant enzyme with catalytic activity in bacteria.

In order to improve the prospect of obtaining soluble and functional enzymes, the following two systems for producing recombinant enzymes were utilized. (1) Using an expression vector pRSETb (Invitrogen, The Netherlands), a recombinant protein in an almost natural state containing an amino-terminal histidine tag was generated, and a recombinant product of 64 KDa was obtained. (2) Using the expression vector pTYB2 (New England Biolabs, MA, USA) and producing it as part of a large fusion protein (fusion protein with 55 kDa intein-CBD), a 120 kDa recombinant product was gotten. The conditions for obtaining a substantial amount of soluble and enzymatically active gene product were examined and determined. Lysates prepared from bacteria overexpressing recombinant Cstps1 (recombinants obtained from both constructs) and supplemented with Mg ²⁺ , as illustrated below (FIG. 2) herein, It has been found that radiolabeled FPP is converted to a hexane soluble product. No such product was obtained in bacterial lysates obtained from bacteria carrying expression plasmids without the Cstps1 insert.

  Accordingly, the present invention discloses the conversion of radiolabeled FPP to a putative sesquiterpene olefin by the activity of the Cstps1 gene product. Similar preparations failed to convert geranyl diphosphate (GPP) to monoterpene olefins (FIG. 6).

  As detailed herein below, it is not radiolabeled to produce products due to the activity of recombinant enzymes sufficient to allow analytical chemistry of such products. A scaled up in-vitro assay using FPP substrate was used. Compared to a control assay performed with an extract of bacteria without the Cstps1 gene, an assay performed with an extract of bacteria producing recombinant Cstps1 detected its unique sesquiterpene peak. (FIGS. 7A and 7C). This peak was analyzed by mass spectrometry, (1) by comparing the retention time of the peak with the retention time of Valensen (FIGS. 7A-B); and (2) the resulting mass spectrum and the mass spectrum internal live It was identified as valencene by comparison with the spectrum of valencene obtained from the rally and by comparison with the spectrum of valencene obtained by the assay of the present invention (FIGS. 7D-F). Valensen is therefore the only product produced from FPP by recombinant Cstps1. Thus, the present invention discloses that the enzyme encoded by Cstps1 is valencene synthase.

  Valensen emits an odor characterized as orange / wood / citrus and is one of the low but important products in citrus essential oils. For the food and cosmetic industry, Valensen is of interest and as a substrate for synthesizing Nootkaton, a substance that emits the dominant grapefruit / citrus aroma. Oxygenation from Valensen to Nootkaton is a simple chemical transformation in these industries and has been suggested to occur in citrus fruits via hydroxylation followed by dehydrogenation (del Rio et al. J. Agric. Food Chem., 1992, 40: 1488-1490), no direct evidence of this pathway in-planta has been obtained. In Valencia orange, valencene accumulates continuously throughout the fruit ripening process (Figure 8), while in grapefruit, a putative downstream compound (2-hydroxyvalensen and subsequent nootkaton: del Rio et al., 1992, ibid. The observation that accumulation stops upon the appearance of) is consistent with the fact that valencene is the final product in orange and not in grapefruit.

  According to yet another aspect, the present invention provides a plant comprising a polynucleotide sequence encoding a valencene synthase, which valencene synthase can convert FPP to valencene.

  According to one embodiment, the polynucleotide sequence encoding valencene synthase is stably integrated into the genome of the plant.

  According to another embodiment, the plant produces at least one compound selected from the group consisting of valencene, a valencene metabolite other than nootkatone, and nootkatone.

  A transgenic plant comprising a valencene synthase according to the present invention comprises, for example, a plasmid encoding a valencene synthase comprising regulatory elements required for expression in the plant and a kan gene encoding a selectable marker gene such as resistance to kanamycin Can be obtained by introducing into Agrobacterium tumefaciens containing the helper Ti plasmid. This transformation can be performed using procedures known in the art, for example as disclosed in EP 116718.

  Alternatively, any type of vector can be used to transform plant cells, including direct gene transfer (eg, by microinjection or electroporation), pollen-mediated transformation (eg, EP 270356, As described in WO 085/01856, and US Pat. No. 4,684,611), plant RNA virus-mediated transformation (eg as described in EP 067553 and US Pat. No. 4,407,956), liposome-mediated transformation ( For example, as described in US Pat. No. 4,536,475), and the like.

