CN104530204B - A kind of rape cecropin B gene nPRP1 and its application - Google Patents

A kind of rape cecropin B gene nPRP1 and its application Download PDF

Info

Publication number
CN104530204B
CN104530204B CN201410801776.3A CN201410801776A CN104530204B CN 104530204 B CN104530204 B CN 104530204B CN 201410801776 A CN201410801776 A CN 201410801776A CN 104530204 B CN104530204 B CN 104530204B
Authority
CN
China
Prior art keywords
gene
bnprp1
eddie
nprp1
cecropin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201410801776.3A
Other languages
Chinese (zh)
Other versions
CN104530204A (en
Inventor
刘胜毅
董彩华
柯涛
曹慧慧
黄军艳
刘越英
童超波
程晓辉
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Oil Crops Research Institute of Chinese Academy of Agriculture Sciences
Original Assignee
Oil Crops Research Institute of Chinese Academy of Agriculture Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oil Crops Research Institute of Chinese Academy of Agriculture Sciences filed Critical Oil Crops Research Institute of Chinese Academy of Agriculture Sciences
Priority to CN201410801776.3A priority Critical patent/CN104530204B/en
Publication of CN104530204A publication Critical patent/CN104530204A/en
Application granted granted Critical
Publication of CN104530204B publication Critical patent/CN104530204B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01NPRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/10Animals; Substances produced thereby or obtained therefrom
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Environmental Sciences (AREA)
  • Dentistry (AREA)
  • Agronomy & Crop Science (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
  • Pest Control & Pesticides (AREA)

Abstract

The invention discloses a kind of rape cecropin B gene nPRP1 and its application.The invention provides a kind of rape cecropin B gene nPRP1, its sequence is shown in SEQ ID NO.2.The artificial synthesized of the gene is completed by overlap PCR methods, the antibacterial peptide gene of synthesis is cloned on pET30a/His EDDIE GFP expression vectors and is transformed into Escherichia coli and carries out vivoexpression, obtains the antibacterial peptide prod for not increasing any additional amino acid.Bacteriostatic activity testing result shows that cecropin B gene nPRP1 has stronger bacteriostatic activity to bacterium and fungi.Excised leaf, which is smeared, connects bacterium experiment confirmationBnPRP1Plant can be significantly increased to metatrophy type fungi:Sclerotinite, botrytis cinerea, Rhizoctonia solani Kuhn, the resistance of grey plaque.BnPRP1 can be used in the preventing and treating of sclerotiniose, gray mold, damping-off and graywall as biological prevention and control agent, and the seed selection of rape disease-resistant variety can also be used for as resistance marker.

