CN107653234B - Zingiber officinale benzenoid type ester flower fragrance gene HcBSMT and application thereof - Google Patents

Abstract

The invention discloses a ginger flower benzenoid type ester flower fragrance geneHcBSMTAnd applications thereof. The above-mentionedHcBSMTThe full-length cDNA sequence of the gene is shown as SEQ ID NO. 1; the full-length DNA sequence is shown as SEQ ID NO. 2; the coding sequence is shown as SEQ ID NO. 3, and the coded amino acid sequence is shown as SEQ ID NO. 4.HcBSMTThe gene is expressed in the fragrant ginger flower tissue, is not expressed in the non-fragrant ginger flower tissue, the expression is regulated and controlled by flower development, and the expression mode is related to flower fragrance release. Will be provided withHcBSMTThe gene is introduced into ginger flower or other plant cells to obtain a transgenic plant with flower fragrance for expressing the gene; and specific molecular markers can be generated according to the gene sequence information of the Zingiber officinale, and are used for identifying the floral genotype of the Zingiber officinale and filial generations thereof and for molecular marker-assisted selective breeding, so that the breeding selection efficiency is improved, and the application prospect is wide.

Description

Zingiber officinale benzenoid type ester flower fragrance gene HcBSMT and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a ginger flowerBenzenoid type ester flower fragrance geneHcBSMTAnd applications thereof.

Background

Floral scent is one of the important aesthetic and commercial traits of ornamental plants, and has been receiving more and more attention in recent years. Studies have shown that consumers prefer floral varieties with an aromatic odor (Pichersky) over non-scented varietieset al., 2007). According to modern medical research, the flower fragrance of many plants can make people joyful, calm, relieve fatigue, revive, and play a certain role in health care and disease treatment (Yangxhang et al, 2001). In addition, the vanilla plants can also be used for extracting plant essential oil, are widely applied to the cosmetic and pharmaceutical industries, and have higher commercial value.

Floral scents are complex mixtures of many low molecular weight, low boiling point, volatile lipophilic molecules (Dudareva)et al., 2008). To date, over 1700 volatile aromas (Knudsen) have been identified in over 1000 plantset al., 2006). Among them, benzenoid type esters are an important class of volatile substances constituting floral scents, in particular methyl benzoate and methyl salicylate, which are important constituents constituting floral scents, and which are present in floral scents of more than 100 plants (Effmert)et al.2005) biosynthesis of methyl benzoate starting from the aromatic amino acid phenylalanine, the first key step in biosynthesis is catalyzed by Phenylalanine Ammonia Lyase (PAL) which deaminates phenylalanine to form trans-cinnamic acid (Wildermuth, 2006.) the conversion of trans-cinnamic acid to a volatile benzene ring requires the removal of two carbon units from the propyl side chain, a process which can be accomplished by two separate catalytic pathways, β -and non- β -oxidation pathways (Boatright)et al.2004) currently, trans-cinnamic acid is transported from the cytoplasm to the peroxisomes (Bussell) under the action of peroxisomal ATP-binding cassette transporters (PXAs) for the β -oxidation pathwayet al.2014), followed by thioesterification of trans-cinnamic acid by cinnamoyl-coa ligase (CNL) (Colquhoun)et al., 2012；Klempienet al.2012), and then through meatThe hydration and dehydrogenation step (Qualley) is completed by cinnamoyl coenzyme A hydrate dehydrogenase (CHD)et al.2012), finally formation of benzoyl-coa (Van Moerkercke) catalyzed by ketoacyl-coa thiolase (KAT)et al.2009) for the non β -oxidation pathway, benzaldehyde is oxidized to benzoic acid (Long) by benzaldehyde dehydrogenase (BALDH) as an important intermediate productet al.2009), however, the process of trans-cinnamic acid to form benzaldehyde is not clear. At the final stage, the methyltransferase of the SABATH family will thenS-transfer of the methyl group of adenosylmethionine (SAM) to a benzenoid carboxylic acid, resulting in a benzenoid floral (D' Auria) with an aromatic odoret al., 2003）。

SABATH is a family of plant-specific methyltransferases, which catalyze the methylation of small plant molecules of N atoms or carboxyl groups, and the sequences of which are very different from those of other types of methyltransferases, thus forming a new class of methyltransferases, which respectively extract the two English letters of the names of the three earliest discovered members, named as SABATH family, Salicylic Acid Methyltransferase (SAMT), Benzoic Acid Methyltransferase (BAMT) and theobromine synthase (D' Auria), respectivelyet al., 2003). SAMT of the fan of fairy is the earliest member of the family, catalyzing the formation of methyl salicylate (Ross) from salicylic acid and SAMet al., 1999). Goldfish BAMT utilizes benzoic acid to generate methyl benzoate (Murfitt)et al., 2000). Some of the SABATH family members are bifunctional, i.e., having SAMT and BAMT activity at the same time, and are therefore referred to as salicylic acid/benzoic acid methyltransferase (BSMT) (Chen)et al., 2003；Pottet al., 2004). BSMT is a terminal enzyme for methyl benzoate biosynthesis, and plays an important regulation role in methyl benzoate biosynthesis. At present, foreign researchers are also only on Arabidopsis (Chen)et al.2003), petunia (Negre)et al.2003) and ornamental tobacco (Hippauf)et al.2010), etc., while less reports have been made in monocots.

Disclosure of Invention

At present, the formation research of SABATH methyltransferase and flower fragrance in China is rarely reported, and no report of the benzene ring type ester flower fragrance gene of the ginger flower is found until the patent application. The cloning of the floral scent gene is a precondition for researching the floral scent formation mechanism of the ginger flower, and the molecular mechanism for disclosing the floral scent formation of the ginger flower can provide a theoretical basis for increasing the floral scent. This provides a new way for breeding new plant variety with strong flower fragrance by adopting gene engineering method. The invention aims to separate and clone a gene carried in ginger flower for controlling benzenoid ester flower fragrance component methyl benzoateHcBSMT。

Another object of the present invention is to provide a protein encoded by the above gene. .

Another object of the present invention is to provide an expression vector containing the above gene.

The invention also aims to provide application of the gene in generating molecular markers and breeding floral varieties, application in cultivating transgenic floral plants, and application of protein encoded by the gene in preparing essences and medicines.

