CN103436537B - Lily ester floral gene LoAAT1 and application thereof - Google Patents

Abstract

The invention belongs to the technical field of gene engineering, and in particular discloses a lily ester floral gene LoAAT1 and application thereof. A nucleotide sequence of the LoAAT1 gene is shown in SEQ ID NO: 1-2, and an amino acid sequence of protein coded by the gene is shown in SEQ ID NO: 3. The LoAAT1 gene is expressed in lily tissue with fragrance and is not expressed in lily varieties having no fragrance, and the expression s related to a development process of flower. The LoAAT1 gene can be linked to any one plant transformation vector and introduced into cells of lily or other plants, to obtain transgenic fragrance expressing the gene, thus being used for production; in addition, a molecular marker can be generated depending on the gene sequence information, and the molecular marker is used for identifying fragrance genotype of lily or other plants and for marker-assisted selective breeding, thus enhancing selecting efficiency of breeding.

Description

A kind of lily ester class floral base is because of LoAAT1 and application thereof

Technical field

The present invention relates to gene engineering technology field, particularly, relate to a kind of lily ester class floral base because of loAAT1and application.

Background technology

The fragrance of a flower of most plants is to be mixed and formed by a series of low-molecular-weight volatile matters, and its chemical composition is mainly terpene compound, phenylpropionic acid compound/benzenoid and derivative of fatty acid (Pichersky et al, 2006; Dudareva et al, 2004).The phenylpropyl alcohol alkanes ester constituents ethyl benzoate forming through shikimic acid pathway is one of lily principal character aroma component (Fan Yanping, 2008).

Ethyl benzoate is phenylpropionic acid compound/benzenoid, and it is with L-Phe precursor.In plastid, by shikimic acid pathway, produce phenylalanine, under the katalysis of phenylalanine lyase (PAL), generate styracin.Styracin is synthesizing benzaldehyde, phenylformic acid under the katalysis of a series of enzymes, and under phenylformic acid CoA ligase (BZL) effect, phenylformic acid forms benzoyl CoA (Boatright J. et al, 2004), finally under alcohol acyltransferase (AAT) catalysis, generate, this enzyme is to control the end key enzyme that ethyl benzoate forms.

Nordstrom(1962) point out first the synthetic main effect that relies on acyltransferase or ester synthetic enzyme of ester class in yeast.Up to the present, three different alcohol acyl transferase genes from different yeast, have been cloned.Flower and fruit are the synthetic major organs of ester class volatile component in plant materials, and ripe ester class volatile component has formed flower and the distinctive fragrance of fruit, and this process is also relevant with alcohol acyltransferase.Ueda and Ogata(1977) find synthetic dependence acyl-CoA and the acyltransferase of the ester class volatile aroma composition in banana cells extracting solution.After this, people have studied alcohol acyltransferase and the ester class volatile matter relation between synthetic in the fruit such as strawberry, apple, pineapple, muskmelon.In these fruits, the formation of Ester is all under the effect of alcohol acyltransferase, the acyl group in acyl-CoA s is transferred to alcohols substrate and formed ester.Perez et al.(1993) research of AAT activity during 4 strawberry cultivars fruit maturations is shown, each kind AAT activity all increases with fruit maturation, but different varieties maximum activity is widely different.Shalit et al.(2001) research shows, rich aromatic melon variety ' Arava ' mature fruit becomes to be grouped into significantly different from volatile aroma in underdone fruit.

In recent years, along with the development of biotechnology, in flower and fruit, several alcohol acyl transferase genes have been cloned.Research discovery, the similar enzyme of these structure and functions is the new classification that Acyltransferases (EC 2.3.1.x) evolution comes, and all belongs to the BAHD gene family of Acyltransferases.In plant the earliest isolated alcohol acyl transferase gene from clarkia breweriflower, bEATcoding phenylcarbinol Transacetylase, has regulated and controled the metabolism of phenylmethyl acetate, belongs to (the Dudareva of BAHD family of acyltransferase et al, 1998).D ' Auria et al.(2002) adopt the search of expressed sequence tag (EST) library to obtain from fairy maiden's fan in conjunction with cDNA end rapid amplifying (RACE) technology bEBTthe total length of cDNA.This gene and plant acyl transferase gene sequence have very large homology, belong to the BAHD family in acyltransferase. bEBTin colored and injured blade, there is expression, show that peruscabin also plays a role in plant defense mechanism.

Aharoni et al.(2000) adopt first expressed sequence tag (EST) library search in conjunction with volatile component of plant spectrum, utilize cDNA chip separated new alcohol acyl transferase gene relevant to aromatic odour from ripe strawberry fruit sAAT.It has the ability that catalysis medium chain fatty acid acetic ester forms.In Charentais muskmelon, clone two and there is high homology (87%; at protein level, determine) alcohol acyl transferase gene; CM-AAT1(GenBank CAA94432) and CM-AAT2(GenBank AF468022); 461 amino acid of encoding; molecular weight is respectively 51.5KD and 51.8 KD, and pI is respectively 8 and 8.5.Transformed yeast finds that CM-AAT1 has the ability of synthesizing ester volatile component, and CM-AAT2 does not detect alcohol acyltransferase activity.Shalit et al.(2003) in containing 1834 monogenic Rose est databases, retrieve, find that 3 possible est sequences are similar to the BAHD alcohol acyl transferase gene in known other source.One of them cDNA is named as rhAAT1, the polypeptide of 458 amino-acid residues of coding, its molecular weight 51.8 KD, pI 5.45, belong to BAHD acyltransferase family.By homology comparison, this protein sequence and strawberry SAAT albumen have 69% homology.Boatright et al.(2004) in to the research of petunia, the method for language function genomics clone phenylcarbinol/phenylethyl alcohol benzoyl transferase gene ( bPBT).The BEBT gene of the aminoacid sequence of this gene and tobacco and fairy maiden's fan bEATall there is higher homology.Phenylcarbinol/phenylethyl alcohol benzoyl transferring enzyme be take benzoyl-CoA as benzoyl donor, take phenylcarbinol and phenylethyl alcohol as precursor, and benzoyl is transferred on phenylcarbinol and phenylethyl alcohol, forms peruscabin and phenylethyl benzoate.Li et al.(2006) by RT-PCR and RACE-PCR technical point from the alcohol acyl transferase gene in Qiao Na golden apple and golden delicious apples fruit, respectively called after mdAAT1 He mdAAT2.Its total length is respectively: 1,639 bp and 1,628 bp, the two homology on amino acid levels is 94.26%.Sequence alignment is found mdAAT2 also contain BAHD gene family and the total conserved regions of other known alcohol acyl transferase gene: HXXXD and FGWG.Cluster analysis finds, MdAAT2 albumen is nearest with the pear fruit alcohol acyl transferase proteins sibship that belongs to Rosaceae pomaceous fruit together, and far away with the alcohol acyl transferase proteins sibship such as lemon, strawberry, Rose.In addition, Yoshioka and Hashimoto (1981) find that alcohol acyltransferase is to be positioned on cytolemma in yeast research, and the enzymatic property of this enzyme is conducted a preliminary study.D ' Auria(2002) think that the member of most of BAHD family is considered to be positioned tenuigenin.Fujiwara et al.(1998) to three flower rough gentian ( gentiana triflora) 5-O-glucoside aromatic acyl transferase carry out immunolocalization research and find that it is mainly distributed in the tenuigenin of upper epidermis cell.Yet Yu et al.(2008) find puncture vine clover ( medicago truncatula) in the MtMaT1 of BAHD family be positioned in nucleus.