Description

A kind of rape cecropin B gene nPRP1 and its application
Technical field
The present invention relates to genetic engineering and biological technical field.More particularly to a kind of rape cecropin B gene nPRP1 and its answer With.
Background technology
Pathogen can cause the serious plant disease for including the mankind, livestock, crop and other biological, cause serious economic damage Lose.Plant pathogenic fungi is the important pathogen of plant, can cause more than 80% plant disease (Zhang Fuli, Wang Zhanbin, Wang Zhi Effect forestry science and technology .2006 of the English chitinases in plant resistance to fungal disease, 31 (3):24-27), world food is caused to make (Knight S.C., Anthony V.M., Brady A.M., the et al.Rationale and of the thing underproduction about 20% perspectives o n the developmentof fungicides.Annu Rev Phytopathol,1997,35: 349-372).Caused by many important plant diseases are all fungi, such as the late blight of potato, rice blast, wheat powdery mildew, corn Northern and southern leaf blight bacterium, grey speck of soybean, sclerotinia sclerotiorum etc., very huge economic loss is all caused every year.On the other hand, fungi During plant is infected, metabolite --- the mycotoxin (mycotoxin) that discharges, to crops and the mankind Health also result in great harm, such as aflatoxin (aflatoxin).
Sclerotinite (Sclerotinia sclerotiorum) belongs to Ascomycotina, discomycete, Helotiales, sclerotinite Section, Sclerotinia.It is the global important phytopathogen of a kind of damage to crops and vegetables.Sclerotinite can widely invade Contaminate many unifacial leaves and dicotyledon.Sclerotiniose caused by sclerotinite is a kind of metatrophy type fungi similar to grey mold, This destructive pathogeny infects more than 400 kinds plants, widely distributed.The preventing and treating to sclerotiniose relies primarily on chemical pesticide at present, But not only cost is high, pollution environment for chemical prevention, and preventive effect is also undesirable;Meanwhile the security of food is also by serious Influence.Rape is one of oil crops important in the world, and sclerotiniose causes the root of rape, rotting for stem and silique, be result in Huge production loss.Although the agricultural production of sclerotiniose serious threat, plant to the molecular mechanism of the host resistance of sclerotinite, We still know little about it.Untill up till now it has not been found that completely immune or high anti-rape cultivation kind (Liu, S., Wang,H.,Zha ng,J.,Fitt,B.D.,Xu,Z.,Evans,N.,Liu,Y.,Yang,W.,and Guo,X.2005.In vitro mu tation and selection of doubled-haploid Brassica napus lines with improved resistance to S clerotinia sclerotiorum.Plant Cell Rep.24:133-144), Therefore, resistance mechanism of the plant to this pathogeny is probed into, it is found that new resistant gene has far reaching significance.
Botrytis cinerea (Botrytis cinerea), also known as the pathogen of Botrytis cinerea, it is a kind of wide host's property, 200 can be caused The downright bad auxotype disease fungus of a variety of known plants (such as water fruits and vegetables and flowers) gray molds.It is widely distributed in atmosphere, Field crops can not only be infected, can equally be brought about great losses to the rear stage of adopting of plant.Botrytis cinerea can be in cryogenic conditions Under (0 DEG C) growth, propagated by producing substantial amounts of grey conidium, compared with other postharvest pathogenic fungis, had latent Infect the advantage caused a disease with low temperature.Meanwhile it also has the characteristics of breeding is fast, hereditary variation is big and grade of fit is high.Daily life In the fruits and vegetables that run into put a period of time and can become mildewed, majority may receive infecting for botrytis cinerea.Gray mold initially simply flows Row in Europe and America, since the 1980s just spread Chinese.Due to pushing away for greenhouse and greenhouse gardening technology Broad-spectrum and, crop grey mold disease is serious, it has also become vegetables, flowers and forestry seedling cultivation base production key constraints.Cut Only 2013, it is not yet found that any plant produces resistance to botrytis cinerea, (Chen Qi, Dinke was hard, Tan Genjia, Zhang Xiao in the world It is big, ash arrhizus bacteria bacterial strain variation of drug resistance and its hereditary Journal of Sex Research.2003 East China plant pathology science seminars and Jiangsu Province plant The tenth member representative assembly collection of thesis of thing pathology meeting).Consequently found that the gene of new anti-botrytis cinerea has far-reaching significance.
Rhizoctonia solani Kuhn (Pyricularia grisea Sacc) is one of basidiomycetes Invisible element category, pathogenic complexity, Metamorphosis is big, and host range is wide, is a kind of fungi being widespread in nature, it is distributed widely in global farming In non-farming, and it is easy to isolated from infected plant and soil.The host range of rhizoctonia is very extensive, there is many Plant disease is that thus category fungi causes, can be with hazard rice, potato, tobacco, wheat, peanut, cotton, rape, sesame, big Beans, Chinese cabbage, pakchoi, various wild cabbages, cauliflower, spinach, celery, muskmelon, bottle gourd, Solanaceae and various citruses and a large amount of Vegetables.This kind of fungi mainly causes the seedling stage of plant overworked disease and damping-off, also causes the banded sclerotial blight of cereal crop, thus draws Playing the research interest of many phytopathologists and classification of fungi scholar, (yellow Jiang Hua, Yang Mei, Zhou Erxun, Qi Peikun, rhizoctonia are ground Study carefully progress, Zhongkai University of Agriculture And Technology 2002,15 (1):61-67,;Lilja A;HE1TALA A M;KARJALAINEN R Identification of a uninucleate Rhizoctonia sp.By pathogenicity,hyphal anastomosis and RAPD analysis 1996)。
Currently used disease control measure, chemical pesticide is relied primarily on, but not only cost is high, pollution ring for chemical prevention Border, and preventive effect is also undesirable;Meanwhile the security of food can be also severely impacted.As the progress of society, people are more next More profoundly recognize and largely use harm of the chemical pesticide to ecological environment and human health for a long time.Biological control can be effective Ground overcomes these drawbacks, thus biological pesticide is increasingly valued by people.
Antibacterial peptide (antimicrobial peptides, AMPs) is a kind of natural small molecule egg with antibacterial activity In vain, living nature is widely present in, is the important component of body nospecific immunity, is respectively provided with antibacterial activity in vitro in vivo (Gordo n YJ,Romanowski EG,A Review of Antimicrobial Peptides and Their Therapeutic Potential as Anti-Infective Drugs.Curr Eye Res.2005,30(7):505– 515).The extensive biological activity of antibacterial peptide, there is very strong suppression to make to bacterial fungus, protozoan, virus and tumour etc. With, have the advantages that efficiently, environmental protection, do not make pathogen produce drug resistance make it in biological control and medically have it is good should With prospect (Gordon YJ, Romanowski E G, A Review of Antimicrobial Peptides and Their Therapeutic Potential as Anti-Infective Dr ugs.Curr Eye Res.2005,30(7):505– 515).Have become genetic engineering of plant for disease resistance, breeding feed additive, food preservative, emerging medicine and other fields in recent years Study hotspot, in disease prevention and cure field be antibiotic ideal substitute (Boman HG, Peptide antibiotics And their role in innateimmunity.Annu Rev Immuno1.1995,13:6l-92).In agricultural production Cheng Zhong, transmission of the farm antibiotics by food chain can be avoided to threat caused by human body by carrying out plant protection work with antibacterial peptide.
According to amino acid sequence and secondary structure, it has been found that Antimicrobial Peptides From Plants can be divided into plant alexin (plant Defensins), lipid transfer proteins (1ipidtransfer proteins, LTPs), thionin (thionins), ecdysone (snakins), hevein class (hev ein-like), the plain class that knots (knottin-like peptides), balsamine element (IbAMP), and newly discovered shepherd's purse plain (she pherdins), cyclic peptide (cyclotides) etc. (Hancock REW, Chapple DS, Peptide Antibiotics.Antimicrob Agent Chemother, l999,43 (6):l3l7- l323).Antibacterial peptide is substantially all with some general character, such as:Small-molecular-weight (<10KDa), cationic surface, positive charge and two Parent's property, these characteristics enable antibacterial peptide and cell membrane to bind and be inserted into cell interior, and most of antibacterial peptide is logical Cross destruction cell membrane so that target cell death and reach sterilization purpose.And other antibacterial peptides can be by cell membrane Ion channel enter cell interior destroy cell without destroy cell membrane (Vogel PMHaHJ:Structure– function relationships of antimicrobial peptides.Biochem Cell Biol 1998,76: 235-246.).The sterilization mode of proline rich class antibacterial peptide (PRPs) is exactly to pass through not destroy cell membrane, but utilizes ion (the L.Otvos J that the mode of passage is carried out:The short proline-rich antibacterial peptide family.Cellular and Molecular Life Sciences 2002,59:1138-1150.).It is most types of Antimicrobial peptide of plant origins does not all have toxicity (Murad AM.Pelegrini PB.Neto SM.Novel to animal and plant cell Findings of Defensins and their Utilization in Construction of Transgenic Plants.Transgenic Plant Journ al 2001(1):39-48).Compared with animal derived antimicrobial peptide, plant-source antibacterial Peptide is easier to express and regulate and control in crop, it is not easy to by intracellular proteasome degradation.Compared with other bactericide, plant comes Influence of the antibacterial peptide in source to environment is smaller, more friendly, is more developed into the potentiality (Hancock of antimycotic biological agent REW, Chapple DS, Peptide Antibi otics.Antimicrob Agent Chemother, l999,43 (6): l3l7-l323).It will such as be fermented in Rs-AFPs Antimicrobial Peptides From Plants channel genes microorganisms, it is easier to overcome to host's Toxic action and largely produced.
Antibacterial peptide is a kind of small-molecular peptides for having suppression or killing action to microorganisms such as bacterium, fungies, it can by bacterium, Fungi or physics, chemical stimulation is induced, or even some antibacterial peptides can form the expression of composition in plant.It is not Various bacteria is only resistant to, and can press down antifungal, viral etc., available for conversion crops, culture disease-resistant variety, thus is being planted Had broad application prospects in thing breeding gene engineering field.Studied first in model plant tobacco and potato resistance to bacterial wilt In succeed, then in the crop such as fire blight of pear, chrysanthemum, capsicum, eggplant of rice leaf spot bacteria and slice germ apple Bacterium, achieve certain effect in nosomycosis research.Radish antibacterial peptide gene (AFP) transgenosis can be obtained into potato P. infestans resistant etc. (Ren Yuxia, Chen Lingna, Chen Jifeng, Chen Zhenghua, potato turn radish antibacterial peptide gene plant acquisition and The Preliminary Identification of anti-late blight, China's Vegetable 2012 (6):68-73).
Antimicrobial peptide of plant origins has broad-spectrum antifungal or bacterial activity, and the antibacterial peptide found in a kind of plant can be effective Be applied in other various plants, as the antibacterial peptide in source in radish can go to wild poppy, Ma Ling by transgene method Respectively reached in potato and wheat anti-late blight of potato and wheat sickle-like bacteria effect (Wei Yujie, Zhang Meixiu, Chang Ying, Luo Shuzhen, Chen Lingna, wild poppy pollen mediation turn radish antibacterial peptide gene technique study, agriculture of gansu science and technology 2009 (11):6-9;Ren Yu Rosy clouds, Chen Lingna, Chen Jifeng, Chen Zhenghua, potato turn the acquisition of radish antibacterial peptide gene plant and the Preliminary Identification of anti-late blight, China's Vegetable 2012 (6):68-73;Zhao Li, Miaoping Zhou, Zengyan, ZhangLi, juan Ren, Lipu Du, Boqiao Zhang, Huijun Xu, Zhiyong Xin, Expression of a radish defensin in tra nsgenic wheat confers increased resistance to Fusarium graminearum and Rhizoctonia cerea lis Funct Integr Genomics 2011,11:63–70).Antibacterial peptide is as emerging disease-resistant Genetic resources, the resistance important in inhibiting to crops such as improvement rice, soybean, cotton, rapes to fungal disease.