  Other methods such as a particle gun are also suitable. Monocotyledonous cells, such as major cereals, can form wounds and / or enzymatically degraded tight embryos that can form compact embryogenic callus as described in WO 92/09696. The formed tissue, or wounds and / or degraded immature embryos can be used for transformation. The resulting transformed plant cells can then be used to regenerate transformed plants by conventional methods.

  The resulting transformed plant introduces valencene synthase to produce more transformed plants with the same characteristics, or to other varieties of the same or related plant species, or hybrid plants Can be used in conventional breeding schemes. Seeds obtained from transformed plants contain valencene synthase as a stable genomic insert. Their seeds, fruits, roots, and other organs obtained from the transformed plants, or their isolated organs, contain the chimeric gene of the invention as a stable genomic insert, which are also according to the invention. Is included.

  Although vine flowers have been reported to emit valencene, this compound has been detected in low amounts in celery (Apium graveolens), mango (Mangifera indica), olives (Olea europaea), and even corals, but valencene is primarily Accompanying citrus fruit. Other genes encoding valencene synthase are not known from any other genus.

  The present invention is the first to disclose a gene encoding valencene synthase. This new valencene synthase is most likely evolved among the genus Citrus. As described hereinabove, the other two citrus genes encoding sesquiterpene synthase were found to be more similar to valencene synthase than any of the other published sesquiterpene synthases. Thus, as pointed out previously for other genera, it can be speculated that much of the diversity of sesquiterpene synthases has progressed in citrus after speciation.

  According to yet another aspect, the present invention provides valencene and valencene metabolites produced downstream of the sesquiterpene biosynthetic pathway and obtained for industrial use by the methods of the invention.

  According to one embodiment, the invention provides the use of valencene and at least one valencene metabolite obtained by the method of the invention in an industrial application selected from agriculture, cosmetics and food.

  According to another embodiment, the at least one balletene metabolite is nootkatone.

  The principles of the present invention disclose novel sesquiterpene synthases, polynucleotides encoding them, methods of production, and methods of use, but are further illustrated by reference to the following non-limiting examples. It will be well understood.

(Plant material)
The fruits of the Citrus sinensis cultivar (Citrus sinensis cv. Valencia) were collected from Prof. Eliezer Goldschmidt, from the Hebrew University Agricultural Department Orchard in Rehovot. Fruits used for analysis of valencene accumulation and gene expression due to growth were collected at 1-month intervals. Flaved tissue was isolated and frozen at -80 ° C until use. Fruits used to measure response to ethylene were treated with ethylene (14 μl / l) or air for 48 hours or 7 days after harvest; flavedo tissues were isolated and frozen at −80 ° C. until use .

(RNA extraction and analysis)
Total RNA was extracted from orange flaveds as previously described (Jacob-Wilk et al., Plant J., 1999, 20 (6): 653-61). Poly A RNA was purified by PolyAtract® mRNA isolation system III (Promega, WI, USA) for application to RT-PCR. Northern analysis was performed using total RNA (20 μg per lane) according to standard methods (Sambrook et al., Ibid). Ribosomal RNA was used as a loading reference and visualized by ethidium bromide staining.

Quantitative PCR was performed using the ABI Prism 7000 sequence detection system and the SyberGreen kit (Applied Biosystems, Warrington, UK) according to the manufacturer's instructions. 5 μg of total RNA from each sample was reverse transcribed using MMLV reverse transcriptase (Gibco-BRL, MD, USA) according to the manufacturer's instructions in a reaction volume of 20 μl. Quantitative PCR reactions were performed in a final volume of 20 μl, 10 μl of master mix (Applied Biosystems, Warrington, UK), 3 μl of amplicon primer (2 μM), and 1 μl of reverse transcription reaction (for 18S ribosomal RNA reference gene) The reverse transcription reaction solution was diluted 10 ⁵ times).

次のプライマーを用いた１８ＳリボソームＲＮＡ参照遺伝子のアンプリコンは、１５０ｂｐから成っていた。

The Cstps1 amplicon using the following primers consisted of 150 bp.

The amplicon of the 18S ribosomal RNA reference gene using the following primers consisted of 150 bp.

  Each sample was analyzed in triplicate and the results represent the normalized mean and standard deviation.