In recent years, the secondary biosynthetic genetic manipulation of the plant fragrance of a flower has become a popular research field.Guterman et al.(2006) will from Chinese rose, clone aATalso in leading-in petunia, result produces acetic acid Bian ester and Phenylethyl ethanoate in transfer-gen plant.This provides an effective approach for adopting genetic engineering technique to cultivate fragrant flower kind.

Summary of the invention

At present, the domestic rarely seen report of research to alcohol acyltransferase and fragrance of a flower formation, until do not find flower of Greenish Lily perfume base because of report before present patent application.Clone's floral base is because being the prerequisite to lily fragrance of a flower formation mechanism study, and the molecule mechanism that discloses the lily fragrance of a flower can increase the fragrance of a flower.This provides a brand-new approach for adopting engineered method to cultivate tool foundation for heavy florals new variety of plant.A gene of controlling ester class fragrance of a flower composition ethyl benzoate that the object of the invention is to carry in the lily flower of Greenish Lily of separating clone siberian.

Another object of the present invention is to provide the protein of said gene coding.

Another object of the present invention is to provide the carrier that contains said gene.

Another object of the present invention is to provide the transgenic plant that contain above-mentioned carrier.

A further object of the invention be to provide said gene produce molecule marker and in seed selection to the application in fragrance of a flower kind, and the application of the protein of said gene coding in preparing essence and medicine.

The present invention's above-mentioned purpose that is achieved by the following technical programs:

A kind of lily ester class floral base because of loAAT1, the full length cDNA sequence of described gene as shown in SEQ ID NO:1, the long 1380bp of full length cDNA sequence; The full length DNA sequence of gene as shown in SEQ ID NO:2, the long 1472bp of full length DNA sequence.

Lily ester class floral base because of loAAT1give ginger flower Linaool fragrance, and lily ester class floral base because of loAAT1at dulcet flower of Greenish Lily tissue expression, in the lily kind of British plain spirits, do not express, and its expression is relevant with flower development process.This gene gene coding region altogether 1380bp(is full length cDNA sequence), infer 459 amino acid of its coding, molecular weight of albumen is 50 kDa.In this gene order, have two conserved sequences of HXXXD and DFGWG, DNA full length nucleotide sequence length is 1472bp, comprises 1 intron, is positioned at 442nd～533, total 92bp, and clipped position all meets " GT-AG rule ".By prokaryotic expression, also by reaction substrate ethanol and benzoyl-CoA reactant, generate ethyl benzoate outward.

A kind of lily ester class floral base because of loAAT1the protein of coding, the aminoacid sequence of described albumen is as shown in SEQ ID NO:3.

A pair of for increase lily ester class floral base because of loAAT1primer, primer sequence is as shown in SEQ ID NO:10～11.

A recombinant vectors, inserts in the multiple clone site of the carrier that sets out, described in claim 1 lily ester class floral base because of loAAT1sequence.The described carrier that sets out can be all types of plant expression vectors of often using in the art, and preferably, the present invention's plant expression vector used is pMOGMON plant expression vector.

A kind of recombinant bacterium of recombinant vectors as mentioned above that comprises.A kind of clone of recombinant vectors as mentioned above that comprises.

Transgenic plant, contain carrier as mentioned above.

As mentioned above lily ester class floral base because of loAAT1application, be specially by lily ester class floral base because of loAAT1be connected in plant conversion carrier, then import in lily or other vegetable cell, obtain and express described lily ester class floral base because of the transgenosis fragrance of a flower kind of LoAAT1.

As mentioned above lily ester class floral base because of loAAT1application, be specially according to this gene and produce specific molecule marker, for the identification of the fragrance of a flower genotype of lily or other plant.

As mentioned above lily ester class floral base because of loAAT1the application of the protein of coding in preparing essence and medicine.

The present invention comprise equally by loAAT1floral base because of primary structure part effectively connect the upper suitable formed mosaic gene of adjusting sequence, and in genome, comprise the plant of this gene and the seed of this kind of plant.If this gene can be natural or chimeric.For example, the fragment that comprises this gene is connected with the promotor of a constitutive expression, this promotor can and be expressed under any condition cytocerastic any period.The promotor of this constitutive expression comprises the promotor of cauliflower mosaic virus 35S etc.On the other hand, also can by the promotor of this gene and a tissue specific expression or the specific expressed promotor of developmental stage or accurately the promotor of environmental induction be connected, these promotors are referred to as inducible promoter.Like this, the change of environment, the difference of developmental stage can change the expression of this gene, same, also the expression of this gene can be limited in some tissues, makes to obtain artificial control by this gene induced resistance reaction.The attack that wherein envrionment conditions comprises disease and pest, the gentle light of height etc., tissue and developmental stage comprise leaf, fruit, seed and flower etc.

According to provided by the invention loAAT1gene order information, those skilled in the art can easily obtain by the following method with loAAT1the gene being equal to: (1) obtains by database retrieval; (2) with loAAT1gene fragment is that genomic library or the cDNA library of probe screening ginger or other plant obtains; (3) basis loAAT1gene order information design Oligonucleolide primers, obtains from genome, mRNA and the cDNA of ginger or other plant by the method for pcr amplification; (4) exist loAAT1on the basis of gene order, with gene engineering method transformation, obtain; (5) by the method for chemosynthesis, obtain this gene.

Flower of Greenish Lily perfume base provided by the invention because of loAAT1there is important using value.One of application is by described loAAT1gene order is connected to any plant conversion carrier, will with any method for transformation loAAT1floral base, because importing lily or other plant cell, can obtain the transgenosis fragrance of a flower of expressing said gene, thereby is applied to produce.Of the present invention gene constructed in plant conversion carrier, can suitably modify described gene or its regulating and controlling sequence, also can before its transcription initiation codon, by other promotor, replace the original promotor of described gene, thereby widen and strengthen plant, produce the fragrance of a flower and the ability that strengthens resistance.

Floral base provided by the invention because of Another application be to produce specific molecule marker according to described gene order information, include but not limited to SNP(mononucleotide polymorphic), SSR(simple sequence repeats polymorphic), RFLP(restriction enzyme length is polymorphic), CAP(cutting amplified fragments is polymorphic).With these marks, can identify the fragrance of a flower genotype of lily or other plant, for molecular marker assisted selection breeding, thereby improve the efficiency of selection of breeding.