Antibacterial peptide is because of its unique Antibacterial Mechanism, the antibiotic property of wide spectrum and the features such as be not likely to produce drug resistance, in each row There is good application prospect in each industry, therefore be also subjected to more next more concern, turn into the study hotspot of Disciplinary Frontiers (Hancock REW, Chapple DS, Peptide Antibiotics.Antimicrob Agent Chemother, l999, 43(6):l3l7-l323).But the antibacterial peptide of plant origin is also difficult to really be applied in agricultural production practice at present.Mainly It is because the functional plant origin antibacterial peptide quantity identified at present is seldom, so as to greatly limit plants antimicrobial The application of peptide.Antibacterial peptide gene in antibacterial peptide database by checking reaches more than 1600 at present, and Antimicrobial Peptides From Plants only have Less than 300 (ht tp://ercbinfo1.ucd.ie/APPDb/).Certified plant origin antibacterial peptide gene quantity is few Main cause is as follows:1st, antibacterial peptide gene is relatively small, easily degraded, and content is low, it is difficult to detection and identification;2nd, antibacterial peptide Molecular weight is small, isolates and purifies difficulty, and extraction step is loaded down with trivial details, yield is low;3rd, vivoexpression purification difficult, cause to be difficult to carry out in vitro Bacteriostatic activity detection carrys out authentication function;4th, efficient prediction screening technique is lacked;5th, antibacterial peptide chemical synthesis cost is high, and price is held high It is expensive.How tool functional new plant antibacterial peptide is efficiently predicted, realizing its horizontal expression and reducing cost turns into current antibacterial Peptide studies the bottleneck with application.
By present invention applicant Inst. of Oil Crops, Chinese Academy of Agriculture be responsible for, vegetables institute of the Chinese Academy of Agricultural Sciences, Shenzhen Hua Da gene studies institute, Hua Zhong Agriculture University, Hunan University, Agricultural University Of Southwest, Jiangsu academy of agricultural sciences, Sichuan academy of agricultural sciences, Qinghai University, and absorb English, Australia, U.S., Fa Deng states related research institutes scientific research personnel cooperate to complete the full-length genome of wild cabbage and rape Sequencing and analysis, wild cabbage and rapeseed gene group partial results paper have delivered (Shengyi Liu, Yumei Liu, Xinhua Yang,C haobo Tong,David Edwards,Isobel A.P.Parkin,Meixia Zhao,Jianxin Ma, Jingyin Yu,Sh unmou Huang,Xiyin Wang,Junyi Wang,Kun Lu,Zhiyuan Fang,Ian Bancroft,Tae-Jin Ya ng,Qiong Hu,XinfaWang,Zhen Yue,Haojie Li,Linfeng Yang, Jian Wu,Qing Zhou,Wanxin Wang,Graham J.King,J.Chris Pires,Changxin Lu, ZhangyanWu,Perumal Sampa th,ZhuoWang,Hui Guo,Shengkai Pan,Limei Yang,Jiumeng Min,Dong Zhang,Dianchua n Jin,Wanshun Li,Harry Belcram,Jinxing Tu,Mei Guan, Cunkou Qi18,Dezhi Du1,Jiana Li,Liangcai Jiang,Jacqueline Batley,Andrew G.Sharpe,Beom-Seok Park,Pradeep Ruper ao,Feng Cheng,Nomar Espinosa Waminal Yin Huang,Caihua Dong,LiWang,Jingping L i,Zhiyong Hu,Mu Zhuang,Yi Huang, Junyan Huang,Jiaqin Shi,Desheng Mei,Jing Li u,Tae-Ho Lee,Jinpeng Wang,Huizhe Jin,Zaiyun Li,Xun Li,Jiefu Zhang,Lu Xiao,Yo ngming Zhou,Zhongsong Liu,Xuequn Liu,Rui Qin,Xu Tang,Wenbin Liu,YupengWang,Yangyong Zhang,Jonghoon Lee,Hyun Hee Kim,France Denoeud,Xun Xu,Xinming Lia ng,Wei Hua,Xiaowu Wang,Jun Wang, Boulos Chalhoub&Andrew H.Paterson.The Brassica oleracea genome reveals the asymmetrical evolution of polyploid genomes.2014.Nature Communication.5: 3930.;Chalhoub B,Denoeud F,Liu S,Parkin IA,Tang H5,Wa ng X,Chiquet J, etc.Plant genetics.Early allopolyploid evolution in the post-Neolithic Bra ssica napus oilseed genome.Science.2014,22;345(6199):950-3.).Chinese cabbage, wild cabbage and sweet Blue type rape genome sequencing information has built up the database http for being available for applicant to inquire about://www.ocri- genomicls.org/bolbas e(Cheng F,Liu S,Wu J,Fang L,Sun S,Liu B,Li P,Hua W,Wang X:BRAD.the ge netics and genomics database for brassica plants.BMC Plant Biol,2011,11:136;Jingyin Yu,Meixia Zhao,Xiaowu Wang,Chaobo Tong,Shunmou Huang,Sadia Tehrim,Yumei Li u,Wei Hua and Shengyi Liu.Bolbase:a comprehensive genomics database for Brassica ole racea.BMC Genomics,2013,14:664).By using life Thing bioinformatics analysis means, using above-mentioned resource, the prediction and analysis of gene can be carried out, obtains large batch of and known antibacterial peptide There is the pre-selection gene of similar sequence architectural feature, therefrom screen gene interested, be a quick shortcut for excavating gene.And Antibacterial peptide mrna length itself is small, can utilize the artificial synthesized technologies of PCR, inexpensive Fast back-projection algorithm, it is not necessary to which cDNA sequence is done Template carries out the work such as cloning, and can greatly speed up the speed for obtaining antibacterial peptide and reduce research difficulty.
Applicant utilizes cabbage type rape tissue transcript profile sequencing data, develops a potential novel antimicrobial peptide of forecast analysis The method of gene, obtain antibacterial peptide new gene BnPRP1.The gene is to belong to proline rich class antibacterial peptide (PRPs), this kind of anti- Proline content is more than 30% in bacterium peptide amino acid sequence, existing antibacterial activity also have antifungal activity (Cabras T, Long hi R,Secundo F,Nocca G,Conti S,Polonelli L,Fanali C,Inzitari R, Petruzzelli R,Mess ana I et al:Structural and functional characterization of the porcine proline-rich antifungal peptide SP-B isolated from salivary gland granules.J Pept Sci 2008,14(3):251-260.).It is with reference to gene engineering method and new with certainly using one Shearing function antibacterial peptide vivoexpression carrier pET30a/His-EDDIE-GFP (Tao Ke, Su Liang, Jin Huang, Han Mao,Jibao Chen,Caihua Dong,Junyan Huang,Shengyi Liu,Jianxiong Kang,Dongqi Liu,Xiangdong Ma,A novel PCR-based method for high throughput prokaryotic expression of antimicrobial peptide genes.BMC Biotechnol 2012,12:10.), this research Amalgamation and expression, renaturation, self cleavage and purifying of the BnPRP1 in Escherichia coli are realized, is obtained with bioactivity BnPRP1 protein products.With cylinder-plate method (influence factor of Jiang Hui haze cylinder-plate methods measure titer of antibodies and control method China Veterinary drug magazine .2011, (08) 23-36), using Escherichia coli, Sarcina lutea as Gram-negative bacteria and gram-positive bacteria Reference culture, indicator bacteria using saccharomycete as fungi carries out bacteriostatic activity detection to the BnPRP1 albumen of purifying, finds BnPRP1 genes can effectively suppress bacterium (Escherichia coli and Sarcina lutea) and fungi (yeast, sclerotinite, botrytis cinerea, line Rot bacterium and grey plaque) growth.This research is to utilize biological information means and technique for gene engineering Large scale identification new plant Carry out derived antimicrobial peptide to lay a good foundation, there is provided a kind of new approach.In addition BnPRP1 can be sprayed in plant table as biological reagent The resistance of plant against fungal disease is improved in face, at the same time it can also be marked as a recruit for aiding in breeding for disease resistance, may be used also To be used for plant genetic engineering as a new gene source, to cultivate disease-resistant transgenic plant.
The content of the invention
The purpose of the present invention is to be the provision of a rape antibacterial peptide having to fungi and bacterium bacteriostatic activity BnPRP1, its sequence are shown in SEQ ID NO.2.The antibacterial peptide length is 35 amino acid, and wherein proline is 13, and this is anti- Bacterium peptide can strengthen plant to metatrophy type fungi Sclerotinia sclerotiorum, botrytis cinerea, grey plaque and the resistance of Rhizoctonia solani Kuhn.
It is another object of the present invention to provide nucleotide sequence, preferred sequence corresponding to rape cecropin B gene nPRP1 For the nucleotide sequence shown in S EQ ID NO.1 and SEQ ID NO.3.
It is also an object of the present invention to provide the synthetic method of rape cecropin B gene nPRP1 genes, method are simple. Using DNAWorks Software tools, primer sequence is designed by codon optimization, BnPR is synthesized using Overlap-PCR technologies P1 gene orders.
Another object of the present invention is to be the provision of rape cecropin B gene nPRP1 preparation method, using CSFV Protein mutant EDDIE is fusion protein;After inclusion body protein purifying, renaturation, EDDIE is correctly folded again, recovers it certainly Shear ability, at specific site Cys168 and 169 C-terminal merge antibacterial peptide shear off, so as to obtain do not increase it is any The antibacterial peptide prod of additional amino acid.
Final object of the present invention is the provision of applications of the rape cecropin B gene nPRP1 in antibacterials are prepared, The antibacterial peptide can strengthen plant to metatrophy type fungi Sclerotinia sclerotiorum, botrytis cinerea, grey plaque and the resistance of Rhizoctonia solani Kuhn, It can also suppress to be applied to biological control and breeding for disease resistance simultaneously.
In order to complete above-mentioned purpose, the present invention adopts the following technical scheme that:
In order to obtain the present invention, related gene and existing antibacterial peptide of the applicant to rapeseed gene group moderate resistance sclerotiniose Database has carried out deeply comprehensive analyses and comparison and prediction, is as a result found that a proline content is new anti-more than 30% Bacterium peptide gene, by having carried out activity analysis after the external synthesis of the gene and induced expression, protein purification, finding the gene Not only with antibacterial activity also with antifungal activity.The present invention develops the BnPRP1 of an enhancing plant against fungal resistance Gene, the antibacterial peptide of BnPR P1 gene expressions not only there is antibacterial activity to also have antifungal activity in bacteriostatic activity experiment (including yeast, sclerotinite, botrytis cinerea, grey plaque and Rhizoctonia solani Kuhn), it imply that the gene in the anti-sclerotiniose breeding of rape With suitable application prospect.
Rape antibacterial peptide gene BnPRP1 acquisition:
Rape leaf has been carried out in applicant laboratory at present, the express spectra sequencing of silique, obtains a large amount of ESTs data letters Breath.Simultaneously by Chinese cabbage, wild cabbage and rape and genome sequencing project, their Genomic sequence information storehouse is constructed (http://www.ocri-genomicls.org/bolbase).Using these sequence informations and special antibacterial peptide database, Such as ANTIMIC (Brahmachary M, Krishnan SPT, Koh JLY, et al.ANTIMIC:a database of antimicrobial sequences.Nucleic Acids Research,2004,32:D586-D589, same as below), APD(Wang Z,Wang GS.APD:the Antimicrobial Peptide Database.Nucleic Acids Research,2004,32:D590-D592, same as below) APPDB (http://ercbinfo1.ucd.ie/APPDb/, below It is identical), PhytAMP (H ammami R, Hamida JB, Vergoten G, et al.Phytamp:a database dedicated to plant antimic robial peptides.Nucleic Acids Res.2009,37:D963- It is D968, same as below) etc. carry out BLAST comparison (nucleotides similarities>90% i.e. Identity>90%), obtain large batch of There is the pre-selection gene of similar structures feature with known antibacterial peptide sequence.Then to the protein sequence (Vector of these pre-selection genes ) and secondary structure structure (nnpredict NTI10:ht tp://www.cmpharm.ucsf.edu/nomi/nnpredict Predictionprotein, same as below) be predicted and analyze, so as to establish protein three-dimensional structure figure, utilize two level knot Storehouse is built in the classification that structure and function carry out protein families to the antibacterial peptide filtered out, so as to finally obtain potential novel antimicrobial peptide Gene.Numbering is EV168192.1, is named as BnPRP1.Gene B nPRP1 nucleotides sequences are classified as shown in SEQ ID NO.3, are resisted Bacterium peptide BnPRP1 amino acid sequence is shown in SEQ ID NO.2.A kind of preparation method of external synthesis rape BnPRP1 genes, Step is as follows:
The codon optimization of rape BnPRP1 genes and external synthesis
According to the DNA sequence dna of BnPRP1 genes, primer sequence is designed, synthetic primer 6 covers drawing for BnPRP1 total lengths altogether Thing, respectively BnPEV168192_1, BnPEV168192_2, BnPEV168192_3, BnPEV168192_4, ba ckboneF and backboneR.Primer sequence is as shown in table 1,
The overlap PCR primer sequences of table 1
BnPRP1 full length genes are obtained using Overlap-PCR technologies.PCR reaction systems are as follows:Total reaction system is 50 μ L, are included:10 × Taq buffer (contain MgCl2) 10 μ l, 1.5mmol/L dNTP (10mmol/L) 4 μ l, primer b AckboneF1 and backboneR respectively adds 1 μ l (concentration 10mmol/L), primer BnPEV168192_1, BnPE V168192_ 2, BnPEV168192_3 and BnPEV168192_4 respectively adds 1 μ l (concentration 2mmol/L), Taq (5U/ μ l) 1 μ l, ddH2O 33 μl.Reaction condition be 94 DEG C 5 minutes, 94 DEG C 1 minute, 58 DEG C 1 minute, 72 DEG C 30 seconds 2 minutes, 25 circulations, extend after 72 DEG C 10 minutes, amplification size was 108bp.
The identified sequencing of PCR primer, sequencing are correctly the cecropin B gene nPRP1 genes after optimizing, and its sequence is SEQ Shown in ID NO.1.
Cecropin B gene nPRP1 preparation method, comprises the following steps:
1) fusion expression vector EDDIE-BnPRP1 structure
Using inverse PCR technique, BnPRP1 genes are connected on expression vector pET30a/His-EDDIE-GFP.Specifically To utilize 30abackbone-F:TGAGATCCGGCTGCTAACAAAGCCC and 30abackbone-R:GCAGCT GGTCACCCACAGCG primers, by Inverse PCR amplification, by pET30a/His-EDDIE-GFP vector linearizations.It will be recovered to PET30a/His-EDDIE-GFP linearized vectors fragment with it is complete by the obtained BnP RP1 of Overlap-PCR amplification recovery Length dna fragment, while Escherichia coli XL10-Gold bacterial strains are converted, by pinpointing homologous recombination in vivo, BnPRP1 genes are connected Onto expression vector pET30a/His-EDDIE-GFP, target gene fusion expression vector EDDIE-BnPR P1 are obtained.
2) the external evoked expression of cecropin B gene nPRP1 is with isolating and purifying
Correct fusion expression vector EDDIE-BnPRP1 plasmids will be sequenced, BL21 (DE3) competence is transformed into heat shock method In cell, EDDIE-BnPRP1 amalgamation and expression engineering bacteria BL21 (DE3)/pETNB is obtained.Using usual manner in LB Liquid Cultures Culture and inducible protein expression in base, the bacterial cell disruption centrifugation of acquisition, supernatant after purification, produce destination protein antibacterial peptide BnPRP1, its sequence are shown in SEQ ID NO.2.
Applications of the rape cecropin B gene nPRP1 in antibacterials are prepared, including the antibacterial peptide is directly prepared into antimicrobial Thing, all there is stronger bacteriostatic activity to bacterium and fungi;The antibacterial of plant can be strengthened on plant leaf blade surface by being sprayed Property, plant is particularly improved to the resistance to the fungal disease such as sclerotinite, botrytis cinerea, vertical withered screw mandrel bacterium, grey plaque, by BnPRP1 Gene is overexpressed using the means of molecular biology in rape or other plant, and preparing can the plant of the antimycotic and transgenosis of bacterium Thing.
The present invention compared with prior art, has advantages below and effect:
1. the present invention using Chinese cabbage, wild cabbage and rape and the sequence information of genome sequencing and transcript profile sequencing data with Special antibacterial peptide database is compared and predicted classification analysis, successfully obtains a new proline rich class antibacterial peptide PRPs-BnPRP1.To be established using bioinformatics means and technique for gene engineering Large scale identification new plant derived antimicrobial peptide A kind of basis, there is provided new approach.
2. utilizing Overlap-PCR technologies artificial synthesized gene in vitro, the technology for obtaining BnPRP1 is greatly reduced Difficulty and cost.
3. to solve the problems of antibacterial peptide heterogenous expression, present invention employs a kind of new amalgamation and expression antibacterial peptide Method, use CSFV protein mutant EDDIE as fusion protein, with inclusion bodies in e. coli bl21 efficient table Up to antibacterial peptide, to reduce toxic action of the antibacterial peptide to host.After inclusion body protein purifying, renaturation, EDDIE correctly rolls over again It is folded, recover its self cleavage ability, the antibacterial peptide that C-terminal merges is shear off at specific site Cys168 and 169, so as to obtain The antibacterial peptide prod of any additional amino acid is not increased.This method need not add any chemical substance and enzyme to remove fusion mark Label, non-toxic to host, purge process is simple, and antibacterial activity of the detection to pathogen, highest goal can be used directly to after shearing Yield can reach 12g/L.
4. cylinder-plate method and blade surface, which spray inoculation test result, shows that the cecropin B gene nPRP1 of Prokaryotic expression, purification can Effectively to suppress the growth of bacterium and sclerotinite, four kinds of botrytis cinerea and Rhizoctonia solani Kuhn, grey plaque disease funguses, can effectively improve Resistance of the plant to them.
5. because BnPRP1 gene sources are in rape, it is also used as the choosing that resistance marker is used for rape disease-resistant variety Educate, or be used for transgenic breeding as the candidate gene of genetic engineering.
Brief description of the drawings
Fig. 1 is expression vector pET30a/His-EDDIE-GFP ideographs.
Fig. 2 is cecropin B gene nPRP1 circular dichroism spectra structure chart.
A in Fig. 2:To the influence of antibacterial peptide BnPRP1 structures under the conditions of different solvents, the direction shown in arrow represents difference The CD spectrums that BnPRP1 antibacterial peptides are presented under solvent condition;
B in Fig. 2:Influences of the various concentrations TFE to antibacterial peptide BnPRP1 structures, the direction shown in arrow represent various concentrations TFE under the conditions of BnPRP1 antibacterial peptides presented CD spectrum.
Fig. 3 is EDDIE-BnPRP1 vector constructions agarose gel electrophoresis detection figure.
A in Fig. 3:The Ago-Gel detection of overlap PCR synthesis BnPRP1 genes;M:100bp DNA Marker; 1-2:Overlap PCR synthesize BnPRP1 genes;
B in Fig. 3:Expression vector EDDIE-BnPRP1 electrophoresis detections;M:1kb DNA Marker;1:Recombinant vector pET30a-EDDIE-BnP;2:Empty carrier pET30a/His-EDDIE-GFP;
C in Fig. 3:BnPRP1 gene PCRs detect;M:DL2000DNA Marker;1:Positive control;2:Negative control;3- 4:BnPRP1 recons.
The expression and purification SDS-PAGE electrophoresis detections of Fig. 4 BnPRP1 albumen.
A in Fig. 4:The SDS-PAGE analyses of fusion protein EDDIE-BnPRP1 induced expressions;M:Small molecular weight protein Mar ker;1,3-6:EDDIE-BnPRP1 is precipitated;Lane 7:EDDIE-BnPRP1 after purification;Lane 2:Renaturation buffer conduct Control.
B in Fig. 4:SDS-PAGE electrophoretic analysis after EDDIE-BnPRP1 renaturation;M:Small molecular weight protein Marker;1,2: SDS-PAGE analyses in 8 hours after EDDIE-BnPRP1 renaturation.
The bacteriostatic activity analysis of Fig. 5 BnPRP1 antibacterial peptides.
In Fig. 5 (a):BnPRP1 antibacterial peptides are analyzed saccharomycete and the bacteriostatic activity of bacterium;
A:Saccharomycete:Pichia pastoris GS115;B:Sarcina lutea;C:Escherichia coli;
0:Renaturation buffer;1:Artificial synthetic antimicrobial peptide BnPRP1;2:Chemical synthesis antibacterial peptide;
In Fig. 5 (b):Cecropin B gene nPRP1 is analyzed the bacteriostatic activity of different fungies;
A:Sclerotinite;B:Trichoderma;C:Rhizoctonia at once;D:Botrytis cinerea;
0:Renaturation buffer;1:Artificial synthetic antimicrobial peptide BnPRP1;2:Chemical synthesis antibacterial peptide;
In Fig. 5 (c):Influences of the micro- sem observation cecropin B gene nPRP1 to nuclear fungal hyphae;
A:Normal growth mycelia;B:Mycelia knots;C:Mycelia adhesion;D:Mycelia ultimate swelling.
Fig. 6 BnPRP1 antibacterial peptides tooth in vitro is smeared and is followed by bacteriostasis figure after kind of sclerotinite.
A in Fig. 6:The blade smeared by cecropin B gene nPRP1;
B in Fig. 6:Undressed normal Arabidopsis leaf is as control.
Embodiment
According to following examples, the present invention can be better understood from, but described embodiment is to preferably explain this Invention, rather than limitation of the present invention.Agents useful for same of the present invention if not otherwise specified, derives from commercial channel, the skill Art scheme, it is the conventional scheme of this area if not otherwise specified.
Embodiment 1:
Rape antibacterial peptide gene BnPRP1 prediction and structural analysis
Utilize the Chinese cabbage of inventor laboratory structure, the genome and transcript profile sequence information number of wild cabbage and cabbage type rape According to storehouse (h ttp://www.ocri-genomicls.org/bolbase) and special antibacterial peptide database, as ANTIMIC is (preceding Face is already described), APD (above already described), APPDB (above already described), PhytAMP (above already described) etc. carry out BLAST comparison (nucleotides Similarity>90% i.e. Identity>90%) the large batch of pre-selection for having similar structures feature with known antibacterial peptide sequence, is obtained Gene.Then the protein sequence (Vector NTI10) to these pre-selection genes and (above already described) progress of secondary structure structure are pre- Survey and analyze, so as to establish protein three-dimensional structure figure, egg is carried out to the antibacterial peptide filtered out using secondary structure and function Storehouse is built in the classification of white matter family, so as to finally obtain the novel antimicrobial peptide gene that numbering is EV168192.1.It is named as BnPRP1. The nucleotides sequence of BnPRP1 genes is classified as shown in SEQ ID NO.3, and cecropin B gene nPRP1 amino acid sequence is SEQ ID N O.2 it is shown.
BnPRP1 antibacterial peptides contain 35 amino acid, and wherein proline content is typical proline rich more than 35% Class antibacterial peptide (Proline-rich PRPs).PRPs is typical linear antibacterial peptide, is free of or propylhomoserin containing semicanal less, will not shape Into disulfide bond, while also lack the secondary structures such as typical spiral and pleated sheet.(above already described) display of protein tertiary structure BnP RP1 secondary structure is mainly presented random coil and contains a small amount of helical structure.This protein structure determines that it is sent out Raw antibacterium and antimycotic binding mode are different from the mechanism of the destruction cell membrane of common antibacterial peptide, but by one kind not Destroy cell membrane mechanism come have the function that it is antibacterial (Balaji Ramanathan EGD, Christopher R.Ross, Frank Blecha:Cathelicidins:microbicidal activity,mechanisms of action,and roles in innate immunity.M icrobes and Infection 2002,4:361-372;Boman HG AB, Boman A:Mechanisms of action on Escherichia coli of cecropin P1and PR-39,two antibacterial peptides from pig intestin e.Infection and immunity 1993,61: 2978-2984;T.Cabras RL,F.Secundo,G.Nocca,S.Conti,L.Polonelli:Structural and functional characterization of the porcine proline–rich a ntifungal peptide SP-B isolated from salivary gland granules.Journal of Peptide Science 2008, 14:251-260.)。