(Example 1: Isolation of cDNA Cstps1)
PolyA RNA (500 ng) obtained from Valencia ™ orange flavedo was synthesized using Superscript ™ II reverse transcriptase (BRL Life Technologies, UK) and 10 pmoles of modified oligo- (dT) primer (5′CGGCTAGCATGCCTTTTTTTTT , SEQ ID NO: 10). PCR was performed using two degenerate primers that matched sequence elements conserved in various monoterpene and sesquiterpene synthases.

  The conditions for increasing the expected 110 bp band were examined and determined (94 ° C. for 20 seconds; 44 ° C. for 20 seconds; 72 ° C. for 20 seconds for 40 amplification cycles), and this band was purified to pGEM -Cloned into T plasmid (Promega, WI, USA). Appropriate clones were selected based on the presence of terpene synthase internal conserved elements in the sequence.

One clone was selected to isolate complete cDNA by 5 'and 3' RACE methods (rapid amplification of cDNA ends). Using the sequence information obtained from this clone, one gene-specific primer per RACE in each direction was designed.

  Using DNA extracted from an almost ripe Valencia orange flaved cDNA library, one gene-specific primer (described above), one universal primer (T3 for 5'RACE, and 3'RACE And T7) were used to amplify the 5 ′ and 3 ′ segments of the cDNA (Jacob-Wilk et al., Ibid). The full length cDNA is named Cstps1 and contains 1647 nucleotides as described in FIG.

(Example 2: Cloning of recombinant Cstps1 in E. coli)
The entire Cstps1 reading frame was amplified from the cDNA library by PCR using EXTAQ ™ polymerase (Takara Bio Inc., Japan), digested with the appropriate restriction sites, and the expression vector pTYB2 (New England Biolabs, MA , USA) and pRSET (Invitrogen, The Netherlands). PCR cloning was performed using the following primers to clone into the NdeI and SmaI restriction sites of pTYB2.

PCR cloning was performed using the following primers to clone into the NheI and SalI restriction sites of pRSET.

  The pTYB2 construct was expressed in E. coli ER2566 (New England Biolabs, MA, USA) at 25 ° C. for 6 hours after induction according to the manufacturer's instructions. The pRSET construct was expressed in E. coli BL21 (DE3) LysE (Invitrogen, The Netherlands) at 25 ° C. for 6 hours after induction according to the manufacturer's instructions. Bacterial cells were lysed in sample buffer and subjected to SDS-PAGE (Laemmli, Nature, 1970, 227 (259): 680-5) or frozen and stored at −20 ° C. until use.

Example 3: Identification and analysis of products produced by Cstps1 activity
(Induction for bacterial growth and Cstsp1 expression)
Recombinant BL21 (D3) pLysS bacteria were plated on LB agar containing 50 μg / ml ampicillin and 34 μg / ml chloramphenicol. The recombinant bacteria contained either an empty plasmid (control) or a plasmid containing the Cstsp1 gene (assay). Individual colonies were cultured overnight in 2 ml LB liquid medium containing 50 μg / ml ampicillin and used as starting cultures. 500 μl of bacterial cell suspension was transferred into 50 ml LB liquid medium containing ampicillin and cultured at 37 ° C. with shaking (200 rpm) until OD ₆₀₀ reached 0.6. IPTG was then added to a final concentration of 0.3 mM and the culture was grown for an additional 5 hours at room temperature. A 1.5 ml aliquot was transferred to a 2 ml polypropylene tube. Cells were harvested by centrifugation at 20000 g for 10 minutes at 4 ° C. and frozen at −20 ° C. until use.

(Preparation of bacterial lysate)
Individual bacterial pellets were suspended in 500 μl of 50 mM bis-Tris buffer pH 6.9 (reaction buffer) containing 10% v / v glycerol, 10 mM DTT, and 5 mM sodium metabisulfite. 10 μg / ml chicken egg white lysozyme chloride (grade VI, Sigma, 60000 u / mg protein) was added. Samples were stirred vigorously and incubated in ice water (4 ° C.) for 15 minutes. After cell lysis, the suspension was centrifuged (4 ° C., 20000 g for 10 minutes). Enzymatic activity characterization was performed by examining the gene product using fresh supernatant.