Compared with prior art, the present invention has following beneficial effect:

The present invention because proceeding to the plant without the fragrance of a flower, contributes to produce new fragrance of a flower plant by clone's floral base.Particularly can with transformation technology in plant cumulative a plurality of floral bases because of, and can not produce the chain problem of bad gene in the genome of following appearance in traditional breeding technology, and can shorten breeding time.Floral base because of clone be overcome in traditional breeding method, can not between plant species, shift floral base because of the prerequisite of problem.In addition, the present invention can further provide or transfer-gen plant and the corresponding seed of the fragrance of a flower that the above-mentioned DNA fragmentation of applications exploiting obtains, and the plant transforming with gene of the present invention or the recombinant chou based on this gene or by the seed of this class plant acquisition.Can gene of the present invention be proceeded to other plant by the mode of sexual hybridization.

figure of description

Fig. 1. loAAT1expression in the different lily kind of fragrance of a flower ethyl benzoate burst size; A: the burst size of the fragrant principal constituent ethyl benzoate of flower of Greenish Lily hemp nettle; B: lily petal loATT1expression level; C: different lily kinds.

Fig. 2. loAAT1expression and different tissues expression specificity at floral organ different development stage; A:Siberia lily Different Organs loAAT1expression level; The burst size of the different flower growth period ethyl benzoates of B:Siberia lily flower; C:Siberia lily different flowering period; D:Siberia lily petal loAAT1expression amount; E:Siberia lily calyx loAAT1expression amount; F:Siberia lily stamen loAAT1expression amount; G:Siberia lily gynoecium loAAT1expression amount.

Fig. 3. loAAT1recombinant protein vitro enzyme catalyzed reaction; A:pET-28a- loAAT1recombinant protein vitro enzyme catalytic reaction products chromatogram and mass spectroscopy figure; B: ethyl benzoate standard specimen chromatogram and mass spectroscopy figure.

Fig. 4. loAAT1the PCR of transgenic tobacco plant detects figure.

Embodiment

Below in conjunction with the drawings and specific embodiments, further describe the present invention.Unless stated otherwise, the reagent adopting in embodiment and method are conventional reagent and the method for using in this area.

Embodiment 1 loAAT1the acquisition of gene cDNA and DNA total length:

S1. the extraction of lily petal RNA: take 0.2g lily phase petal in full bloom, adding liquid nitrogen is ground into powder rapidly, proceed to fast 4 ℃ deposit be added with 0.5 mL2 % CTAB(containing 0.1% mercaptoethanol) in 2 mL centrifuge tubes of extracting solution, vibration is to thoroughly mixing; Room temperature is placed 5min, keeps flat centrifuge tube, makes surface-area maximum; 4 ℃ of centrifugal 1min of 12000rpm, supernatant proceeds to new for RNase centrifuge tube.Add 0.1mL5M NaCl, gentleness mixes; Add 0.3mL chloroform, turn upside down and mix; 4 ℃ of centrifugal 10min of 12000rpm, get upper strata water and proceed to new for RNase centrifuge tube.Add the Virahol with the isopyknic precooling of gained water, put upside down and mix, room temperature is placed 10min, keeps flat centrifuge tube, makes surface-area maximum; 4 ℃ of 12000 centrifugal 10min of rpm, discards supernatant, notes not pouring out precipitation, adds 1 mL 75% ethanol (preparation of DEPC water) washing RNA precipitation, puts upside down and mixes; 4 ℃ of 5000 centrifugal 3min of rpm, pouring liquids, notes not pouring out precipitation.Remaining a small amount of liquid is of short duration centrifugal, then uses the sucking-off of rifle head, and room temperature is dried 2～3 min; Add 30 μ L DEPC H ₂o, piping and druming, mixes repeatedly, fully dissolves RNA.Being put in-80 ℃ saves backup.

S2. the total RNA of petal of the lily of usining phase in full bloom is as template, with synthetic the first chain cDNA of raw work M-MuLV First cDNA Synthesis Kit.According to the genes involved primers of reporting in GenBank nucleic acid database, upstream primer F1:TCTCCAAGGCTCTGGTGTTCTA (T/C) TA (T/C) CC (A/C/G/T) is T (G/T/C); As shown in SEQ ID NO:4.Downstream primer R1:TGCATGAACCTGATAGCGAAG (A/G) is (A/G) AA (A/C/G/T) CC (A/C/G/T) CC (T/C); As shown in SEQ ID NO:5.And transfer to Shanghai bio-engineering corporation synthetic.The above-mentioned synthetic cDNA of take carries out pcr amplification reaction as template adopts TaKaRa PCR Amplification Kit, and concrete grammar carries out to specifications.PCR program is: 94 ℃ of denaturation 4min; 94 ℃ of sex change 30s, 57 ℃ of renaturation 30s, 72 ℃ of extension 1min, 30 circulations; Then 72 ℃ are extended 10min.At-20 ℃, save backup.After PCR reaction finishes, with whether containing object fragment band in 1.0% agarose gel electrophoresis Preliminary detection PCR product.Pcr amplification product is after 1% agarose gel electrophoresis detects, with scalpel, under ultraviolet lamp, cut out the blob of viscose that contains object fragment, with DNA gel, reclaim test kit (Agarose Gel DNA Purification Kit, TaKaRa) and reclaim the basic reference reagent box of recovery method specification sheets.To carry out 1% agarose electrophoresis detection to reclaiming product afterwards, see its recovering effect and concentration roughly, to guarantee the carrying out of follow-up test.According to the object clip size and the effective concentration thereof that reclaim, the product of getting appropriate recovery purifying is connected with cloning vector, and carrier is selected TaKaRa pMD18-T carrier, and the mol ratio of target DNA and cloning vector is controlled at 3:1 left and right, and concrete operations by specification carries out.At 16 ℃, constant temperature connects 3～6h, and the length of tie-time is depending on the length of object fragment.In advance competent cell DH5 α (TaKaRa) is taken out from-80 ℃ of refrigerators, and be placed in ice chest and treat that it melts naturally, 10 μ L connecting fluid full doses are added in the centrifuge tube of competent cell, after ice bath 30min, 42 ℃ of water-bath heat shock 50s, place rapidly 2～5min on ice, then add the SOC liquid nutrient medium 890 μ L of 37 ℃ of pre-temperature to supply 1mL, mix 180rpm shaking culture 1h at latter 37 ℃.At the X-gal(20mg/mL containing being coated with 30 μ L on the LB solid medium planar surface of 100 μ g/mL penbritins) and 30 μ L IPTG(20mg/mL), then be coated with appropriate conversion fluid, liquid to be transformed is inverted in incubated overnight in 37 ℃ of thermostat containers after being absorbed completely, observations after about 16h, by the blue hickie screening of X-gal/IPTG white colony, and preliminary evaluation recombinant plasmid, flat board is placed in 4 ℃ of preservations.After blue hickie preliminary screening, extract plasmid after conventionally selecting 6 bacterial plaques to shake bacterium, for further evaluation.With the toothpick of sterilizing from LB plate culture medium the single colony inoculation of picking white in the LB liquid nutrient medium that contains 100 μ g/mL penbritins, 37 ℃, the cultivation of 240rpm shaken overnight on temperature control shaking water bath shaking table, with the little test kit (sub-biological company limited is won in Shanghai) of taking out of plasmid DNA, extract plasmid, on step by specification, method is carried out.Institute's upgrading grain is carried out to 1.0% agarose gel electrophoresis detection, relatively plasmid size and by the plasmid obviously lagging behind carry out double digestion ( ecoRi/ hindiII, TaKaRa) analyzes.At 37 ℃, enzyme is cut after 1h, enzyme is cut to product and carry out 1.0% agarose gel electrophoresis detection.Arbitrarily selecting and recommending enzyme cuts after identifying and carries out determined dna sequence containing the recombinant plasmid of object fragment.Examining order transfers to Shanghai Ying Jun Bioisystech Co., Ltd to complete, and adopts American AB I377 sequenator.The sequence of gained is compared and homology analysis at NCBI.