In order to verify above-mentioned protein tertiary structure result, inventor's artificial synthetic antimicrobial peptide BnPRP1 all 35 ammonia Base acid, secondary structure structure detection is carried out in circular dichroism detector used in Chinese Academy of Sciences's virus research to it.BnPRP1 two level Structure detection is enterprising in institute of viruses of Chinese Academy of Sciences Jasco-810 CD spectropolarimeter light splitting polarimeters OK, Detection wavelength 190-260nm, detection step-length are 2nm, and each sample is to scan average value three times, are detected in room 20 DEG C or so progress of temperature.Water, methanol (MeOH), ethanol (EtOH), trifluoroethanol (TFE), acetonitrile (MeCN), P BS is respectively adopted Buffer solution (NaCl 137mM, KCl 2.7mM, KH2PO4 1.4mM,Na2HPO44.3mM, pH 7.4 is same as below) as molten Agent, CD spectrum signatures of the measure BnPRP1 in different solvents system.BnPRP1 final concentration of 100 μM/L in measure system.Adopt The B nPRP1 buffer solutions that 50 μM/L is prepared with TFE containing various concentrations (25%, 50%, 75%) PBS carry out CD surveys It is fixed.In measurement results such as Fig. 2 of the BnPRP1 in different organic solvents and phosphate buffer shown in A, in organic solution Peak value increases compared with PBS at 220nm, illustrates that helical content increases antibacterial peptide in organic solvent, organic molten in order to obtain Agent is studied organic molten the details of BnPRP1 secondary structure effects using the trifluoroethanol PB S buffer solutions of various concentrations Formation of the agent to BnPRP1 secondary structure.From Fig. 2 B can be seen that TFE can effective inducing cycloidic structure formation, with The rise of TFE concentration, the intensity at its peak also gradually strengthens, i.e. its helical structure content increase.Derivable helical structure is got over It is illustrate that helical structure contained in BnPRP1 secondary structures under normal circumstances is fewer more, calculated according to the above results BnPRP1 is made up of 90% random coil and 10% helical structure.
Circular dichroism detector testing result result shows that it is mainly formed as two level is predicted by random coil, includes A small amount of α spirals, belong to Proline-rich classes antibacterial peptide (Fig. 2).Illustrate that the present invention measures by analysis of biological information and in advance The antibacterial peptide of the Proline-rich type new to one.
Embodiment 2:
The codon optimization of rape BnPRP1 genes and external synthesis
Due to antibacterial peptide, existence time is short in vivo, it is difficult to catches, the round pcr with routine is difficult from rape cDNA Middle amplification, and whole antibacterial peptide is all artificial synthesized then expensive.In order to reduce the cost for obtaining antibacterial peptide, root of the present invention According to the DNA sequence dna according to BnPRP1 genes, DNAWorks Software tools (http is utilized://mcl1.ncifcrf.gov/dnawo Rks/, Hu F, Ke T, Li X, Mao PH, Jin X, Hui FL, Ma XD, Ma LX.Expression and Purif ication of an Antimicrobial Peptide by fusion with elastin-like polypeptides in Escherichia coli.Appl Biochem Biotechnol.2010,160(8):2377-87), it is excellent by codon Change (Ke T, Liang S, Huang J, Mao H, Chen J, Dong C, Liu S, Kang J, Liu D, Ma X:A novel PCR-based m ethod for high throughput prokaryotic expression of antimicrobial peptide genes.BMC Biot echnol 2012,12:10.) primer sequence is designed, altogether 6 coverings of synthetic primer The primer (the handsome company's synthetic primer in Shanghai) of BnPRP1 total lengths, respectively BnPEV168192_1, BnPEV168192_2, BnPEV168192_3, BnPEV168192_4, backboneF and backboneR.Primer sequence is as shown in table 1, boldface table Show with carrier pET30a/His-EDDIE-GFP (carrier be this laboratory with reference to Ke Tao documents it is built-up, Ke T, Liang S, Huang J,Mao H,Chen J,Dong C,Liu S,Kang J,Liu D,Ma X:A novel PCR-based method for high thro ughput prokaryotic expression of antimicrobial peptide genes.BMC Biotechnol 2012,12:10.) homologous part, remaining is gene-specific primer.Using Overlap- Round pcr (Zhu D, Zhong X, Tan R, Chen L, Huang G, Li J, Sun X, Xu L, Chen J, Ou Y, Zhang T,Yuan D,Zhang Z,Shu W,Ma L:High-throughput cloning ofhuman liver complete open reading frames using ho mologousrecombination in Escherichia coli.Anal Biochem 2010,397(2):162-167) obtain BnP RP1 full length genes.
PCR reaction systems are as follows:Total reaction system is 50 μ L, is included:10 × Taq buffer (contain MgCl2) 10 μ l, 1.5mmol/L dNTP (10mmol/L) 4 μ l, primer backboneF1 and backboneR respectively add 1 μ l (concentration 10mmol/ L), primer BnPEV168192_1, BnPEV168192_2, BnPEV168192_3 and BnPEV168192_4 respectively add 1 μ l (concentration For 2mmol/L), Taq (5U/ μ l) 1 μ l, ddH2O 33μl.Reaction condition be 94 DEG C 5 minutes, 94 DEG C 1 minute, 58 DEG C 1 minute, 72 DEG C 30 seconds 2 minutes, 25 circulations, extend 10 minutes after 72 DEG C, amplification size is 108bp (Fig. 3).PCR primer is through 1.0% fine jade Sepharose electrophoresis detection, after Gel Extraction kit recovery, it is connected to pMD18-T carriers, heat shock method conversion XL10- The competent cell of Gold bacterial strains, it is coated on the LB solid medium flat boards containing the μ g/mL of ampicillin 50,37 DEG C of cultures Overnight, hickie 6 is selected, using M13 primers:5 ' TGTAAAACGACGGCCAGT3 ' and 5 ' CAGGAAACAGCTATGACC3 ', Do bacterium colony PCR detections.Amplified production size is 200bp, after 1.0% agarose gel electrophoresis detected magnitude is correct.PCR is detected The correct bacterial plaque of size is inoculated into the LB liquid medium of the μ g/mL containing ampicillin 50,200r/min shaken cultivations at 37 DEG C Overnight, a small amount of alkalinity extraction plasmids, after 1.0% agarose gel electrophoresis detection DNA size is correct (for 400bp), use Kpn I/BamH I digestions carry out double digestion to plasmid, and 37 DEG C overnight, the detection of 1.0% agarose gel electrophoresis.It will detect correct Positive recombinant clones be named as pMD18-BnPRP1, pMD18-BnPRP1 is served into Hai Yingjun companies is sequenced, analysis knot Fruit, the cecropin B gene nPRP1 full length gene sequences after being optimized, its sequence are shown in SEQ ID NO.1.
Embodiment 3:Fusion expression vector EDDIE-BnPRP1 structure
The method reported according to Ke Tao, using inverse PCR technique, expression vector pET30a/ is connected to by BnPRP1 genes On His-EDDIE-GFP.Utilize 30abackbone-F:TGAGATCCGGCTGCTAACAAAGCCC and 30abackbon e-R: GCAGCTGGTCACCCACAGCG primers, by Inverse PCR amplification, by pET30a/His-EDDIE-GF P vector linearizations.Tool Precursor reactant system is as follows:Using 50 μ L systems, the wherein μ l of pET30a/His-EDDIE-GFP plasmids 1 (50ng/ μ l) are template mould Plate, 10 × Taq buffer (contain MgCl2) 5 μ l, 1.5mmol/L dNTP (10mmol/L) 4 μ l, 5 ' primer 30abackbone- The μ l of R 2 (10 μm of ol/L), the μ l of 3 ' primer 30abackbone-F 2 (10 μm of ol/L), Taq enzyme (5U/ μ l) 1 μ l, ddH2O 31μl。 Reaction condition is 5 minutes at 94 DEG C, 94 DEG C 30 minutes, 60 DEG C 30 seconds, 72 DEG C 6 minutes, 25 circulations, extend 10 points after 72 DEG C Clock, PCR primer size are 6kb.After 1.0% agarose gel electrophoresis detected magnitude is correct, reclaimed with gel reclaims kit 6kb large fragments.By the pET30a/His-EDDIE-GFP linearized vectors fragment being recovered to passing through in embodiment two The BnPRP1 full length DNA fragments that Overlap-PCR amplification recovery obtains, while convert Escherichia coli XL10-Gold bacterial strains and (be purchased from Strategene companies), by pinpointing homologous recombination in vivo, BnPRP1 genes are connected to expression vector pET30a/His- On EDDIE-GFP.Specific method is as follows:According to pET30a/His-EDDIE-GFP linearized vector fragments:50ng BnPRP1 Full length DNA fragment=3:1 ratio biased sample, with heat shock method convert XL10-Gold bacterial strains competent cell after, containing Screened on the solid LB media flat board of kanamycins (50 μ g/mL), utilize the GFP green fluorescent protein marks of (Fig. 1) on carrier Label screen non-luminous positive colony under ultraviolet light, extract plasmid, through 1.0% agarose gel electrophoresis detected magnitude just Really (B in Fig. 3), serve the sequencing of Hai Ying fine horses biotech firm.Sequence is correctly purpose gene fusion expression carrier after sequencing EDDIE-BnPRP1。
Embodiment 4:
The external evoked expression of cecropin B gene nPRP1 is with isolating and purifying
Correct fusion expression vector EDDIE-BnPRP1 plasmids will be sequenced, BL21 (DE3) impressions are transformed into heat shock method In state cell, EDDIE-BnPRP1 amalgamation and expression engineering bacteria BL21 (DE3)/pETNB is obtained.Bacterium solution is drawn 5 μ l and existed after converting In the flat lining out of solid LB media containing kanamycins (50 μ g/mL), 37 degree of cultures resist after 24 hours from kanamycins Picking chooses single bacterium colony on mild-natured plate.The single bacterium colony of picking is inoculated in the LB of 10 milliliters final concentration of (50ug/mL kanamycins) In nutrient solution, stayed overnight in 37 DEG C of shaken cultivations, with 1:100 ratio is forwarded in 1000 milliliters of LB fluid nutrient mediums, and 37 DEG C are shaken Culture 3 hours or so is swung, when absorbance value is 0.6 or so under 600nm with spectrophotometer detection LB fluid nutrient mediums, upper State the IPTG that final concentration of 1mM is added in LB fluid nutrient mediums.Concussion continues to cultivate 6h progress induced expressions at 37 DEG C, uses platform Formula centrifuge (above already described) with 5000r/min centrifugation 15min, outwells supernatant at room temperature, collects bacterial sediment.
By the thalline that upper step is collected with bacterium buffer solution is broken, ultrasonic cell disruptor carrying out ultrasonic bacteria breaking 5min is used under ice bath, Then 15min is centrifuged with 5000r/min rotating speed with centrifuge under the conditions of 4 DEG C, collects inclusion body precipitation.Inclusion body is precipitated Cleaned twice under the conditions of 4 DEG C with 10 milliliters of lavation buffer solutions, 2 minutes every time.With centrifuge with 12000r/ under the conditions of 4 DEG C Min rotating speeds centrifuge 20min, collect precipitation again.With the expression (figure of destination protein in SDS-PAGE electrophoresis detection inclusion bodys 4).The result of (A) shows after IPTG inducing action 8 hours in Fig. 4, BnPRP1 great expressions in inclusion body precipitation.
With volume ratio 1:The inclusion body collected above precipitation is dissolved in urea-denatured buffer solution by 10 ratio, at room temperature Shaken 2 hours with oscillator, 20min is centrifuged with 12000r/min rotating speeds with centrifuge in 4 DEG C, takes supernatant.Take 1ml Ni-NTA Ago-Gel prepacked column, add 10ml equilibration buffers and balance prepacked column at room temperature 30 minutes, with 5000r/min Speed in 4 DEG C with centrifuge 5min, remove the solution under, collect prepacked column.Then inclusion body protein supernatant is taken 10ml samples with 0.5ml/min speed loading into Ni-NTA Ago-Gel prepacked columns, with 2 milliliters of centrifuge tubes be in charge of by lower section The solution flowed down in prepacked column is collected, often pipe collects 2 milliliters.Then washed with 15ml lavation buffer solutions with 1-2ml/min flow velocity Remove unadsorbed sample.Lower section is in charge of the solution collected and flowed down in prepacked column with 2 milliliters of centrifuge tubes, and often pipe collects 2 milliliters.Then The EDDIE-BnPRP1 fusion proteins specifically bound with 5ml elution buffers with 1-2ml/min flow velocity elution with Ni-NTA, Lower section is in charge of the solution collected and flowed down in prepacked column with 2 milliliters of centrifuge tubes, and often pipe collects 2 milliliters.Finally use 5ml level pads Pillar is balanced, adds 1 milliliter of 20% ethanol in case next time uses.By all solution of collection SDS-PAGE electrophoresis detection purposes The content and purity of albumen, take purity best, and the pipe of concentration highest one does renaturation experiment (sample of swimming lane 7 in A in Fig. 4).