The invention realizes the above purpose by the following technical scheme:

phenylring type ester flower fragrance gene of ginger flowerHcBSMTThe full-length cDNA sequence of the gene is shown as SEQ ID NO. 1, and the full-length cDNA sequence is 1422 bp; the full-length DNA sequence of the gene is shown as SEQ ID NO. 2, and the full-length DNA sequence is 1797 bp.

Phenylring type ester flower fragrance gene of ginger flowerHcBSMTGenes for endowing ginger flower with methyl benzoate fragrance and ginger flower benzenoid type ester fragranceHcBSMTThe expression is carried out in the fragrant ginger flower tissue, and is not carried out in the non-fragrant ginger flower tissue, and the expression is in obvious positive correlation with the flower development process. The gene coding sequence (CDS) is shown as SEQ ID NO:3, 1134 bp in total, and is presumed to code 377 amino acids, the sequence of the protein is shown as SEQ ID NO. 4, the molecular weight of the protein is 43 kDa, and a plurality of conserved SAM and phenyl carboxylic acid substrate binding sites are arranged in the gene sequence. The DNA sequence has a length of 1506 bp, and comprises 4 introns respectively positioned at positions 82-167, 306-405, 679-785 and 1059-1140The cutting positions all accord with the GT-AG rule.

Meanwhile, the invention also provides a pair of genes for amplifying the benzene ring type ester flower fragrance of the ginger flowerHcBSMTThe primer sequence of (1) is shown as SEQ ID NO. 5-6.

A recombinant vector containing the phenylring-type ester floral gene of the zingiber officinale roscoeHcBSMT。

A recombinant bacterium comprising the recombinant vector of claim 5.

A cell line comprising the recombinant vector of claim 5.

The invention relates to a benzene ring type ester flower fragrance gene of ginger flowerHcBSMTThe coded protein can catalyze the reaction of benzoic acid and SAM to generate methyl benzoate and salicylic acid and SAM to generate methyl salicylate in vitro or in a plant body, shows the maximum catalytic activity under the conditions of 25 ℃ and pH 6.5, and has the catalytic activity on substrates of benzoic acid and salicylic acidKThe M values are 87.73 +/-7.03 and 26.73 +/-3.88 mu M respectively.

As mentioned above, the genes of the phenyl ring type esters of Zingiber officinale RoscoeHcBSMTThe application of the method is to use the phenylring type ester floral scent gene of the ginger flowerHcBSMTConnecting to plant transformation vector, then introducing into ginger flower or other plant cell to obtain the gene for expressing said ginger flower benzenoid type ester flower fragranceHcBSMTThe transgenic variety with flower fragrance.

As mentioned above, the genes of the phenyl ring type esters of Zingiber officinale RoscoeHcBSMTThe gene is used for generating specific molecular markers according to the gene, and is used for identifying the filial generation of the zingiberis with benzenoid ester fragrance.

As mentioned above, the genes of the phenyl ring type esters of Zingiber officinale RoscoeHcBSMTUse of the encoded protein in the preparation of a flavour and/or a medicament.

The invention also comprisesHcBSMTChimeric genes formed by the linkage of appropriate regulatory sequences operatively to the major structural part of floral genes, as well as plants and seeds of such plants comprising such genes in their genome. Such genes may be native or chimeric. For example, a fragment containing the gene is ligated with a constitutively expressed promoter, which can be ligated under any conditions with a promoterExpressed at any stage of cellular development. Such constitutively expressed promoters include 35S promoter of cauliflower mosaic virus, and the like. Alternatively, the gene may be linked to a tissue-specific or developmental-stage-specific or precisely environmentally inducible promoter, referred to as an inducible promoter. Therefore, the expression of the gene can be changed depending on the environment and the development period, and similarly, the expression of the gene can be restricted to a certain tissue, so that the resistance reaction induced by the gene can be artificially controlled. Wherein the environmental conditions comprise attack of pests and diseases, high and low temperature, light and the like, and the tissues and the development period comprise leaves, fruits, seeds, flowers and the like.

According to the inventionHcBSMTGene sequence information can be easily obtained by the following method by those skilled in the artHcBSMTEquivalent genes: (1) obtaining through database retrieval; (2) to be provided withHcBSMTThe gene fragment is obtained by screening a genomic library or a cDNA library of the ginger flower or other plants by using a probe; (3) according toHcBSMTDesigning oligonucleotide primer based on gene sequence information, and obtaining from the genome, mRNA and cDNA of ginger flower or other closely related plants by PCR amplification; (4) in thatHcBSMTOn the basis of gene sequence, the gene sequence is obtained by modification by a gene engineering method; (5) the gene is obtained by a chemical synthesis method.

The ginger flower fragrance gene provided by the inventionHcBSMTHas important application value. One of the applications is to be describedHcBSMTThe gene sequence is connected to any plant transformation vector and is transformed by any transformation methodHcBSMTThe floral gene is introduced into ginger flower or other plant cells to obtain transgenic plants with floral fragrance, so that the transgenic plants can be applied to production. The gene is constructed in a plant transformation vector, the gene or a regulatory sequence thereof can be modified appropriately, and other promoters can be used for replacing the original promoter of the gene before a transcription initiation codon, so that the flower fragrance generating and resistance enhancing capabilities of plants are widened and enhanced.

Another application of the floral gene provided by the invention is to generate specific molecular markers according to the gene sequence information, including but not limited to SNP (single nucleotide polymorphism), SSR (simple sequence repeat polymorphism), RFLP (restriction endonuclease length polymorphism), CAP (cut amplified fragment polymorphism). The markers can be used for identifying the floral genotype of the Zingiber and filial generations thereof, and are used for molecular marker-assisted selective breeding, so that the selection efficiency of breeding is improved.