According to the cDNA fragment sequence having obtained, utilize biosoftware Primer Premier 5.0 designing two special primers, 3 '-RACE 1st Primer:GAGTTGCTCTTCGACGTTGAG near 3 of fragment sequence ' end; As shown in SEQ ID NO:6; 3 '-RACE 2nd Primer:CGCTGATCCTAATTCAGGTGACTC; As shown in SEQ ID NO:7.After analyzing, biosoftware Oligo 6.0 transfer to Shanghai bio-engineering corporation synthetic.Oligo (dT)-3 ' end anchor primer of take is primer, and cDNA the first chain is synthesized in reverse transcription.Using synthetic cDNA the first chain as template, with 3 ' times primers and 3 ' end anchor primer, carry out 3 ' end PCR amplification.PCR program is: 94 ℃ of denaturation 3min; 94 ℃ of sex change 30s, renaturation 30s(temperature are depending on concrete), 72 ℃ of extension 1min, 30 circulations; Then 72 ℃ of total elongation 10min.After PCR reaction solution dilutes 10-100 times for the first time, as template, with 3 ' bis-times nested primers, carry out PCR reaction for the second time.After PCR reaction finishes, with whether containing object fragment band in 1.0% agarose gel electrophoresis Preliminary detection PCR product.Through reclaiming, detecting, select and recommend at random enzyme and cut after identifying and carry out determined dna sequence containing the recombinant plasmid of object fragment.Examining order transfers to Shanghai Ying Jun Bioisystech Co., Ltd to complete, and adopts American AB I377 sequenator.The sequence of sequencing result and cDNA fragment is spliced to analysis, judge its be whether cDNA fragment sequence 3 ' extension.

Utilize equally known cDNA fragment sequence, at the Position Design pair of primers near its 5 ' end, 5 '-RACE 1st Primer:CGAGCCGAACATTGGCATCAG; As shown in SEQ ID NO:8; 3 '-RACE 2nd Primer:TAGAACACCAGAGCCTTGGA; As shown in SEQ ID NO:9.The method that adopts 5 ' end to add joint is carried out, and through reclaiming, detecting, selects and recommends at random enzyme and cuts after identifying and carry out determined dna sequence containing the recombinant plasmid of object fragment.Examining order transfers to Shanghai Ying Jun Bioisystech Co., Ltd to complete.The sequence of sequencing result and cDNA fragment is spliced to analysis, judge its be whether cDNA fragment sequence 5 ' extension.

To resulting fragment sequence, 3 ' and 5 ' sequence carry out after Blast analysis, the SeqMan program of utilizing DNAstar software package is by the splicing of comparing of three fragments, splicing institute calling sequence is terpene synthase gene cDNA full length sequence.The cDNA full length sequence of splicing gained carries out homology relatively and analyzes the protein sequence of nucleotide sequence and derivation again on NCBI.

The acquisition of gene cDNA full length sequence:

Gene cDNA total length according to having obtained, designs and synthesizes upstream and downstream primer, Hctps1-P1:ATGGCATCATCCCTCACTTTCTC; As shown in SEQ ID NO:10.Hctps1-P2:CTA GAGGGCAGAAGCAATAAAC; As shown in SEQ ID NO:11.Take lily cDNA as template, adopt TaKaRa PCR Amplification Kit to carry out pcr amplification reaction.Reaction conditions is: 94 ℃ of denaturation 4min; 94 ℃ of sex change 30s, renaturation 30s(temperature are depending on concrete), 72 ℃ of extension 3min, 35 circulations; Then 72 ℃ of total elongation 10min.Get 5 μ LPCR products and carrying out electrophoresis evaluation, observation experiment result under UV-light containing in the sepharose of ethidium bromide 0.8%.

Application Agarose Gel DNA Purification Kit Ver. 2.0(TaKaRa), according to operation instructions, PCR product purification is reclaimed, reclaim product and be dissolved in 25 μ LElution Buffer.Get purifying and reclaim product 4 μ L, pMD20-T Vector 1 μ L, connecting fluid Solution I 5 μ L, form the linked system of 10 μ L, connect at 16 ℃ and spend the night.Transform coli strain DH5 α competent cell, coat on the LB solid medium that contains X-gal, IPTG, penbritin 37 ℃ of overnight incubation; Then select 20, white clone's spot in the LB liquid nutrient medium that contains penbritin, 37 ℃, 240rpm enlarged culturing 16-24h; With the little test kit (sub-biological company limited is won in Shanghai) of taking out of plasmid DNA, extract plasmid, agarose gel electrophoresis comparison plasmid size is also carried out enzyme by the plasmid obviously lagging behind and is cut evaluation.Random choose from the positive recombinant plasmid identifying, serves Hai Ying fine horse Bioisystech Co., Ltd and carries out sequencing.Obtain loAAT1the full length cDNA sequence of gene and full length DNA sequence, infer and its protein sequence according to cDNA sequence.

Embodiment 2 loAAT1the expression analysis of gene:

Different varieties lily petal, the RNA at siberian lily different development stage petal and lily different tissues position, siberian extracts the Trizol method (TaKaRa) of using, quantitative fluorescent PCR adopts SYBR green(TaRaKa) method, the concrete principle of dye method is shown in specification sheets.Utilize Primer Premier 5.0 software design real-time fluorescence quantitative PCR primers, press fluorescence quantification PCR primer principle of design, with Primer premier 5.0, design respectively primer, by fluorescence quantitative PCR detection, whether it has mispairing or primer dimer and amplification efficiency thereof, therefrom select a pair of best primer, P1:ATTGTGGTGCCAGTTTGCTTGC; As shown in SEQ ID NO:12.P2:CCCTTTTACCCTTCGTTGAACTTC; As shown in SEQ ID NO:13.Reference gene ACT, according to the principle of design of Real-time PCR primer, designs primers with Primer premier 5.0, ACT-P1:TTCGTGTTGCACCAGAAGAGC, and as shown in SEQ ID NO:14, ACT-P2:TGAATGGCGACATACATGGCAG; As shown in SEQ ID NO:15.By Real-time PCR, detect, and production standard curve, to detect its amplification efficiency (E), whether in 90～110% scopes, screen.The cDNA of each sample of take is template, carries out quantitative fluorescent PCR reaction on ABI quantitative real time PCR Instrument.Each sample is established 3 repetitions, with ddH ₂the negative contrast of O.Reaction system is SYBR Premix Ex Taq(TaKa Ra) 10.0 μ L, upstream primer (10 μ M) 0.4 μ L, downstream primer (10 μ M) 0.4 μ L, cDNA 2.0 μ L, ddH ₂o 7.2 μ L.Response procedures is 94 ℃, 30 s; 94 ℃, 15 s; 55 ℃, 30 s; 72 ℃, 30 min; 40 circulations, 94 ℃ of 15 s, 72 ℃ of 30 s, 0.4 ℃/s melt curve analysis is analyzed.Reaction finishes rear confirmation amplification curve and melt curve analysis, with 2 ^{-△ △ Ct}method (2 (Delta Delta C (T)), Livak and Schmittgen, 2001) is carried out data analysis, calculates lily loAAT1expression in different samples.Gene expression analysis the results are shown in Figure 1 and Fig. 2.From Fig. 1 and Fig. 2, can find out:

loAAT1only in the lily kind petal that has fragrance of a flower principal constituent ethyl benzoate to discharge, express, do not make into not express in minute kind of release, and expression amount becomes marked positive correlation with fragrance of a flower burst size; loAAT1only in flower of Greenish Lily organ, express, at vegetative organ such as root, stem and leaves, do not express, the expression amount of this gene becomes marked positive correlation, the maximum full-bloom stage petals of ethyl benzoate burst size period with different flowering loAAT1expression amount is the highest, and the not fragrant flower bud phase does not express, explanation loAAT1to control the synthetic key gene discharging of lily fragrance of a flower principal constituent ethyl benzoate.

Embodiment 3 hctps1gene prokaryotic:

S1. according to resulting loAAT1the cDNA total length of gene, with comprising bamhI and notthe special primer of I restriction enzyme site carries out pcr amplification.PCR product reclaims test kit with Takara and reclaims, and reclaims product and directly uses bamhI and notI restriction enzyme carries out double digestion, and 1% sepharose reclaims object fragment.PET-28a prokaryotic expression carrier is used bamhI and notI restriction enzyme carries out double digestion 1% sepharose and reclaims large fragment.In 16 ℃ of connections, spend the night, will connect product transform intestinal bacteria ( e. coli) DH5 α competent cell; Extract plasmid and cut and check order after evaluation through enzyme, obtain recombinant prokaryotic expression vector.

S2. use the recombinant plasmid dna through identifying to transform intestinal bacteria (Rosetta) competent cell, picking list colony inoculation in 5mL LB(containing 25 mg/L Kan, 34 mg/L Chl) in substratum, 37 ℃ of concussion overnight incubation.The 100 μ L seed liquor of transferring contain 25 mg/L Kan in fresh 100ml(, 34 mg/L Chl) in LB substratum, 37 ℃ of 180rpm cultivate 4～6h, survey a certain amount of IPTG(0.1～0.2mM of the rear use in OD value to 0.4～0.6) at 14～18 ℃ of induction 14～16h.Get another control group simultaneously and wherein do not add IPTG induction.Centrifugal collection thalline, with 5ml cracking buffer (50mM phosphoric acid buffer pH 8.0) suspension cell, thalline is cooling, be placed in ultrasonic disruption cell on ice.12000rpm, 4 ℃ of centrifugal 10min, move to supernatant in new centrifuge tube, by distilled water washing and precipitating once, then suspend and precipitate with 5mL cracking buffer.Get respectively each 50 μ L of cleer and peaceful precipitation, preserve and-20 ℃, carry out SDS-PAGE electrophoretic analysis.Prepare 12.5% sds page, in order loading.The electrophoresis that carries out to concentrated glue and separation gel with the voltage of 60V and 120V respectively.Electrophoresis is complete, coomassie brilliant blue staining 30min, then with destainer decolouring 1～8h, observe and log.

S3. the purifying of albumen: picking list colony inoculation is in the liquid LB of 5ml substratum, 37 ℃, 180rpm, overnight incubation, the rear fresh liquid LB that is all forwarded to 500mL cultivates and concentrates, 37 ℃, 180rpm, cultivates 4h, with IPTG (0.1～0.2 mM), under 18 ℃ of conditions, induce after 16h, collect thalline.Get 200 μ L thalline in centrifuge tube, 4 ℃ of preservations, carry out SDS-PAGE electrophoretic analysis.With the cracking buffer suspension cell of 5mL and be transferred in centrifuge tube, be placed in and make thalline remain cooling on ice, ultrasonic disruption cell.10,000 x g, 4 ℃ of centrifugal 20～30 min, collect supernatant liquor.Get the supernatant of 20 μ L in-20 ℃ of preservations, carry out SDS-PAGE analysis.To Ni-NTA resin(nickel--the nitrilotriacetic acid(NTA) resin extender that adds 1～2mL in 5mL cell pyrolysis liquid) mix, and low speed on 4 ℃ of shaking tables in conjunction with 60min.In connection with cell pyrolysis liquid and resin compound completely, pack in chromatography column, remove bottom block and collect effluent liquid part (flow-through fraction, F), get the effluent liquid of 20 μ L, in-20 ℃ of preservations, carry out SDS-PAGE analysis.With the washing buffer elution chromatography post twice of 4ml, collect the elutriant (wash fraction, W) of every part, respectively get 20 μ L and be stored in and in-20 ℃ of refrigerators, make SDS-PAGE and analyze.With the wash-out buffer of 0.5mL, wash post four times, with different collection tubes, collect successively respectively the elutriant (elution fraction, E) of every part, be labeled as respectively E1, E2, E3, E4, respectively gets 20 μ L and carries out SDS-PAGE analysis.According to the detected result of SDS-PAGE, concentrate and contain target protein wash-out part in a centrifuge tube, with pipettor, be transferred in dialysis tubing 4 ℃ of dialysed overnight.Collect the solution after dialysis, adding glycerine to make glycerine total content in protein solution is 20%, and carries out packing with the amount of 200 μ L/pipes, gets trace and carries out the detection of SDS-PAGE protein concentration, and remaining is put in-70 ℃ of Ultralow Temperature Freezers and saves backup.

S4. alcohol acyl-synthetase enzymatic characterization: switching 100 μ L seed liquor in fresh 200mL(containing 25 mg/L Kan; 34 mg/L Chl) in LB substratum; 37 ℃ of 180rpm cultivate 4～6h, survey a certain amount of IPTG(0.1～0.2mM of the rear use in OD value to 0.4～0.6) at 14～18 ℃ of induction 14～16h.5000rpm, 4 ℃ of centrifugal collection thalline of centrifugal 5min, with 5mLbuffer (10mM MOPS buffer pH 7.0 10% glycerine 1mM DTT) suspension cell, are placed in ultrasonic disruption cell on ice.12000rpm, 4 ℃ of centrifugal 20min, move to supernatant in new centrifuge tube.

S5. enzymatic reaction and GC-MS analyze: by 80 μ L 50 μ M pH 8.0Tris-HCl, zyme extract 50 μ L, 0.05 μ M benzoyl CoA 20 μ L solution, the ethanolic soln of 5.8 μ L 20 μ m, mercaptoethanol solution 2 μ L and ddH ₂o 842.2 μ L add in sample bottle and seal, 75 μ m polydimethyl oxygen alkane (PMDS) extracting fiber heads are inserted in vial, 28 ℃ of water-bath 1h, headspace solid-phase microextraction, after reaction finishes, extracting fiber head is put to gas chromatography-mass spectrum and is used in conjunction in instrument and analyzes, GC conditions is: chromatographic column is HP-1NNOWAX post (30m * 0.25mm); Carrier gas is high-purity helium, and splitting ratio 20:1 presses 50 Pa, flow 1 mL/min before post; Sample time 2min; Temperature programming: 45 ℃ of post starting temperatures, keep 2min, with the speed of 5 ℃/min, rise to 80 ℃ and keep 1min, then with the speed of 10 ℃/min, rise to 250 ℃ and keep 5 min.Mass spectrum condition is: 220 ℃ of the interface temperature of GC-MS, electron bombardment ionization source EI, 350V; 170 ℃ of ion source temperatures; Electron energy 70 eV; Quality of scanning scope 35～335aum, the mass spectrum collecting is analyzed with WILLEY/MAINLIB storehouse.Prokaryotic expression the results are shown in Figure 3.As can be seen from Figure 3: the pET-28a-Lo-AAT1 vitro enzyme catalytic reaction products that ethanol and benzoyl CoA be substrate of take is ethyl benzoate through Mass Spectrometric Identification; ethyl benzoate standard specimen chromatogram and mass spectrum are consistent with adopting; illustrate that enzyme that this genes encoding generates is a kind of enzyme that ethanol and benzoyl CoA be substrate Synthesis of ethyl benzoate catalyzed of take, this gene is ethanol benzoyl transferase gene.

Embodiment 4 loAAT1genetic transformation to tobacco:

S1. vector construction and Agrobacterium-mediated Transformation: will loAAT1the full length cDNA sequence of gene is used ecorI and bamhI enzyme is cut, and reclaims object fragment; Carrier pMOGMON uses ecorI and bamhI enzyme is cut, and purifying reclaims the fragment of corresponding size, connects, and transforms DH5 α, upgrading grain, and enzyme is cut evaluation, chooses required clone, order-checking, and be transformed in Agrobacterium LBA4404.

S2. Transformation of tobacco: by tobacco " W38 " blade (square of 0.5 cm * 0.5 cm) preculture 2～3 d in substratum, the OD obtaining with step S1 ₆₀₀0.5～0.8 Agrobacterium LBA4404 bacterium liquid, contaminate 5～10min, then cultivate altogether 3 d, tobacco is on the substratum that contains 20 mg/L Totomycin Hyg, 400 mg/L cephamycin C ef, petunia is on the substratum that contains 5 mg/L Totomycin Hyg, 400 mg/L cephamycin C ef, at illumination 2000～10000Lx, under 25 ℃ of conditions, select to cultivate.Select to cultivate after 2～3 weeks, the transformant of explant will produce resistant calli, material is proceeded in corresponding selective differentiation substratum and breaks up the cultivation of sprouting, until indefinite bud, grow to 1 cm when above, cut and insert to contain on the root media of selecting to press and carry out root culture, every bottle is inserted 2～3 seedlings, carries out root induction.Root is grown to the healthy and strong seedling of approximately 4～5 cm, hardening 5～6d, after hardening finishes, clear water is cleaned root substratum, transplants.

S3. the extraction of transgene tobacco genomic dna:

S31. get 0.2 g material, add liquid nitrogen grinding powdered, the material of milled is proceeded in the centrifuge tube of 2 ml, add 1 ml preheating 2 % CTAB extracting solutions (mercaptoethanol containing 0.1%), fully mix, be placed in 65 ℃ of water-bath 45 min, 6～8min mixes once.10000 rpm, centrifugal 5 min.

S32. be chilled to room temperature, get supernatant liquor, add isopyknic chloroform/primary isoamyl alcohol (24:1), mix gently to solution and become emulsification shape, 10000 rpm, centrifugal 5 min.

S33. get supernatant, add the Virahol of 2/3 volume precooling, place 30min for-20 ℃.Centrifugal 5 min of 10000 rpm, abandon supernatant liquor, by 70% washing with alcohol, precipitate 2～3 times.Add 200 μ l TE solution to dissolve.

S34. add 1/10 volume NaAC(3 mol/L) and the dehydrated alcohol of 2 times of volumes ,-20 ℃ place 2h more than.The centrifugal 5min of 12000 rpm, abandons supernatant liquor, 70% washing with alcohol 2～3 times for precipitation, and drying at room temperature precipitates.With 20～50 μ L1 * TE, dissolve-20 ℃ of preservations.

s4. transgene tobacco PCR detects: with the positive contrast of transformed bacteria liquid, unconverted DNA makes negative control, carries out pcr amplification system.

Upstream primer F2:CTT CTA CAC AGC CAT CGG TCC AGA; As shown in SEQ ID NO:16.

Downstream primer R2:GAT GTA GGA GGG CGT GGA TAT GTC; As shown in SEQ ID NO:17.

Reaction system (20 μ L): transfer-gen plant DNA 1 μ L (20ng ~ 50ng); 10 * buffer, 2 μ L; MgCl ₂(2.5mM) 2 μ L; Taq enzyme 0.2 μ L; DNTP (2.5mM) 2 μ L; Primer respectively adds 10 μ M; Add sterilized water to 25 μ L.

Reaction conditions: 94 ℃, 4 minutes; 94 ℃, 30 seconds; 54 ℃, 30 seconds; 72 ℃, 1 minute; 30 circulations; 72 ℃ are extended 10 minutes.Filter out PCR positive plant (Fig. 4).

S5. transgenic tobacco plant volatile matter SPME-GC/MS analyzes: adopt solid-phase microextraction-gaschromatographic mass spectrometry methods analyst.Tobacco seedling is taken out from matrix, clean, be placed in 2.5 L watertight chests, add 31.6 ng/ μ L(100 μ M SNP to be treated to 316 ng/ μ L) ethyl decylate 10 μ L as internal standard substance, silicone rubber pad sealing by teflon lined, insert 100 μ m polydimethylsiloxane (PMDS) extracting fiber heads, under 25 ℃ of temperature, head space samples 30 min.Adopt FINNIGAN TRACE MS gas chromatograph-mass spectrometer (U.S.) to analyze.Chromatographic condition is DB-5 quartz capillary column length 30 m, internal diameter 0.25 mm, and the thick 0.25 μ m of liquid film, carrier gas He, column head pressure 68.974 kPa, program shunt/is not shunted 250 ℃ of (LSS) injector temperatures.Temperature programming: 50 ℃, keep 2 min; Heat-up rate with 3 ℃/min rises to 250 ℃, keeps 30 min.In SPME analyzes, PSS injection port is set as Splitless injecting samples mode, and the not shunting time is 2 min, and bushing pipe adopts the Glass tubing of 1.5 mm internal diameters, and desorption time is 3 min; In DHS injection port splitting ratio, be 20:1, sample size is 2.0 μ L.GC/MS transmission line temperature is 250 ℃, mass scanning scope is 30～350 a μ m, sweep time 0.3 s, scanning interval 0.2 s, 170 ℃ of EI ion source temperatures, EI electron energy 70 eV, photomultiplier (PMT) voltage 230 V, WILEY, MAINLIB, REPLIB and 4 storehouses of NISTDEMO for mass spectrum of collecting are analyzed, and quantitative with the ratio of interior mark ethyl decylate peak area according to each component peaks area, determined the chemical composition of tobacco volatile matter.Result shows: in wild-type tobacco, main volatile matter is Leaf Acetate and leaf-alcohol, and content is respectively 0.241 μ g/gFW.h and 0.263 μ g/gFW.h; And have methyl benzoate, ethyl benzoate and 2 hydroxybenzoic acid methyl esters, their volatile quantities in transfer-gen plant, be respectively 0.020 μ g/gFW.h, 0.349 μ g/gFW.h and 0.044 μ g/gFW.h, wherein ethyl benzoate is main volatile component.This explanation alcohol acyl transferase gene loAAT1in tobacco, justice is expressed the composition that has changed tobacco leaf volatile component, and ethyl benzoate volatile quantity improves a lot.

SEQUENCE LISTING

<110> Agricultural University Of South China

<120> lily ester class floral base is because of LoAAT1 and application thereof

<130>

<160> 17

<170> PatentIn version 3.3

<210> 1

<211> 1380

<212> DNA

<213> LoAAT1 full length gene cDNA sequence

<400> 1

atggcatcat ccctcacttt ctctgtccaa agccgccagc ccgagctcat cgcaccggca 60

gccccgaccc cccacgagct caagcgcctc tccgacattg acgaccaaga gggtctccgg 120

ttccagatac cggtcatcca attctaccgc cacgaccctt tactaggcgg tgcaagagac 180

cctgtgatgg ttatccgaga ggcacttgct aaggctctgg tgttttacta ccccttggcc 240

ggccgcctca gggagggggc tgaccgcaag ctcgcggtgg agtgcactgg tgagggtgtt 300

gttttcatcg aggctgatgc caatgttcgg ctcgaacagt ttggtgatgc tctgcagccg 360

cctttcccat gcctggagga gttgctcttc gacgttgagg gctccagcgg gatactcggc 420

tgcccgctga tcctaattca ggtgactcgc ttgagttgcg gtggcttcat ctttgccctc 480

cgtctcaacc acaccatctc ggacgctgcc ggcctcgtac agttcatgac cgccgtcggc 540

gagctcgccc gtggcgcaat cgcaccaaca gtccaaccag tctgggcgcg ccacctcctc 600

gaggctcgct ccccgccctg ccccaccttc gcccatcgcg agtacgatgt catccctgat 660

acaaagaaca ccctcatccc cttggacgac atggtccacc gctcattctt tttcggtcgc 720

cgcgagatcg ctgccttgcg tcgccgtgtc ccccaccacc tccgcagctc ctccaccttt 780

gagatcctca ccgcctccct ctggaagtgt cgcacatcct ccatccaagt cgacccatac 840

gaagaggtcc gcatcatctg cattgtcaac tcacgcggga agttcaaccc accgctgccg 900

acagggtact atgggaatgc tttagcatta cccgtggccg tggcggaggc aggaaaggtg 960

gctaacaacc ctcttgggta cgcattggag ttggtgaaga aagcgaaggc agaggtgact 1020

gaggagtata tgaaatcggt tgctgacttg atggtaatca ggggacgacc tcacttcacg 1080

gcggtgagaa cttacttggt ttcggacttg aaaagggcgg ggttcaggga tgtggatttc 1140

ggatggggaa aggcagtata tggtggagcc gcgaagggag gggttggggt gattcccggg 1200

gtcataagct tctttgtacc attcaagaat aggaatggag aggatgggat tgtggtgcca 1260

gtttgcttgc caggtccagc aatggagaag tttttggtgg agattgaaag gctcacgaag 1320

gtgtccgaga tggaggaaga gcatggcacg aacgcgcagt ttattgcttc tgccctctag 1380

<210> 2

<211> 1472

<212> DNA

<213> LoAAT1 full length gene DNA sequence dna

<400> 2

atggcatcat ccctcacttt ctctgtccaa aggcgccagc ccgagctcat cgcaccggca 60

gccccgaccc cccacgagct caagcgcctc tccgacattg acgaccaaga gggtctccgg 120

ttccagatac cggtcatcca attctaccgc cacgaccctt tactaggcgg tgcaagagac 180

cctgtgatgg ttatccgaga ggcacttgct aaggctctgg tgttttacta ccccttggcc 240

ggccgcctca gggagggggc tgaccgcaag ctcgcggtgg agtgcactgg tgagggtgtt 300

gttttcatcg aggctgatgc caatgttcgg ctcgaacagt ttggtgatgc tctgcagccg 360

cctttcccat tactggagga gttgctcttc gacgttgagg gctccagcgg gatactcggc 420

tgcccgctga tcctaattca ggtacctacc agatttattt accattgtga acacactgga 480

tcttcatata ccatctacag tacgctaaaa actcaagcct tgttgttatg taggtgactc 540

gcttgagttg cggtggcttc atctttgccc tccgtctcaa ccacaccatc tcggacgctg 600

ccggcctcgt acagttcatg acagccgtcg gcgagctcgc ccgtggcgca atcgcaccaa 660

cagtccaacc agtctgggcg cgccacctcc tcgaggctcg ctccccgccc tgccccacct 720

tcgcccatcg cgagtacgaa gtcatccctg atacaaagaa caccctcatc cccttggacg 780

acatggtcca ccgctcattc tttttcggtc gccgcgagat cgctgccttg cgtcgccgtg 840

tcccccacca cctccgcagc tcctccacct ttgagatcct caccgcctcc ctctggaagt 900

gtcgcacatc ctccatccaa gtcgacccat acgaagaggt ccgcatcatc tgcattgtca 960

actcacgcgg gaagttcaac ccaccgctgc cgacagggta ctatgggaat gctttagcat 1020

tacccgtggc cgtggcggag gcaggaaagg tggctaacaa ccctcttggg tacgcattgg 1080

agttggtgaa gaaagcgaag gcagaggtga cggaggagta tatgaaatcg gttgctgact 1140

tgatggtaat caggggacga cctcacttca cggcggtgag aacttacttg gtttcggact 1200

tgaaaagggc ggggttcagg gatgtggatt tcggatgggg aaaggcagta tatggtggag 1260

ccgcgaaggg aggggttggg gtgattcccg gggtcataag cttctttgta ccattcaaga 1320

ataggaatgg agaggatggg attgtggtgc cagtttgctt gccaggtcca gcaatggaga 1380

agtttttggt ggagattgaa aggctcacga aggtgtccga gatggaggaa gagcatggca 1440

cgaacgcgca gtttattgct tctgccctct ag 1472

<210> 3

<211> 459

<212> PRT

The protein sequence of <213> LoAAT1 coding

<400> 3

Met Ala Ser Ser Leu Thr Phe Ser Val Gln Ser Arg Gln Pro Glu Leu

1 5 10 15

Ile Ala Pro Ala Ala Pro Thr Pro His Glu Leu Lys Arg Leu Ser Asp

20 25 30

Ile Asp Asp Gln Glu Gly Leu Arg Phe Gln Ile Pro Val Ile Gln Phe

35 40 45

Tyr Arg His Asp Pro Leu Leu Gly Gly Ala Arg Asp Pro Val Met Val

50 55 60

Ile Arg Glu Ala Leu Ala Lys Ala Leu Val Phe Tyr Tyr Pro Leu Ala

65 70 75 80

Gly Arg Leu Arg Glu Gly Ala Asp Arg Lys Leu Ala Val Glu Cys Thr

85 90 95

Gly Glu Gly Val Val Phe Ile Glu Ala Asp Ala Asn Val Arg Leu Glu

100 105 110

Gln Phe Gly Asp Ala Leu Gln Pro Pro Phe Pro Cys Leu Glu Glu Leu

115 120 125

Leu Phe Asp Val Glu Gly Ser Ser Gly Ile Leu Gly Cys Pro Leu Ile

130 135 140

Leu Ile Gln Val Thr Arg Leu Ser Cys Gly Gly Phe Ile Phe Ala Leu

145 150 155 160

Arg Leu Asn His Thr Ile Ser Asp Ala Ala Gly Leu Val Gln Phe Met

165 170 175

Thr Ala Val Gly Glu Leu Ala Arg Gly Ala Ile Ala Pro Thr Val Gln

180 185 190

Pro Val Trp Ala Arg His Leu Leu Glu Ala Arg Ser Pro Pro Cys Pro

195 200 205

Thr Phe Ala His Arg Glu Tyr Asp Val Ile Pro Asp Thr Lys Asn Thr

210 215 220

Leu Ile Pro Leu Asp Asp Met Val His Arg Ser Phe Phe Phe Gly Arg

225 230 235 240

Arg Glu Ile Ala Ala Leu Arg Arg Arg Val Pro His His Leu Arg Ser

245 250 255

Ser Ser Thr Phe Glu Ile Leu Thr Ala Ser Leu Trp Lys Cys Arg Thr

260 265 270

Ser Ser Ile Gln Val Asp Pro Tyr Glu Glu Val Arg Ile Ile Cys Ile

275 280 285

Val Asn Ser Arg Gly Lys Phe Asn Pro Pro Leu Pro Thr Gly Tyr Tyr

290 295 300

Gly Asn Ala Leu Ala Leu Pro Val Ala Val Ala Glu Ala Gly Lys Val

305 310 315 320

Ala Asn Asn Pro Leu Gly Tyr Ala Leu Glu Leu Val Lys Lys Ala Lys

325 330 335

Ala Glu Val Thr Glu Glu Tyr Met Lys Ser Val Ala Asp Leu Met Val

340 345 350

Ile Arg Gly Arg Pro His Phe Thr Ala Val Arg Thr Tyr Leu Val Ser

355 360 365

Asp Leu Lys Arg Ala Gly Phe Arg Asp Val Asp Phe Gly Trp Gly Lys

370 375 380

Ala Val Tyr Gly Gly Ala Ala Lys Gly Gly Val Gly Val Ile Pro Gly

385 390 395 400

Val Ile Ser Phe Phe Val Pro Phe Lys Asn Arg Asn Gly Glu Asp Gly

405 410 415

Ile Val Val Pro Val Cys Leu Pro Gly Pro Ala Met Glu Lys Phe Leu

420 425 430

Val Glu Ile Glu Arg Leu Thr Lys Val Ser Glu Met Glu Glu Glu His

435 440 445

Gly Thr Asn Ala Gln Phe Ile Ala Ser Ala Leu

450 455

<210> 4

<211> 31

<212> DNA

<213> upstream primer F1

<220>

<221> misc_feature

<222> (29)..(29)

<223> n is a, c, g, or t

<400> 4

tctccaaggc tctggtgttc taytayccnb t 31

<210> 5

<211> 32

<212> DNA

<213> downstream primer R1

<220>

<221> misc_feature

<222> (27)..(27)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (30)..(30)

<223> n is a, c, g, or t

<400> 5

tgcatgaacc tgatagcgaa gryraanccn cc 32

<210> 6

<211> 21

<212> DNA

<213> 3′-RACE 1st Primer

<400> 6

gagttgctct tcgacgttga g 21

<210> 7

<211> 24

<212> DNA

<213> 3′-RACE 2nd Primer

<400> 7

cgctgatcct aattcaggtg actc 24

<210> 8

<211> 21

<212> DNA

<213> 5′-RACE 1st Primer

<400> 8

cgagccgaac attggcatca g 21

<210> 9

<211> 20

<212> DNA

<213> 3′-RACE 2nd Primer

<400> 9

tagaacacca gagccttgga 20

<210> 10

<211> 23

<212> DNA

<213> Hctps1-P1

<400> 10

atggcatcat ccctcacttt ctc 23

<210> 11

<211> 22

<212> DNA

<213> Hctps1-P2

<400> 11

ctagagggca gaagcaataa ac 22

<210> 12

<211> 22

<212> DNA

<213> P1

<400> 12

attgtggtgc cagtttgctt gc 22

<210> 13

<211> 24

<212> DNA

<213> P2

<400> 13

cccttttacc cttcgttgaa cttc 24

<210> 14

<211> 21

<212> DNA

<213> ACT-P1

<400> 14

ttcgtgttgc accagaagag c 21

<210> 15

<211> 22

<212> DNA

<213> ACT-P2

<400> 15

tgaatggcga catacatggc ag 22

<210> 16

<211> 24

<212> DNA

<213> upstream primer F2

<400> 16

cttctacaca gccatcggtc caga 24

<210> 17

<211> 24

<212> DNA

<213> downstream primer R2

<400> 17

gatgtaggag ggcgtggata tgtc 24

Claims (1)

1. lily ester class floral base, because of a LoAAT1, is characterized in that, the full length cDNA sequence of described gene is as shown in SEQ ID NO:1; The full length DNA sequence of gene is as shown in SEQ ID NO:2.

2. lily ester class floral base, because of a protein for LoAAT1 coding, is characterized in that, the aminoacid sequence of described albumen is as shown in SEQ ID NO:3.

A pair of for the lily ester class floral base claimed in claim 1 that increases because of the primer of LoAAT1, it is characterized in that, primer sequence is as shown in SEQ ID NO:10～11.

4. a recombinant vectors, is characterized in that, in the multiple clone site of the carrier that sets out, inserts, and lily ester class floral base is because of the sequence of LoAAT1 described in claim 1.

5. a recombinant bacterium that comprises recombinant vectors described in claim 4.

6. a clone that comprises recombinant vectors described in claim 4.

Described in claim 1 lily ester class floral base because of the application of LoAAT1, it is characterized in that, lily ester class floral base, because LoAAT1 is connected in plant conversion carrier, is then imported in Cell of lily, obtain and express described lily ester class floral base because of the transgenosis fragrance of a flower kind of LoAAT1.

Described in claim 2 lily ester class floral base because of the application in preparing essence of the protein of LoAAT1 coding.