2 milliliters of the protein solution of swimming lane 7 in best Fig. 4 A after step electrophoresis detection is taken, rapidly joins 100 milliliters of renaturation Buffer solution, placed 6 hours in room temperature, Tricine-SDS-PAGE electrophoresis detection fusion proteins EDDIE-BnPRP1 self cleavage effect Fruit, as a result as shown in B in Fig. 4:Obtain fusion protein occur it is remaining without any additional amino acid after self cleavage BnPRP1 antibacterial peptides.The protein content of antibacterial peptide after renaturation, concentration 12mg/ml are determined using Nanodrop-2000.
Embodiment 5:
BnPRP1 antibacterial peptide Antibacterial Activities
Represented respectively with Sarcina lutea (Micrococcus luteus) for gram-positive bacteria, Escherichia coli (Escherichia coli) represents for Gram-negative bacteria, and saccharomycete (Pichia pastoris GS115) is as fungi Indicator bacteria, the standard method using cylinder-plate method as detection cecropin B gene nPRP1 bacteriostatic activities.
Specific method is as follows:The artificial purifying that 200 microlitres of concentration are about 3 milligrams every milliliter is added in each Oxford cup Good cecropin B gene nPRP1 solution or the cecropin B gene nPRP1 solution of chemical synthesis, cultivated under 37 degree of environment 12-16 small Shi Hou, the antibacterial activity of BnPRP1 antibacterial peptides is calculated by determining inhibition zone size.Altogether carry out 3 times experiment, test every time into 3 technologies of row repeat.
As a result as shown in (a) and table 2 in Fig. 5, Oxford cup and artificial synthetic antimicrobial peptide added with expression and purification antibacterial peptide All occur big inhibition zone around Oxford cup, and control section does not have obvious inhibition zone to occur.Vivoexpression purifies antibacterial peptide BnPRP1 more than 1.3 centimetres, is shown to the average antibacterial circle diameter of Escherichia coli, Sarcina lutea and Pichia pastoris Efficient bacteriostasis.
Inventor is also to BnPRP1 antibacterial peptides to sclerotinite (Sclerotinia sclerotiorum), botrytis cinerea (Botrytis cine rea) and three kinds of plant pathogenic fungis of Rhizoctonia solani Kuhn (Pyricularia grisea Sacc) Bacteriostatic activity is identified.Intact sclerotinite sclerotium is selected, it is first alcohol-pickled 1 minute with 10 milliliter 75%, then with 10 in the least Rise 0.1%HgCl2Middle soaking disinfection 8-10 minutes, then with flushing 3-5 times of 10 milliliters of sterilized water.Sterilizing sclerotium is cut two Mung bean size is cut into end, center section, and section down, is inoculated in PDA plate.Usual every sclerotium connects a plate, is once inoculated with 8-9 Plate.In 22 DEG C of quiescent cultures 3-4 days, when mycelia will be paved with flat board, useCard punch punches along mycelia outer rim, takes bacterium Silk block, for being inoculated with again.The mycelia block taken out with card punch is placed in middle position on a new PDA plate, makes to contain There are the one side contact PDA planes of mycelia.
Botrytis cinerea and the mycelia block of Rhizoctonia solani Kuhn are separately immersed in 50% glycerite, are stored in -80 DEG C of ultralow temperature Refrigerator.The mycelia block of preservation can be cultivated directly on PDA plate.Botrytis cinerea needs about 48 hours thirty years of age withered silk of 22 DEG C of cultures Pyrenomycetes needs 26 DEG C to cultivate 48 hours, when mycelia extends to about 1cm, equally respectively places an Oxford up and down in mycelia block Cup, it is separately added into antibacterial peptide (the effect phase for the antibacterial peptide that two methods obtain of artificial purified antibacterial peptide or chemical synthesis Together), renaturation solution is as control.Continue culture 48 hours, observe bacteriostatic activity situation.As a result as shown in (b) in Fig. 5, with compareing Compare, Fungal hyphal growth is prevented around the Oxford cup added with antibacterial peptide, can not cross Oxford cup, and control section mycelia It then can smoothly cross the edge that Oxford cup reaches culture dish.Cecropin B gene nPRP1 bacteriostatic diameter and the result of calculation of bacteriostasis rate It is shown in Table 2.As a result show that the cecropin B gene nPRP1 of vivoexpression purifying reaches 90% to the bacteriostasis rate of sclerotinite, the suppression to botrytis cinerea Bacterium rate reaches 86%, and the bacteriostasis rate of Rhizoctonia solani reaches 84%.
The vivoexpression of table 2 purifies cecropin B gene nPRP1 bacteriostatic activities
In order to further inquire into the inhibitory action that BnPRP1 antibacterial peptides grow to fungi, research pair is used as using nuclear fungal hyphae As having inquired into growth inhibition effect of the antibacterial peptide to nuclear fungal hyphae.By above on PDA plate normal growth nuclear fungal hyphae Removed, be placed on slide with tweezers respectively with nuclear fungal hyphae near the Oxford cup for adding BnPRP1 solution, the upper 1 drop physiology of drop Salt solution, covered, (Lycra DMI6000B) observation is placed under inverted microscope, is found after cecropin B gene nPRP1 is acted on Nuclear fungal hyphae compared with the nuclear fungal hyphae of normal growth, mycelial growth is suppressed, occur on mycelia top knot, Wrapping phenomena, and occur serious adhesion phenomenon between mycelia, as shown in C in Fig. 5.Illustrate that BnPRP1 mainly passes through resistance Hinder growing to reach the purpose for suppressing mycelia and extending for disease fungus top mycelia.
Embodiment 6:
Application of the BnPRP1 antibacterial peptides in plant disease-resistant
In order to detect potentiality of the cecropin B gene nPRP1 as resistance of the biological prevention and control agent for improving plant against fungal disease, hair A person of good sense sprays certain density artificial expression and purification antibacterial peptide solution, then inoculation in plant (arabidopsis, rape) blade surface Above-mentioned three kinds of disease funguses, Lesion size is determined after 36 hours.Concrete mode is as follows:
The Arabidopsis leaf and 5 leaf phase rape leafs of growth 5 weeks are taken, uniformly smearing one layer of concentration in blade surface is 5ng/ μ l labor statements reach cecropin B gene nPRP1 after purification.According to method described in embodiment 5, cultivated respectively on PDA plate Sclerotinite, botrytis cinerea and Rhizoctonia Solani, when mycelia will be paved with flat board, useCard punch is beaten along mycelia outer rim Hole, mycelia block is taken, be inoculated with for rape leaf, usedCard punch punches along mycelia outer rim, mycelia block is taken, for arabidopsis Blade inoculation.The mycelia block that card punch takes out is placed in arabidopsis and rape leaf middle with syringe needle, made containing bacterium The one side contact blade surface of silk.It is simultaneously also same according to the method described above on the arabidopsis and rape leaf for not smearing antibacterial peptide Sclerotinite, botrytis cinerea and Rhizoctonia Solani are inoculated with soon as control, are cultivated 36 hours and are seen under the conditions of 22 DEG C, humidity 90% Susceptible situation is examined, and determines the Lesion size on each blade.As a result as shown in Fig. 6 and table 3, table 4, the plan south of antibacterial peptide is smeared Mustard blade and rape leaf are compared with the arabidopsis and rape leaf do not smeared, inoculation sclerotinite, botrytis cinerea and Rhizoctonia solani Kuhn Lesion area after 36 hours is all substantially reduced.Such as sclerotinite is inoculated with without smearing cecropin B gene nPRP1 Arabidopsis leafs 36 hours Bacterial plaque area expands to 3.04cm afterwards2, and the average bacterial plaque area for smearing cecropin B gene nPRP1 Arabidopsis leafs is 0.92cm2, only Have the 30% of control blade bacterial plaque area.Bacterium equally after rape leaf surface smear cecropin B gene nPRP1 is followed by bacterium 36 hours Spot area also only has 27% or so of control.Illustrate effectively to inhibit nuclear disk in arabidopsis and rape leave surface smear antibacterial peptide The extension of bacterium, improve resistance of the plant to sclerotinite.Botrytis cinerea also obtains similar knot with the inoculation test of Rhizoctonia solani Kuhn Fruit (table 3, table 4).Inventor's method as noodles, cecropin B gene nPRP1 is smeared on 5 leaf phase soybean leaves, then inoculation Another disease fungus ash plaque, inoculation blade is 9, is repeated 3 times, using do not smear 5 leaf phase soybean leaves of antibacterial peptide as pair According to.According to incidence, 6 days measurement lesion areas after bacterium is connect.As a result show:The scab face of antibacterial peptide soybean leaves is smeared Product is 0.158 ± 0.01cm2, compared to the lesion area (0.224 ± 0.013cm for the control blade do not smeared2), its scab spot Area averagely reduces 30%, and pole significant difference is presented.This explanation sprays cecropin B gene nPRP1 in plant leaf blade and significantly inhibited Sclerotinite, botrytis cinerea, Rhizoctonia solani Kuhn and grey plaque infect the effect of diffusion, and it is true to these four cause of diseases to effectively raise plant The resistance of bacterium.
Lesion area (unit after the Arabidopsis leaf of table 3 is inoculated with 36 hours:cm2)
Numbering Control 1 2 3 4 5 6 7 8
Sclerotinite 3.04 0.96 1.08 0.88 1.01 1.14 0.95 0.59 0.78
Botrytis cinerea 4.86 1.15 1.21 1.47 1.38 1.81 1.20 1.05 1.22
Rhizoctonia solani Kuhn 3.65 1.56 1.12 1.02 1.76 1.79 1.44 1.35 1.61
Lesion area (unit after the rape leaf of table 4 is inoculated with 36 hours:cm2)
Numbering Control 1 2 3 4 5 6 7 8
Sclerotinite 6.21 1.52 1.74 1.85 1.96 1.35 1.78 1.85 1.66
Botrytis cinerea 8.89 2.24 2.67 2.01 2.14 2.53 2.96 2.38 2.49
Rhizoctonia solani Kuhn 7.01 2.25 2.59 2.23 2.65 2.98 2.87 2.98 2.44
The bacteriostatic activity testing result of the present invention shows BnPRP1 to bacterium (Escherichia coli, Sarcina lutea) fungi (saccharomycete, sclerotinite, botrytis cinerea, Rhizoctonia solani Kuhn, grey plaque) all has stronger bacteriostatic activity.Excised leaf is smeared and connects bacterium Experiment confirms that BnPRP1 can strengthen plant to metatrophy type fungi:Sclerotinite, botrytis cinerea, Rhizoctonia solani Kuhn, grey plaque Resistance.BnPRP1 can be used in the preventing and treating of sclerotiniose, gray mold, damping-off and graywall as biological prevention and control agent.Base can be passed through BnPRP1 expression is improved because of engineering technology can strengthen plant to sclerotinite, botrytis cinerea, Trichoderma and Rhizoctonia solani Kuhn Resistance, can also as resistance marker be used for rape disease-resistant variety seed selection.
SEQUENCE LISTING
<110>Inst. of Oil Crops, Chinese Academy of Agriculture
<120>A kind of rape cecropin B gene nPRP1 and its application
<130>A kind of rape cecropin B gene nPRP1 and its application
<160> 3
<170> PatentIn version 3.1
<210> 1
<211> 108
<212> DNA
<213>Artificial sequence
<400> 1
atgccgccta cccaaaatcc gagcatggcg cctccaactc agaaccctta cggccagcct 60
atggcacccc ctacccagaa tccgtatggg cagccgatgg ctccaccg 108
<210> 2
<211> 35
<212> PRT
<213>Rape
<400> 2
Pro Pro Thr Gln Asn Pro Ser Met Ala Pro Pro Thr Gln Asn Pro Tyr
1 5 10 15
Gly Gln Pro Met Ala Pro Pro Thr Gln Asn Pro Tyr Gly Gln Pro Met
20 25 30
Ala Pro Pro
35
<210> 3
<211> 105
<212> DNA
<213>Rape
<400> 3
cctccgaccc agaatccctc tatggctcct ccaactcaga atccgtacgg tcaacctatg 60
gctccaccaa ctcagaatcc atacggtcaa cctatggctc cacca 105