Compared with the prior art, the invention has the following beneficial effects:

the invention obtains the benzene ring type ester floral scent gene of the ginger flowerHcBSMTIs a key gene for biosynthesis and release of methyl benzoate as a main component of the floral fragrance of the ginger flowers; the protein coded by the gene can catalyze the reaction of benzoic acid and SAM to generate methyl benzoate in vitro or in a plant body, and catalyze the reaction of salicylic acid and SAM to generate methyl salicylate; the floral gene is transferred into a plant without floral fragrance, which is beneficial to generating new floral plants. In particular, a plurality of floral genes can be accumulated in a plant by using a transformation technique without causing a problem of linkage of undesirable genes in the genome accompanying conventional breeding techniques, and the breeding time can be shortened. The cloning of floral gene is a precondition for overcoming the problem that floral gene can not be transferred between plant species in traditional breeding. In addition, the present invention can further provide or apply the floral transgenic plant and corresponding seed obtained by using the above DNA fragment, and the plant transformed with the gene of the present invention or a recombinant based on the gene or the seed obtained from such a plant. The gene of the invention can be transferred to other plants by sexual crossing.

Drawings

FIG. 1 shows the release of methyl benzoate in ginger flowerHcBSMTAnalyzing the gene expression of (1); a: the release rule of the methyl benzoate in different organs of the ginger flower; b: the release rule of methyl benzoate in different flower development periods; c:HcBSMTanalyzing the expression of different organs of the ginger flower; d:HcBSMTanalyzing the expression of the petals in different development stages; and SS: style and stigma; a: anther; f: filament; l: a lip; and (3) LP: a side lobe; se: sepals; pe: flower stalk; b: bract; le: a blade; ri: and (4) rootstalk.

FIG. 2 is an in vitro functional analysis of the HcBSMT recombinant protein; a and B: a total ion chromatogram and a mass spectrum of a product generated by catalyzing Benzoic Acid (BA) and Salicylic Acid (SA) by HcBSMT; c: total ion chromatogram and mass spectrum of methyl benzoate; d: a total ion chromatogram and mass spectrum of methyl salicylate; e and F: empty vector control.

FIG. 3 is a graph of transient transformation of tobacco leaves to identify HcBSMT function; a and B: EGFP as a negative control; c and D: tobacco lamina transient transformationHcBSMTAnd a selective ion chromatogram of the product generated by injecting Benzoic Acid (BA) and Salicylic Acid (SA) substrates; e: selective ion chromatogram of methyl benzoate; f: selective ion chromatogram of methyl salicylate.

FIG. 4 is a biochemical analysis of the HcBMST protein; a: analyzing the influence of temperature on the catalytic activity of HcBMST; b: analyzing the influence of pH on the catalytic activity of HcBMST; c: enzyme kinetic analysis of HcBMST catalytic substrate benzoic acid; d: enzyme kinetic analysis of HcBMST catalytic substrate benzoic acid.

Detailed Description

The present invention will be described in further detail with reference to the following drawings and specific examples. Unless otherwise indicated, the reagents and methods employed in the examples are those conventionally used in the art.

Example 1HcBSMTGene cDNA and DNA full Length obtaining

S1, extracting RNA from ginger flower petals: the extraction of the ginger petal RNA adopts Trizol method. Weighing 0.1 g of petal material, quickly grinding into powder in liquid nitrogen, transferring into a centrifuge tube containing 1.0 ml of Trizol, vigorously shaking, mixing, and standing at room temperature for 5 min. Centrifuge at 12,000 g for 5min at 4 ℃. Carefully sucking the supernatant, transferring into a new centrifuge tube, adding 200. mu.l chloroform, tightly covering the centrifuge tube, mixing until the solution is milky white, and standing at room temperature for 5 min. Centrifuge at 4 ℃ at 12,000 g for 15 min. And (4) sucking the supernatant, transferring the supernatant into another new centrifuge tube, adding isopropanol with the same volume, turning the centrifuge tube upside down, fully mixing the mixture, and standing the mixture at room temperature for 10 min. Centrifuge at 4 ℃ at 12,000 g for 10 min. Carefully discard the supernatant, wash the precipitate with 75% ethanol 2-3 times, centrifuge at 7,500g 4 ℃ for 5min, and carefully discard the supernatant. The centrifuge tube lid was opened and the pellet was dried at room temperature for several minutes. After the precipitate is dried, an appropriate amount of RNase-free water is added to dissolve the precipitate.

S2. first strand cDNA Synthesis: using the total RNA of the ginger flower petals as a template, and synthesizing first strand cDNA by using M-MLV reverse transcriptase. 1000 ng of Total RNA, 1. mu.l of Oligo d (T) were added to the microcentrifuge tube₁₈Primers, 1. mu. ldNTP (10 mM each), supplemented with RNase-Free H₂O to 10. mu.l. Mixing gently, centrifuging for several seconds, water bathing at 70 deg.C for 10min, and immediately ice bathing for 2 min. Mu.l of 5 XM-MLV buffer, 0.5. mu.l of RNase initiator (40U/. mu.l) and 1. mu. l M-MLV reverse transcriptase are added in sequence to supplement RNase-Free H₂O to 20. mu.l. Slightly centrifuging, inactivating reverse transcriptase in 42 deg.C water bath for 60 min, inactivating reverse transcriptase in 70 deg.C water bath for 15 min, cooling on ice for 2 min, and storing at-20 deg.C for use.

S3.cDNA full-length cloning, synthesizing gene full-length cloning primer HcBSMT-F: CCCGTAGTTCCATGCTCCAT shown as SEQ ID NO:5, HcBSMT-R: GTTTCAATTTACGTCCACATCAGC shown as SEQ ID NO:6, using ginger flower cDNA as a template, adopting high-fidelity DNA polymerase KOD-plus (TOYOBO) to carry out PCR amplification reaction under the conditions of 94 ℃, pre-denaturation for 3 min, 98 ℃, denaturation for 10 s and 68 ℃, annealing/extension for 2 min and 40 cycles, finally, denaturing at 68 ℃, using TBE buffer solution to prepare 1.0% agarose gel, then carrying out agarose gel electrophoresis on the PCR product, cutting out agarose gel containing purposeful DNA under an ultraviolet lamp, carrying out gel recovery by using a gel recovery kit of Shanghai worker, eluting and recovering the product by 40 mul, carrying out A tail reaction on the recovered product by using rTaq DNA polymerase (TaKaRa), connecting the recovered product to a carrier under the conditions of 72 ℃, using pMD19-T to T, inoculating the supernatant of TaTaq DNA polymerase (TaKa) to 100 mu G) and carrying out rapid culture on a mixed liquid containing 100 mu LB medium, shaking and inoculating the supernatant of 100 mu LB medium to 100 mu LB medium, after the medium is inverted and cultured, and the supernatant of 100 mu.10 mu.20 mu.4 ℃ and the supernatant of the medium is quickly cultured, and the supernatant of the medium is added to obtain a white agarose gel, the mediumIncubate overnight at 37 ℃ on a water bath shaker at 180 rpm. The plasmid of overnight cultured bacteria is extracted by using a small plasmid extraction kit of Shanghai worker, and the extracted plasmid is subjected to double enzyme digestion identification. Sequencing and analyzing the positive clone by using M13 sequencing primer to obtainHcBSMTThe full-length cDNA sequence of the gene is shown as SEQ ID NO. 1, the coding sequence (CDS) is shown as SEQ ID NO. 3, and the deduced protein amino acid sequence is shown as SEQ ID NO. 4.