(Radioactive (micro) assay)
Aliquots (10-40 μl) of lysates containing recombinant enzyme were prepared with 10 mM MgCl ₂ and ³ H-FPP (specific activity 20.5 Ci / mmole, Sigma) or monoterpene synthase for sesquiterpene synthase activity test The mixture was mixed with 0.015 μCi of ³ H-GPP (specific activity 15 Ci / mmole, ARC) for activity test, and the total volume was made 100 μl with the reaction buffer. The reaction was overlaid with 1 ml of hexane, vortexed briefly, centrifuged, and then incubated at 30 ° C. for 1-2 hours. The sample was then vortexed, centrifuged, and 850 μl of the upper hexane was transferred to a new tube containing 10-50 mg of Silica Gel 60 (Merck, Darmstadt, Germany). Vortex these tubes, centrifuge at 10000 g for 1 minute at room temperature, and 600 μl of 3 ml scintillation fluid [2,5 phenyloxazole (PPO, 4 g / l), 2,2-p-phenylene-bis-5 -Toluene containing phenyloxazole (POPOP, 0.05 g / l) and 30% (v / v) Triton] was transferred to a 5 ml scintillation tube. Radioactivity was quantified using a liquid scintillation counter (Kontron model 810). Enzyme activity was calculated based on the specific activity of the substrate, using an appropriate correction factor for the scintillation machine counting efficiency (Shalit et al., J Agric Food Chem., 2001, 49 (2): 794-9). Lysates obtained from recombinant bacteria expressing the Cstps1 gene were found to convert FDP to a hexane soluble product, which did not bind to silica gel under the experimental conditions used. (FIG. 2). No such product was obtained from control lysates obtained from bacteria carrying expression plasmids without the Cstps1 insert. This result indicated that radiolabeled FPP was converted to a putative sesquiterpene olefin.

(Product scale-up by Cstsp1 activity)
Radioactivity assays were scaled up in glass tubes capped with aluminum foil. 1 μM non-radioactive farnel diphosphate (Sigma, MO, USA), 10 mM MgCl ₂ , and 400 μl of bacterial lysate were mixed in a total volume of 2 ml of reaction buffer, 2 ml of hexane was overlaid at 30 ° C. Incubated overnight. Shake each tube and extract repeatedly with 3 ml of hexane (3-5 times). In vitro generated hexane layers containing sesquiterpenes are pooled, passed through a short Pasteur pipette filled with silica gel, dried over sodium sulfate and Turbo Vac II (Zymark, MA, USA)) Concentrated to a final volume of 400 μl.

  GC-MS analysis: The volatile compounds obtained as described above were analyzed on a HP-GCD apparatus equipped with a HP-5 (30 m x 0.25 mm) fused silica capillary column. Helium (1 ml / min) was used as the developing gas. The injector temperature was 250 ° C. and was set to splitless injection. The oven was set at 70 ° C. for 2 minutes, the temperature was increased to 200 ° C. at a rate of 4 ° C./min, and a 6 minute hold was set. The temperature of the detector was 280 ° C. The mass range was recorded from 45 to 450 m / z with 70 eV electron energy. The identification of valencene is known from the comparison of mass spectra as well as from citrus samples (for tomatoes, extracted as described in Lewinsohn et al., Plant Physiol., 2001, 127: 1256-1265). This is done by comparison with retention time data and data from Valensen (Frutarom, Israel) and supplementing the data stored in the Wiley GC-MS library database. As shown in FIG. 7, in the extract obtained from the lysate of the recombinant bacteria, only one peak was observed, and only one hexane-soluble and detectable product was produced. It shows that. When this peak was compared with the peak obtained with commercially available purified valencene and further compared with the library database, the product due to Cstps1 activity was identified as valencene. Therefore, the Cstps1 polypeptide of the present invention was named valencene synthase.

図３に提示する通り、柑橘類セスキテルペンシンターゼ（進化系統樹における番号１０、１１、及び１２）は、既知の被子植物セスキテルペンシンターゼにおける明確なサブグループを形成する。進化系統樹を得るには、アライメント及び進化系統樹プログラムである、ＢｉｏＥｄｉｔ（Ｈａｌｌ、１９９９年、同上）及びＴｒｅｅＶｉｅｗ（Ｐａｇｅ、同上）を用いた。 (Example 4: Sequence analysis and evolutionary tree software tool)
General sequence data manipulation and homology searches were performed using a bioinformatics tool (Curagen, CT, USA) incorporating CuraTools ™. Transport peptide analysis was performed by Target P (Emanuelsson et al., 2000, ibid). Evolutionary phylogenetic trees were obtained using the following software: BioEdit ™ (Hall, 1999, ibid) and Treeview (Page, ibid). The accession numbers of the sequences used are as follows.