Claims (8)

1. a kind of protein of separation, its sequence is shown in SEQ ID NO.2.
2. gene corresponding to the protein described in claim 1.
3. gene according to claim 2, its sequence is shown in SEQ ID NO.1.
4. gene according to claim 2, its sequence is shown in SEQ ID NO.3.
5. application of the gene described in protein or claim 2 in antibacterials are prepared described in claim 1.
6. application according to claim 5, it is characterised in that described antibacterials are anti-sclerotinite medicine, anti-grey mold Bacterium medicine, anti-Rhizoctonia solani Kuhn medicine, anti-Escherichia coli medicine, anti-Sarcina lutea medicine or anti-Pichia pastoris medicine.
7. the gene described in protein or claim 2 described in claim 1 resists in enhancing plant to metatrophy type fungi The application of property, described fungi is Rhizoctonia solani Kuhn, botrytis cinerea, sclerotinite or grey plaque.
8. the preparation method of albumen described in claim 1, comprises the following steps:
1) fusion expression vector EDDIE-BnPRP1 structure
Utilize 30abackbone-F:TGAGATCCGGCTGCTAACAAAGCCC and 30abackbone-R:GCAG CTGGTCACCCACAGCG primers, by Inverse PCR amplification, by pET30a/His-EDDIE-GFP vector linearizations;Will recovery The pET30a/His-EDDIE-GFP linearized vectors fragment arrived and the nucleotide sequence shown in SEQ ID NO.1, are converted simultaneously Escherichia coli XL10-Gold bacterial strains, by pinpointing homologous recombination in vivo, BnPRP1 genes are connected to expression vector p ET30a/ On His-EDDIE-GFP, target gene fusion expression vector EDDIE-BnPRP1 is obtained;
2) the external evoked expression of cecropin B gene nPRP1 is with isolating and purifying
Correct fusion expression vector EDDIE-BnPRP1 plasmids will be sequenced, BL21 (DE3) competent cell is transformed into heat shock method In, obtain EDDIE-BnPRP1 amalgamation and expression engineering bacteria BL21 (DE3)/pETNB;Using usual manner in LB fluid nutrient mediums Cultivate and inducible protein expression, the bacterial cell disruption centrifugation of acquisition, supernatant after purification, produce destination protein cecropin B gene nPRP1, its Sequence is shown in SEQ ID NO.2.
CN201410801776.3A 2014-12-19 2014-12-19 A kind of rape cecropin B gene nPRP1 and its application Active CN104530204B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410801776.3A CN104530204B (en) 2014-12-19 2014-12-19 A kind of rape cecropin B gene nPRP1 and its application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410801776.3A CN104530204B (en) 2014-12-19 2014-12-19 A kind of rape cecropin B gene nPRP1 and its application