S4. DNA sequence cloning: extracting the genomic DNA of the petals or the leaves of the ginger flowers by using a plant genomic DNA extraction kit (TIANGEN). Performing PCR amplification with KOD-plus polymerase using the same cloning primer as in S3 and genomic DNA as template under the same conditions as in S3 to obtainHcBSMTThe genomic DNA sequence of (1) is shown as SEQ ID NO. 2.

Example 2 measurement of Zingiber officinale Roscoe type ester floral fragrance materials andHcBSMTanalysis of gene expression

S1, determining ginger flower phenyl ring type ester flower fragrance substances: sealing a sample to be detected in a gas detection device, adding 1.728 mu g of ethyl decanoate as an internal standard, collecting flower aroma substances and the internal standard substances for 30 min, inserting an 50/30 mu m DVB/CAR/PDMS extraction head (Supelco) for extraction for 30 min, then carrying out GC-MS detection and weighing the sample. The gas chromatography (Agilent 7890A GC syster) conditions were: the chromatographic column is HP-5MS (30 m is multiplied by 0.25 mu m); the carrier gas is high-purity helium, the temperature of a sample inlet is 250 ℃, the sample is injected without shunting, the flow rate of the column is 1 ml/min, and the resolving time is 3 min. Temperature programming: the column was started at 40 ℃ for 2 min and was ramped up to 250 ℃ at a rate of 10 ℃ per min for 5 min. Mass spectrometry (Agilent 5975 CMSD) conditions were: the interface temperature is 220 ℃, the electron bombardment source EI voltage is 1000V, the ion source temperature is 230 ℃, the electron energy is 70eV, the scanning mass range is 50-335 aum, and the acquired mass spectrum information is subjected to matching analysis by using a standard mass spectrum in an NIST library. The calculation formula of the aroma components is as follows: component content (μ ggFW)^-1h^-1) = internal standard mass × peak area of component/peak area of internal standard substance/fresh weight of flower.

S2.HcBSMTAnalysis of gene expression of (1): ginger flower bud using plant total RNA extraction kit (magenta)Extracting total RNA of the sample at the same position; total RNA was extracted from samples of petals at different developmental stages by Trizol method, which was the same as "example 1S 1". Mu.g of total RNA was subjected to RNA reverse transcription using PrimeScript reverse transcription kit (TaKaRa), and the cDNA product obtained by the reverse transcription was diluted 20-fold and used for real-time fluorescent quantitative PCR. Using Primer Premier 5.0 softwareHcBSMTDesigning a fluorescent quantitative PCR primer in a 3' untranslated region of the gene, wherein an upstream primer F: AGGAGAAAGCCAATCACACC, as shown in SEQ ID NO: 7; a downstream primer R: GGCATGATTCAGTTTGACAAG, as shown in SEQ ID NO: 8. The specificity of the primers was checked by gel electrophoresis, sequencing and dissolution curve, using standard curve methods to detect the amplification efficiency and correlation coefficient of each pair of primers. The assay used an ABI7500 fluorescent quantitative PCR system with 20. mu.l reaction system containing 10. mu.l iTaq Universal SYBR Green Supermix (Bio-Rad), 0.2. mu.M upstream/downstream primers, 2. mu.l cDNA template and appropriate amount of purified water. The reaction program was pre-denatured at 95 ℃ for 30 s, followed by denaturation at 95 ℃ for 15 s, annealing at 55 ℃ for 30 s, extension at 72 ℃ for 30 s, 40 cycles, and the dissolution profile program was started at 60 ℃ with a 1% ramp rate to 95 ℃. Three technical replicates were performed for each sample. The expression analysis of different parts of the ginger flower is screened in the early stage of useACTAnd (3) as an internal reference gene, carrying out homogenization treatment of gene expression among samples, wherein an upstream primer F: GTATGTTGCTATTCAGGCTGTCC, as shown in SEQ ID NO: 9; a downstream primer R: GAAGAATGGCATGAGGTAGAGC, as shown in SEQ ID NO: 10. Method for screening ginger flower petal in early stage of expression analysis in different development stagesRPSAnd (3) as an internal reference gene, carrying out homogenization treatment of gene expression among samples, wherein an upstream primer F: TTAGTAGCATCGGCTGCAATAAG, as shown in SEQ ID NO: 11; a downstream primer R: CTCTTTTGGGAAGACGGTTGAG, as shown in SEQ ID NO: 12. By using 2^－△△CtMethod (Livak)et al.2001) calculating the relative expression between different samples.

The results of the measurement of benzenoid ester floral material and the gene expression analysis are shown in FIG. 1. As can be seen from the figure: the main benzene ring type ester flower fragrance substance in the ginger flower fragrance component is methyl benzoate. The main release parts of the methyl benzoate are side flaps, lip flaps, sepals and filaments, in addition, the style and the stigma, the anther and the pedicel are also released in a small amount,while the bracts, leaves and rhizomes were not detectable for the release of methyl benzoate. In the flower development process, the release of the methyl benzoate is hardly detected in the bud period (0-16 h), a trace amount of methyl benzoate is detected in the initial blooming period (24 h), the release amount of the methyl benzoate is gradually increased along with the blooming of the flower to the full bloom period (40 h), the release amounts of 48 h and 56 h are reduced, and the release amount of the methyl benzoate reaches the maximum in the aging period (64 h). As shown by the fluorescent quantitative PCR analysis,HcBSMTthe gene is specifically expressed in the floral organs, with a higher expression level in the labial, lateral and sepals, and hardly expressed in the non-floral organ sites (bracts, leaves and rhizomes). In the process of the flower development, the flower growth,HcBSMTthe gene is hardly expressed in the petal development process from 0 h to 24 h; from the half bloom stage (32 h) of the petals, the gene expression is rapidly increased, and the high expression level is maintained in the full bloom stage and the aging stage (40-64 h). The above results show that it is possible to obtain,HcBSMTthe expression of the gene is very obviously related to the release of the methyl benzoate, which indicates thatHcBSMTIs a key gene for biosynthesis and release of methyl benzoate as a main component of the flower fragrance of the ginger flowers.

Example 3 HcBSMT in vitro functional assay

S1, vector construction: according toHcBSMTcDNA sequence of a Gene designed to containEcoRI andNoti, specific primer of enzyme cutting site, upstream primer F:GAATTCATGGGTTTGAAGGTGGAGCA, as shown in SEQ ID NO: 13; a downstream primer R:GCGGCCGCATACTCTTTTCTTCAAGGCAA TGAC, as shown in SEQ ID NO: 14. PCR amplification is carried out by using a high fidelity enzyme KOD-plus, an amplification product is recovered, double enzyme digestion is carried out for 3 hours at 37 ℃ together with a pET-30a vector, and a DNA fragment is purified after the enzyme digestion is finished. The purified target fragment and the vector were ligated with T4 DNA ligase overnight at 16 ℃ to transform the ligation product intoE.coliDH5 α was competent, and after sequencing to confirm it, the recombinant plasmid was transferred into the pLysS strain Rosetta2 (DE 3).

S2, recombinant protein expression and purification: single colonies were picked and inoculated into 5 ml LB (50 mg/l Kan, 34 mg/l Chl) liquid medium and shake-cultured overnight at 37 ℃. Transferring 100 mul of seed solution into fresh 100 ml (containing 50 mg/lKan, 34 mg-l Chl) is cultured in an LB liquid culture medium at 37 ℃ and 180 rpm until the OD value is 0.4-0.6, 0.02 mMIPTG is added, and induction is carried out for 24-48 h at 16 ℃. The cells were collected by centrifugation and 5 ml of lysis buffer (50 mM NaH) was used₂ PO ₄300 mM NaCl, 10mM imidazole, pH 8.0) and placed on ice to sonicate the cells three times for 5min each. 12000 rpm, 4 degrees C centrifugal 10min, the supernatant transfer to new centrifugal tube, with double distilled water washing precipitation, and then 5 ml lysis buffer suspension precipitation. And respectively taking the supernatant and the precipitate of 15 mu l, and carrying out SDS-PAGE electrophoretic analysis.

S3, recombinant protein purification: and (3) filling 0.5 ml of Ni-NTA HisBind Resins (novagen) into a chromatographic column, standing at 4 ℃ vertically overnight, draining internal liquid after resin is precipitated, adding 5 ml of double distilled water, repeatedly washing for 5-10 times, and pre-cooling at 4 ℃.5 ml of cell lysis supernatant was added to a pre-cooled chromatography column, mixed well and combined on a shaker at 4 ℃ for 1 h at low speed. And (4) allowing the liquid to flow out, collecting the liquid in a 15 ml centrifuge tube, and taking 15 mu l of effluent liquid for SDS-PAGE analysis. 4 ml of washing buffer (50 mM NaH) was added₂ PO ₄300 mM NaCl, 20 mM imidazole, pH 8.0), washing the column twice, collecting the washing liquid of each part, marked as W1 and W2, and taking 15 mul each for SDS-PAGE analysis. 0.5 ml of elution buffer (50 mM NaH) was added to each of the samples₂PO₄300 mM NaCl, 250 mM imidazole, pH 8.0), collecting the eluates of each part in turn by different collecting tubes respectively, marking the eluates as E1, E2, E3 and E4, and taking 15 muL of each part to carry out SDS-PAGE analysis. According to the SDS-PAGE results, the fractions with higher purity and concentration were transferred to a dialysis bag by a pipette and dialyzed overnight at 4 ℃ for 2 times. A standard curve was prepared using bovine serum albumin, and the protein concentration of the purified sample was determined.

S4, enzyme catalysis function identification: 1 ml of the reaction solution (50 mM Tris-HCl, pH 7.0, 0.2 mM SAM, 100 mM KCl, 2 mM benzoic acid or salicylic acid and 10. mu.g of purified recombinant protein) was prepared in a glass reaction flask and sealed, followed by water bath at 25 ℃ for 1 hour. An 50/30 μm DVB/CAR/PDMS extraction head (Supelco) was inserted into a sealed reaction flask, and after 30 min of solid phase microextraction in the headspace of a water bath at 50 ℃, the extraction head was inserted into a GC-MS injection port for analysis, and the gas chromatography and mass spectrometry conditions were the same as in "example 2S 1". And determining the types of the methylated products by comparing the retention time and the mass spectrum of the reaction products and the standard.

S5, enzyme catalytic activity analysis: the standard reaction system and reaction conditions of the enzyme catalytic activity analysis are the same as those of S4, and the reaction solution is placed under different temperature conditions to analyze the influence of different temperatures on the enzyme catalytic activity. 50 mM Tris-HCl buffers with different pH values are prepared, and the influence of different pH values on the enzyme catalytic activity is analyzed. And respectively taking benzoic acid (0-500 mu M) and salicylic acid (0-500 mu M) with different concentrations as substrates, and analyzing the enzyme kinetic characteristics of the HcBSMT on the substrates benzoic acid and salicylic acid.

The results of the enzyme catalytic function analysis and the catalytic activity analysis are shown in FIGS. 2 and 4. As can be seen from fig. 2: HcBSMT can catalyze the reaction of benzoic acid and SAM to generate methyl benzoate, and can catalyze the reaction of salicylic acid and SAM to generate methyl salicylate, and no methylation product is detected in the blank control, which indicates that HcBSMT is benzoic acid/salicylic acid methyltransferase. As can be seen from fig. 4: HcBSMT showed the largest enzyme catalytic activity at 25 ℃ and pH 6.5, for the substrate benzoic acidKM value of 87.73 +/-7.03 mu M, for substrate salicylic acidKThe M value is 26.73 +/-3.88 mu M.

Example 4HcBSMTInstant conversion tobacco leaf

S1, vector construction and agrobacterium transformation: according toHcBSMTcDNA sequence of a Gene designed to containSacI andKpni, specific primer of enzyme cutting site, upstream primer F:GAGCTCATGGGTTTGAAGG TGGAGCA, as shown in SEQ ID NO: 15; a downstream primer R:GGTACCTTATACTCTTTTCTTC AAGGCAATG, as shown in SEQ ID NO:16, PCR amplification is carried out by using high fidelity enzyme KOD-plus, after the amplification product is recovered, the double enzymes are cut into pGreenII 62-SK vector, DH5 α is transformed, after the sequencing is confirmed, the recombinant plasmid is transferred into Agrobacterium GV3101psoup strain.

S2, agrobacterium culture and tobacco transient transformation: and (3) selecting a single agrobacterium colony, inoculating the single agrobacterium colony in an LB liquid culture medium containing Rif (50 mu g/ml) + Kan (50 mu g/ml), and performing shake culture at the temperature of 28 ℃ and the rpm of 200 for 24 hours. Centrifuging at 5,000 g for 10min, discarding supernatant, and suspending with pure waterAfter the incubation, 5,000 g was centrifuged for 10min, and the supernatant was discarded. With permeation buffer (10 mM MES, pH 5.2, 10mM MgCl)₂0.1 mM acetosyringone) to OD₆₀₀About 0.4, and left at room temperature for 3 hours. A1 ml syringe without needle head sucks the agrobacterium tumefaciens suspension liquid to perform infiltration dip-dyeing on the tobacco leaves, and the tobacco leaves are placed in a culture room for continuous culture after being infected.

S3, volatile matter detection of tobacco leaves: after 3 days of culture, 1 ml of needle-free injector is used for penetrating and injecting 1 mM benzoic acid or salicylic acid into the tobacco leaves which are impregnated with the agrobacterium tumefaciens, the whole tobacco is sealed in a 500 ml glass bottle, the tobacco volatile matter is extracted for 6-12 h by a solid phase microextraction method, and then GC-MS analysis is carried out, wherein the conditions of gas chromatography and mass spectrum are the same as those of 'example 2S 1'. And determining the type of the methylated product by comparing the retention time and the mass spectrum of the reaction product and the standard.

The results of the measurement of the volatile components of tobacco lamina are shown in FIG. 3, from which it can be seen that: after the EGFP is transiently transformed, a large number of green fluorescence signals can be observed under a fluorescence microscope, which indicates that the transformation system has higher transformation efficiency. Transient transformationHcBSMTGene, after injecting substrate benzoic acid at the same time, a large amount of methyl benzoate can be detected in volatile matters of the leaves; transient transformationHcBSMTGene, and after the substrate salicylic acid is injected at the same time, a large amount of methyl salicylate is generated in the volatile matter of the leaf. Therefore, the HcBSMT also has the functions of catalyzing benzoic acid to generate methyl benzoate and catalyzing salicylic acid to generate methyl salicylate in plants.

Sequence listing

<110> southern China university of agriculture

<120> hydrocyclo-type ester floral gene HcBSMT of zingiber officinale roscoe and application thereof

<130>1713511ZBSH042

<141>2017-10-17

<160>16

<170>SIPOSequenceListing 1.0

<210>1

<211>1422

<212>DNA

<213> Lily bulb (Lilium brown var. viridulum)

<400>1

cccgtagttc catgctccat aaacctcaca tttcatactc accaaatcct caggccctca 60

gaagagtgtg tgtgtgagag agagggagaa agatgggttt gaaggtggag caagctcttc 120

acatggttgg gggttctggt gaaactagct acgccaccaa ctcgagactc caagagaagg 180

cgatctatcg aacgaagcct gtgttggcga ccaccatcga agaaatgtat aaagggttgc 240

tccctgagca tatggtcgtt gttgatcttg gttgctcttc tggttctaac acattcattg 300

tggtctctca ggtactcgac atcattgttg aactccgtcg tatgatggag atgaagaagc 360

cattggaggt gcaattcttc ttgaacgacc tcccagggaa tgacttcaac tatgtctttc 420

aatccctaga taagttcaag aacaaggtgg aggaggagag taagggggag ttgttggtgc 480

cgtattatgt ggtcggagtg gcaggatcat tctacgggag gcttttccct tgcgcgagtg 540

tccatttctt tcattcttcc tattgtctaa tgtggctctc acaggtcccc gaagagctag 600

agaacgacca aggtgtttca ctaaataaag gaaatatcta ttggacagaa acaagttcgt 660

cccaagtaga aaaagcatat cgagagcaat ataagaaaga ctttttgaca tttcttaggt 720

caagatatat agaactaaac attggaggtg gaatgatgtt gacatttcta ggaagaagaa 780

aaagaactcc cggtcacggt gacttatgtc atctttggag actacttgca gaagctctta 840

actcgatggt cttagaggaa atcataccag aagaaaaagt tagcaccttc aatttgccaa 900

tttacggacc ttcacttgaa gaggtgaagt ctataatcca tcacgaagga ttattcgatt 960

tggatcgagt agagatcttt gaatccagtt gggatccatt tgacgattca ggagatgatt 1020

cttttgatct atcaaactat acaaaaagtg cgaaaaatgt ggcggattgc attcgggctg 1080

tggtcgaacc cttgattgtg catcaatttg gagatgtcat acttgatgat ttattcacaa 1140

gatacgcgca gaatgttctg aaacaccttc tcaaggagaa agccaatcac accattttag 1200

tcattgcctt gaagaaaaga gtataaaatt cagcaaggaa aataaaggag aataaatatt 1260

ctgcaagaga atttgttatt attatcattc tcaaattagt tctcatgtga atctttttcg 1320

tttccttgtc aaactgaatc atgcccatcc taaaaatcaa gcattagata tgatcaaatt 1380

ttatatgata attttaaagc tgatgtggac gtaaattgaa ac 1422

<210>2

<211>1797

<212>DNA

<213> Lily bulb (Lilium brown var. viridulum)

<400>2

cccgtagttc catgctccat aaacctcaca tttcatactc accaaatcct caggccctca 60

gaagagtgtg tgtgtgagag agagggagaa agatgggttt gaaggtggag caagctcttc 120

acatggttgg gggttctggt gaaactagct acgccaccaa ctcgagactc caagtcgatc 180

aatgcaactc tctaaattgt attttctttt agtatctaaa tttataagta gattttgatt 240

atcatgtata catgctcagg agaaggcgat ctatcgaacg aagcctgtgt tggcgaccac 300

catcgaagaa atgtataaag ggttgctccc tgagcatatg gtcgttgttg atcttggttg 360

ctcttctggt tctaacacat tcattgtggt ctctcaggta aataggatgc tactccttga 420

gcaaattatg atcattgttg attttagttg ctcttttggt cctaactcct aacatattcc 480

ttgtggtctc tgatcaggta ctcgacatca ttgttgaact ccgtcgtatg atggagatga 540

agaagccatt ggaggtgcaa ttcttcttga acgacctccc agggaatgac ttcaactatg 600

tctttcaatc cctagataag ttcaagaaca aggtggagga ggagagtaag ggggagttgt 660

tggtgccgta ttatgtggtc ggagtggcag gatcattcta cgggaggctt ttcccttgcg 720

cgagtgtcca tttctttcat tcttcctatt gtctaatgtg gctctcacag gtacttaatt 780

aatctctctc taatagtata gtatcgacca actttaatat acataatact ttttcttctt 840

aattttacta atcatatata atttgaatct attataggtc cccgaagagc tagagaacga 900

ccaaggtgtt tcactaaata aaggaaatat ctattggaca gaaacaagtt cgtcccaagt 960

agaaaaagca tatcgagagc aatataagaa agactttttg acatttctta ggtcaagata 1020

tatagaacta aacattggag gtggaatgat gttgacattt ctaggaagaa gaaaaagaac 1080

tcccggtcac ggtgacttat gtcatctttg gagactactt gcagaagctc ttaactcgat 1140

ggtcttagag gtttgtattt aactaatttt atgattaaat atgtaaaaat gactgcaact 1200

aatgttgatt tttttttcct atatgtattt aggaaatcat accagaagaa aaagttagca 1260

ccttcaattt gccaatttac ggaccttcac ttgaagaggt gaagtctata atccatcacg 1320

aaggattatt cgatttggat cgagtagaga tctttgaatc cagttgggat ccatttgacg 1380

attcaggaga tgattctttt gatctatcaa actatacaaa aagtgcgaaa aatgtggcgg 1440

attgcattcg ggctgtggtc gaacccttga ttgtgcatca atttggagat gtcatacttg 1500

atgatttatt cacaagatac gcgcagaatg ttctgaaaca ccttctcaag gagaaagcca 1560

atcacaccat tttagtcatt gccttgaaga aaagagtata aaattcagca aggaaaataa 1620

aggagaataa atattctgca agagaatttg ttattattat cattctcaaa ttagttctca 1680

tgtgaatctt tttcgtttcc ttgtcaaact gaatcatgcc catcctaaaa atcaagcatt 1740

agatatgatc aaattttata tgataatttt aaagctgatg tggacgtaaa ttgaaac 1797

<210>3

<211>1134

<212>DNA

<213> Lily bulb (Lilium brown var. viridulum)

<400>3

atgggtttga aggtggagca agctcttcac atggttgggg gttctggtga aactagctac 60

gccaccaact cgagactcca agagaaggcg atctatcgaa cgaagcctgt gttggcgacc 120

accatcgaag aaatgtataa agggttgctc cctgagcata tggtcgttgt tgatcttggt 180

tgctcttctg gttctaacac attcattgtg gtctctcagg tactcgacat cattgttgaa 240

ctccgtcgta tgatggagat gaagaagcca ttggaggtgc aattcttctt gaacgacctc 300

ccagggaatg acttcaacta tgtctttcaa tccctagata agttcaagaa caaggtggag 360

gaggagagta agggggagtt gttggtgccg tattatgtgg tcggagtggc aggatcattc 420

tacgggaggc ttttcccttg cgcgagtgtc catttctttc attcttccta ttgtctaatg 480

tggctctcac aggtccccga agagctagag aacgaccaag gtgtttcact aaataaagga 540

aatatctatt ggacagaaac aagttcgtcc caagtagaaa aagcatatcg agagcaatat 600

aagaaagact ttttgacatt tcttaggtca agatatatag aactaaacat tggaggtgga 660

atgatgttga catttctagg aagaagaaaa agaactcccg gtcacggtga cttatgtcat 720

ctttggagac tacttgcaga agctcttaac tcgatggtct tagaggaaat cataccagaa 780

gaaaaagtta gcaccttcaa tttgccaatt tacggacctt cacttgaaga ggtgaagtct 840

ataatccatc acgaaggatt attcgatttg gatcgagtag agatctttga atccagttgg 900

gatccatttg acgattcagg agatgattct tttgatctat caaactatac aaaaagtgcg 960

aaaaatgtgg cggattgcat tcgggctgtg gtcgaaccct tgattgtgca tcaatttgga 1020

gatgtcatac ttgatgattt attcacaaga tacgcgcaga atgttctgaa acaccttctc 1080

aaggagaaag ccaatcacac cattttagtc attgccttga agaaaagagt ataa 1134

<210>4

<211>377

<212>PRT

<213> Lily bulb (Lilium brown var. viridulum)

<400>4

Met Gly Leu Lys Val Glu Gln Ala Leu His Met Val Gly Gly Ser Gly

1 5 10 15

Glu Thr Ser Tyr Ala Thr Asn Ser Arg Leu Gln Glu Lys Ala Ile Tyr

20 25 30

Arg Thr Lys Pro Val Leu Ala Thr Thr Ile Glu Glu Met Tyr Lys Gly

35 40 45

Leu Leu Pro Glu His Met Val Val Val Asp Leu Gly Cys Ser Ser Gly

50 55 60

Ser Asn Thr Phe Ile Val Val Ser Gln Val Leu Asp Ile Ile Val Glu

65 70 75 80

Leu Arg Arg Met Met Glu Met Lys Lys Pro Leu Glu Val Gln Phe Phe

85 90 95

Leu Asn Asp Leu Pro Gly Asn Asp Phe Asn Tyr Val Phe Gln Ser Leu

100 105 110

Asp Lys Phe Lys Asn Lys Val Glu Glu Glu Ser Lys Gly Glu Leu Leu

115 120 125

Val Pro Tyr Tyr Val Val Gly Val Ala Gly Ser Phe Tyr Gly Arg Leu

130 135 140

Phe Pro Cys Ala Ser Val His Phe Phe His Ser Ser Tyr Cys Leu Met

145 150 155 160

Trp Leu Ser Gln Val Pro Glu Glu Leu Glu Asn Asp Gln Gly Val Ser

165 170 175

Leu Asn Lys Gly Asn Ile Tyr Trp Thr Glu Thr Ser Ser Ser Gln Val

180 185 190

Glu Lys Ala Tyr Arg Glu Gln Tyr Lys Lys Asp Phe Leu Thr Phe Leu

195 200 205

Arg Ser Arg Tyr Ile Glu Leu Asn Ile Gly Gly Gly Met Met Leu Thr

210 215 220

Phe Leu Gly Arg Arg Lys Arg Thr Pro Gly His Gly Asp Leu Cys His

225 230 235 240

Leu Trp Arg Leu Leu Ala Glu Ala Leu Asn Ser Met Val Leu Glu Glu

245 250 255

Ile Ile Pro Glu Glu Lys Val Ser Thr Phe Asn Leu Pro Ile Tyr Gly

260 265 270

Pro Ser Leu Glu Glu Val Lys Ser Ile Ile His His Glu Gly Leu Phe

275 280 285

Asp Leu Asp Arg Val Glu Ile Phe Glu Ser Ser Trp Asp Pro Phe Asp

290 295 300

Asp Ser Gly Asp Asp Ser Phe Asp Leu Ser Asn Tyr Thr Lys Ser Ala

305 310 315 320

Lys Asn Val Ala Asp Cys Ile Arg Ala Val Val Glu Pro Leu Ile Val

325 330 335

His Gln Phe Gly Asp Val Ile Leu Asp Asp Leu Phe Thr Arg Tyr Ala

340 345 350

Gln Asn Val Leu Lys His Leu Leu Lys Glu Lys Ala Asn His Thr Ile

355 360 365

Leu Val Ile Ala Leu Lys Lys Arg Val

370375

<210>5

<211>20

<212>DNA

<213> Lily bulb (Lilium brown var. viridulum)

<400>5

cccgtagttc catgctccat 20

<210>6

<211>24

<212>DNA

<213> Lily bulb (Lilium brown var. viridulum)

<400>6

gtttcaattt acgtccacat cagc 24

<210>7

<211>20

<212>DNA

<213> Lily bulb (Lilium brown var. viridulum)

<400>7

aggagaaagc caatcacacc 20

<210>8

<211>21

<212>DNA

<213> Lily bulb (Lilium brown var. viridulum)

<400>8

ggcatgattc agtttgacaa g 21

<210>9

<211>23

<212>DNA

<213> Lily bulb (Lilium brown var. viridulum)

<400>9

gtatgttgct attcaggctg tcc 23

<210>10

<211>22

<212>DNA

<213> Lily bulb (Lilium brown var. viridulum)

<400>10

gaagaatggc atgaggtaga gc 22

<210>11

<211>23

<212>DNA

<213> Lily bulb (Lilium brown var. viridulum)

<400>11

ttagtagcat cggctgcaat aag 23

<210>12

<211>22

<212>DNA

<213> Lily bulb (Lilium brown var. viridulum)

<400>12

ctcttttggg aagacggttg ag 22

<210>13

<211>26

<212>DNA

<213> Lily bulb (Lilium brown var. viridulum)

<400>13

gaattcatgg gtttgaaggt ggagca 26

<210>14

<211>33

<212>DNA

<213> Lily bulb (Lilium brown var. viridulum)

<400>14

gcggccgcat actcttttct tcaaggcaat gac 33

<210>15

<211>26

<212>DNA

<213> Lily bulb (Lilium brown var. viridulum)

<400>15

gagctcatgg gtttgaaggt ggagca 26

<210>16

<211>31

<212>DNA

<213> Lily bulb (Lilium brown var. viridulum)

<400>16

ggtaccttat actcttttct tcaaggcaat g 31

Claims (9)

1. A peltate flower fragrance gene HcBSMT is characterized in that the full-length cDNA sequence of the gene is shown as SEQID NO. 1; the full-length DNA sequence of the gene is shown as SEQ ID NO. 2; the gene coding sequence is shown in SEQ ID NO. 3.

2. The protein encoded by the pelargonium zingiberensis floral benzenoid flower fragrance gene HcBSMT as claimed in claim 1, wherein the amino acid sequence of the protein is shown as SEQ ID NO. 4.

3. A primer pair for amplifying a benzocyclo-type ester floral scent gene HcBSMT is characterized in that the sequence of the primer pair is shown as SEQ ID NO 5-6, SEQ ID NO 13-14 or SEQ ID NO 15-16.

4. A fluorescent quantitative PCR primer for detecting a phenylcyclo-type ester floral scent gene HcBSMT is characterized in that the sequence of the primer is shown as SEQ ID NO. 7-8.

5. A recombinant vector comprising the zingiber officinale roscoe benzenoid flower fragrance gene HcBSMT of claim 1.

6. A recombinant bacterium comprising the recombinant vector of claim 5.

7. A cell line comprising the recombinant vector of claim 5.

8. The use of the phenformin flower fragrance gene HcBSMT according to claim 1, wherein the phenformin flower fragrance gene HcBSMT is ligated to a plant transformation vector and introduced into a plant cell to obtain a transgenic variety expressing the phenformin flower fragrance gene HcBSMT.

9. The use of the protein encoded by the phenformin type ester floral scent gene HcBSMT of claim 2 in the preparation of a perfume.

Images