As presented in FIG. 3, citrus sesquiterpene synthases (numbers 10, 11, and 12 in the evolutionary tree) form a distinct subgroup of known angiosperm sesquiterpene synthases. To obtain an evolutionary phylogenetic tree, alignment and evolutionary phylogenetic programs, BioEdit (Hall, 1999, ibid) and TreeView (Page, ibid) were used.

(Example 5: Valencene production in pumpkin using Cstps1 gene)
CDNA Cstps1 (Sharon-Asa et al., Supra) encoding citrus valencene synthase was cloned into a ZYMV-based viral expression vector in frame with the viral polyprotein sequence. Virus vectors containing no insert sequence (AG) or containing the Cstps1 insert sequence (AG-Cstps1) were used to infect pumpkin cotyledons. According to the appearance of typical infectious symptoms and confirmation by ELISA analysis, the harvest of leaves of plants infected with the viral vector (the third, fourth and fifth true leaves of each plant) is approximately 18 post infection. I went on the day. Corresponding age wild-type plant leaves were collected. Volatile material was extracted from all leaves and analyzed for the presence of valencene using GC-MS as previously described for other plant tissues (Sharon-Asa et al., Ibid.).

Uninfected pumpkin plants and plants infected with the “empty” viral vector (AG) did not accumulate the sesquiterpene valencene. Valensen is common in citrus but is not recorded at all in cucurbits. Only plants infected with a viral vector containing citrus valencene synthase (AG-Cstps1) were found to accumulate valencene, a sesquiterpene (Table 1).

  Since the above description of specific embodiments will fully reveal the general nature of the invention, others will not have to experiment without undue experimentation by applying current knowledge. In addition, and without departing from the general concept, such specific embodiments can be easily modified and / or adapted to various applications, and thus such adaptations and modifications are It is to be understood and intended to be within the meaning and scope of the equivalents of the disclosed embodiments. It will be understood that the terminology or terminology used herein is for the purpose of description and not limitation. The methods, materials, and steps for carrying out the various disclosed chemical structures and functions can take a variety of alternative forms without departing from the invention.

It is a figure which shows the nucleotide sequence of Cstps1, ie, sequence number 1. Obtained from sesquiterpene synthase Cstps1 (SEQ ID NO: 1) and epi-alistroken synthase (SEQ ID NO: 4, accession number AAG17667) and cotton (Gossypium arborium), which are sesquiterpene synthases obtained from tobacco species (Nicotiana tabacum) It is a figure which shows the amino acid alignment with the kadinene synthase (sequence number 5, accession number CAA77191). It is a schematic diagram which shows the position of the valencene synthase in the system | strain map of terpene synthase. FIG. 3 shows the systemic expression of Cstps1 in Valencia orange flavedo during fruit ripening in fruits harvested at monthly intervals during the 2003 season (A) or during the 2001 season (B). FIG. 7 shows the effect of ethylene on Cstps1 expression and valencene accumulation in citrus flavedes following 7 days (A) or 48 hours of ethylene treatment. FIG. 2 shows the activity assay of recombinant Cstps1 as pmole product per hour reaction time. FIG. 5 shows GC-MS identification of recombinant Cstps1 sesquiterpene product. (A) Valensen chromatogram; (B) Chromatogram of product obtained from assay using bacterial lysate expressing recombinant Cstps1; (C) Bacterial lysate carrying control plasmid pTYB. Chromatogram of the product obtained from the assay used; (D) Single ion chromatogram of Valensen (m / z = 107); (E) of the product obtained from the lysate expressing recombinant Cstps1. Single ion chromatogram (m / z = 107); (F) Single ion chromatogram profile of Valensen (Wiley GC-MS library database). It is a figure which shows accumulation | storage of valencene during citrus fruit growth.

Claims (67)

  An isolated polynucleotide comprising a nucleic acid sequence encoding valencene synthase, wherein the valencene synthase can convert farnesyl pyrophosphate to valencene.   2. The isolated polynucleotide of claim 1, wherein the valencene synthase is derived from a citrus plant species.   The isolated polynucleotide of claim 2, wherein the valencene synthase is derived from orange.   2. The isolated polynucleotide of claim 1 comprising a nucleic acid having at least 80% homology to SEQ ID NO: 1 or its complementary strand.   5. The isolated polynucleotide of claim 4, comprising a nucleic acid having at least 90% homology to SEQ ID NO: 1 or its complementary strand.   A nucleic acid encoding a valencene synthase comprising (a) at least 70% homology to SEQ ID NO: 2; and (b) at least one amino acid sequence having the consensus motif of SEQ ID NO: 3 in consecutive amino acids. The isolated polynucleotide of claim 1, comprising:   2. The isolated polynucleotide of claim 1 comprising a nucleic acid encoding a valencene synthase comprising an amino acid sequence having at least 80% homology to SEQ ID NO: 2.   8. The isolated polynucleotide of claim 7, comprising a nucleic acid encoding a valencene synthase comprising an amino acid sequence having at least 90% homology to SEQ ID NO: 2.   9. An isolated polynucleotide comprising a nucleic acid capable of hybridizing to the polynucleotide of any one of claims 1-8.   An isolated polypeptide comprising an amino acid sequence having the activity of valencene synthase, wherein said activity is capable of converting farnesyl pyrophosphate to valencene.   11. The isolated polypeptide of claim 10, wherein the valencene synthase is derived from a citrus plant species.   12. The isolated polypeptide of claim 11, wherein the valencene synthase is derived from orange.   11. The amino acid sequence of claim 10, comprising (a) at least 70% identity to SEQ ID NO: 2; and (b) at least one contiguous motif of consensus motifs as set forth in SEQ ID NO: 3 of consecutive amino acid sequences. Isolated polypeptide.   11. The isolated polypeptide of claim 10, comprising an amino acid sequence having at least 80% identity to SEQ ID NO: 2, and fragments, derivatives, and analogs thereof.   15. The isolated polypeptide of claim 14, comprising an amino acid sequence having at least 90% identity to SEQ ID NO: 2, and fragments, derivatives, and analogs thereof.   An expression vector comprising a nucleic acid sequence encoding valencene synthase, wherein the valencene synthase can convert farnesyl pyrophosphate into valencene.   The expression vector according to claim 16, wherein the valencene synthase is derived from a citrus plant species.   18. The isolated polynucleotide of claim 17, wherein the valencene synthase is derived from orange.   The expression vector according to claim 16, wherein the nucleic acid sequence has at least 80% homology to SEQ ID NO: 1 or its complementary strand.   20. The expression vector of claim 19, wherein the nucleic acid sequence has at least 90% homology to SEQ ID NO: 1 or its complementary strand.   Valensen synthase, wherein the nucleic acid sequence comprises (a) at least 70% homology to SEQ ID NO: 2; and (b) at least one amino acid sequence having the consensus motif of SEQ ID NO: 3 of consecutive amino acids The expression vector according to claim 16, which encodes.   The expression vector according to claim 16, wherein the nucleic acid sequence encodes a valencene synthase comprising an amino acid sequence having at least 80% homology to SEQ ID NO: 2.   23. The expression vector of claim 22, comprising a nucleic acid encoding a valencene synthase comprising an amino acid sequence having at least 90% homology to SEQ ID NO: 2.   24. An expression vector according to any one of claims 16 to 23, selected from a plasmid or a virus.   17. The method further comprises at least one element selected from the group consisting of a promoter operably linked to a polynucleotide encoding valencene synthase, a selectable marker, a signal sequence, a replication origin, an enhancer, and a transcription termination sequence. 24. The expression vector according to any one of items 1 to 23.   A host cell comprising an expression vector, wherein the expression vector comprises a nucleic acid sequence encoding a valencene synthase capable of converting farnesyl pyrophosphate to valencene.   27. The host cell according to claim 26, wherein the valencene synthase is derived from a citrus plant species.   28. The host cell according to claim 27, wherein the valencene synthase is derived from orange.   27. The host cell of claim 26, wherein the nucleic acid sequence has at least 80% homology to SEQ ID NO: 1 or its complementary strand.   30. The host cell of claim 29, wherein the nucleic acid sequence has at least 90% homology to SEQ ID NO: 1 or its complementary strand.   Valensen synthase, wherein the nucleic acid sequence comprises (a) at least 70% homology to SEQ ID NO: 2; and (b) at least one amino acid sequence having the consensus motif of SEQ ID NO: 3 of consecutive amino acids 27. A host cell according to claim 26 which encodes.   27. The host cell of claim 26, wherein the nucleic acid sequence encodes a valencene synthase comprising an amino acid sequence having at least 80% homology to SEQ ID NO: 2.   35. The host cell of claim 32, comprising a nucleic acid encoding a valencene synthase comprising an amino acid sequence having at least 90% homology to SEQ ID NO: 2.   The host cell according to any one of claims 26 to 33, which is a prokaryotic cell or a eukaryotic cell.   35. The host cell of claim 34, which produces at least one compound selected from the group consisting of valencene, a valencene metabolite other than nootkatone, and nootkatone.   36. The host cell of claim 35, which is a bacterial cell.   37. The host cell according to claim 36, which is E. coli.   35. The host cell according to claim 34, wherein the host cell is a prokaryotic cell and the nucleic acid sequence encoding valencene synthase is stably integrated into the cell's genome. A method for producing a recombinant valencene synthase comprising:
Culturing a host cell comprising an expression vector, wherein the expression vector comprises a nucleic acid sequence encoding a valencene synthase, and the valencene synthase can convert FPP to valencene under conditions suitable for the expression of the valencene synthase. Including a method. 40. The method of claim 39, further comprising recovering the valencene synthase. 40. The method of claim 39, further comprising recovering valencene. 40. The method of claim 39, further comprising recovering at least one valencene metabolite.   43. The method of claim 42, wherein the at least one valencene metabolite is Nootkaton.   40. The method of claim 39, wherein the valencene synthase is derived from a citrus plant species.   45. The method of claim 44, wherein the valencene synthase is derived from orange.   40. The method of claim 39, wherein the nucleic acid has at least 80% homology to SEQ ID NO: 1 or its complementary strand.   47. The method of claim 46, wherein the nucleic acid has at least 90% homology to SEQ ID NO: 1 or its complementary strand.   The nucleic acid comprises an amino acid sequence having (a) at least 70% homology to SEQ ID NO: 2; and (b) at least one contiguous amino acid sequence comprising the consensus motif of SEQ ID NO: 3 40. The method of claim 39, encoding valencene synthase.   40. The method of claim 39, wherein the nucleic acid encodes a valencene synthase comprising an amino acid sequence having at least 80% homology to SEQ ID NO: 2.   50. The method of claim 49, wherein the nucleic acid encodes a valencene synthase comprising an amino acid sequence having at least 90% homology to SEQ ID NO: 2.   40. The method of claim 39, wherein the host cell is selected from a prokaryotic cell or a eukaryotic cell.   52. The method of claim 51, wherein the host cell is a prokaryotic cell and the nucleic acid sequence encoding valencene synthase is stably integrated into the cell's genome.   52. The method of claim 51, wherein the host cell is a bacterial cell.   54. The method of claim 53, wherein the host cell is E. coli.   40. The method of claim 39, wherein the expression vector is selected from a plasmid or a virus.   The expression vector further comprises at least one element selected from the group consisting of a promoter operably linked to a polynucleotide encoding valencene synthase, a selectable marker, a signal sequence, a replication origin, an enhancer, and a transcription termination sequence. 56. The method of claim 55.   57. Use of valencene obtained by the method according to any one of claims 39 to 56 in an industrial application selected from the group consisting of agriculture, cosmetics and food.   A plant comprising a nucleic acid sequence encoding valencene synthase, wherein the valencene synthase can convert farnesyl pyrophosphate into valencene.   59. A plant according to claim 58, wherein the valencene synthase is derived from a citrus plant species.   60. The plant of claim 59, wherein the valencene synthase is derived from orange.   59. The plant of claim 58, wherein the nucleic acid sequence has at least 80% homology to SEQ ID NO: 1 or its complementary strand.   62. The plant of claim 61, wherein the nucleic acid sequence has at least 90% homology to SEQ ID NO: 1 or its complementary strand.   Valensen synthase, wherein the nucleic acid sequence comprises (a) at least 70% homology to SEQ ID NO: 2; and (b) at least one amino acid sequence having the consensus motif of SEQ ID NO: 3 of consecutive amino acids 59. The plant of claim 58, which encodes.   59. The plant of claim 58, wherein the nucleic acid sequence encodes a valencene synthase comprising an amino acid sequence having at least 80% homology to SEQ ID NO: 2.   65. The plant of claim 64, comprising a nucleic acid encoding a valencene synthase comprising an amino acid sequence having at least 90% homology to SEQ ID NO: 2.   66. The plant according to any one of claims 58 to 65, which produces at least one compound selected from the group consisting of valencene, a valencene metabolite other than nootkatone, and nootkatone. 59. The plant of claim 58, wherein the nucleic acid sequence encoding valencene synthase is stably integrated into the genome of the plant.

Images