Publications (2)

Publication Number Publication Date
CN104530204A CN104530204A (en) 2015-04-22
CN104530204B true CN104530204B (en) 2017-11-10

Family

ID=52845867

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410801776.3A Active CN104530204B (en) 2014-12-19 2014-12-19 A kind of rape cecropin B gene nPRP1 and its application

Country Status (1)

Country Link
CN (1) CN104530204B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110301454B (en) * 2019-06-16 2020-10-16 浙江大学 Application of rape short peptide BnPEP5
CN110278959B (en) * 2019-06-16 2020-10-13 浙江大学 Application of rape short peptide BnPEP4
CN113717977A (en) * 2021-09-26 2021-11-30 中国农业科学院油料作物研究所 Brassica napus tissue-specific P8 promoter and application thereof in preparation of transgenic rape

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101849608B (en) * 2010-05-18 2013-12-18 四川大学 Rape-seed meal antibacterial peptide

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101849608B (en) * 2010-05-18 2013-12-18 四川大学 Rape-seed meal antibacterial peptide

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
抗菌肽基因BnPCD842895克隆表达及活性检测;黄金;《中国油料作物学报》;20130829;第35卷(第4期);第358页右栏第1.3节,第362页右栏第4节,第358页左栏第1-2段,第361页第2.5节,第359页第1.5节和第1.6节 *
油菜抗菌肽的分离及抑菌机制的初步研究;詹妍等;《四川大学学报(自然科学版)》;20090128;第46卷(第1期);全文 *

Also Published As

Publication number Publication date
CN104530204A (en) 2015-04-22

Similar Documents

Publication Publication Date Title
Chadha et al. An ecological role of fungal endophytes to ameliorate plants under biotic stress
El Enshasy et al. Trichoderma: biocontrol agents for promoting plant growth and soil health
CN103756975B (en) A kind of preparation method and application thereof infecting the soybean mosaic virus of tobacco
JPWO2002072817A1 (en) Novel proteins, genes encoding them, and uses thereof
CN111171123B (en) Plant immune activation protein PsPII1 and application thereof
CN106834336A (en) A kind of heterogenous expression and purification process of Trichoderma harzianum acid protease P6281
CN104530204B (en) A kind of rape cecropin B gene nPRP1 and its application
CN104744577B (en) Beauveria bassiana antibacterial protein Bbafp and its expression vector, genetically modified plants containing its gene preparation method and application
Tang et al. Allium fistulosum L. alleviates apple replant disease by suppressing Fusarium solani
CN106929516A (en) Cucumber CsDIR16 genes and its application in plant Propamocarb residues of pesticides are reduced
CN104530206B (en) A kind of rape cecropin B gene nCRP1 and its application
CN107964547B (en) A kind of 10 gene PnPR10-3 of Radix Notoginseng pathogenesis-related proteins and application
JP2012246227A (en) Soilborne disease controlling agent, and method for controlling soilborne disease using the same
CN1693468A (en) High efficiency secretory expression application of plant multifunction activity and broad spectrum resistance cell signal factor Harpin
CN104530205B (en) A kind of rape cecropin B gene nLTP1 and its application
RU2352580C1 (en) Peptide with antifungal activity
CN103255096A (en) Gene engineering bacterium capable of performing high-efficiency expression on Alpha-elaterin-protein and construction method and application thereof
CN106818885A (en) A kind of acid protease is preparing the application in suppressing cause of disease bacteria preparation
CN112940135A (en) Fusion protein, amino acid sequence, coding nucleotide sequence, preparation method and application thereof
JP2005500062A (en) A new biochemical pesticide that uses a gene derived from a black wilt fungus WT # 3 (KCCM10283), a novel phytopathogenic fungus that affects pear trees
CN109988227A (en) The functional protein of nematode commensal gut bacterium BC7 and its application
CN113817747B (en) Sisal hemp defensin gene and application thereof
CN109134629A (en) Botrytis cinerea secreted protein exciton BcXyl1 and its application
WO2003106490A1 (en) A fusion protein comprising a cellulose binding domain
CN110684087B (en) Lanthionine precursor peptide amyA16, and preparation method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant