CN104530205B - A kind of rape cecropin B gene nLTP1 and its application - Google Patents
A kind of rape cecropin B gene nLTP1 and its application Download PDFInfo
- Publication number
- CN104530205B CN104530205B CN201510050902.0A CN201510050902A CN104530205B CN 104530205 B CN104530205 B CN 104530205B CN 201510050902 A CN201510050902 A CN 201510050902A CN 104530205 B CN104530205 B CN 104530205B
- Authority
- CN
- China
- Prior art keywords
- gene
- bnltp1
- eddie
- rape
- nltp1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/10—Animals; Substances produced thereby or obtained therefrom
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Agronomy & Crop Science (AREA)
- Pest Control & Pesticides (AREA)
- Virology (AREA)
- Dentistry (AREA)
- Environmental Sciences (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a kind of rape cecropin B gene nLTP1 and its application.The invention provides a kind of rape cecropin B gene nLTP1, its sequence is shown in SEQ ID NO.2.The artificial synthesized of the gene is completed by overlap PCR methods, the antibacterial peptide gene of synthesis is cloned on pET30a/His EDDIE GFP expression vectors and is transformed into Escherichia coli and carries out vivoexpression, obtains the antibacterial peptide prod for not increasing any additional amino acid.Bacteriostatic activity testing result shows that cecropin B gene nLTP1 has stronger bacteriostatic activity to bacterium and fungi.Excised leaf, which is smeared, connects bacterium experiment confirmationBnLTP1Plant can be significantly increased to metatrophy type fungi:Sclerotinite, botrytis cinerea, the resistance of Pyricularia oryzae.BnLTP1 can be used in the preventing and treating of sclerotiniose, gray mold and rice blast as biological prevention and control agent, and the seed selection of rape disease-resistant variety can also be used for as resistance marker.
Description
Technical field
The present invention relates to genetic engineering and biological technical field.More particularly to a kind of rape cecropin B gene nLTP1 and its answer
With.
Background technology
Pathogen can cause the serious plant disease for including the mankind, livestock, crop and other biological, cause serious economic damage
Lose.Plant pathogenic fungi is the important pathogen of plant, can cause more than 80% plant disease (Zhang Fuli, Wang Zhanbin, Wang Zhi
English, effect of the chitinase in plant resistance to fungal disease, forestry science and technology, 2006,31 (3):24-27), world food is caused to make
(Knight S.C., Anthony V.M., Brady A.M., the et al.Rationale and of the thing underproduction about 20%
perspecti ves on the developmentof fungicides.Annu Rev Phytopathol,1997,35:
349-372).Caused by many important plant diseases are all fungi, such as the late blight of potato, rice blast, wheat powdery mildew, corn
Northern and southern leaf blight bacterium, grey speck of soybean, sclerotinia sclerotiorum etc., very huge economic loss is all caused every year.On the other hand, fungi
During plant is infected, metabolite --- the mycotoxin (mycotoxin) that discharges, to crops and the mankind
Health also result in great harm, such as aflatoxin (aflatoxin).
Sclerotinite (Sclerotinia sclerotiorum) belongs to Ascomycotina, discomycete, Helotiales, sclerotinite
Section, Sclerotinia.It is the global important phytopathogen of a kind of damage to crops and vegetables.Sclerotinite can widely invade
Contaminate many unifacial leaves and dicotyledon.Sclerotiniose caused by sclerotinite is a kind of metatrophy type fungi similar to grey mold,
This destructive pathogeny infects more than 400 kinds plants, widely distributed.The preventing and treating to sclerotiniose relies primarily on chemical pesticide at present,
But not only cost is high, pollution environment for chemical prevention, and preventive effect is also undesirable;Meanwhile the security of food is also by serious
Influence.Rape is one of oil crops important in the world, and sclerotiniose causes the root of rape, rotting for stem and silique, be result in
Huge production loss.Although the agricultural production of sclerotiniose serious threat, plant to the molecular mechanism of the host resistance of sclerotinite,
We still know little about it.Untill up till now it has not been found that completely immune or high anti-rape cultivation kind (Liu, S.,
Wang,H.,Zha ng,J.,Fitt,B.D.,Xu,Z.,Evans,N.,Liu,Y.,Yang,W.,and Guo,X.2005.In
vitro mu tation and selection of doubled-haploid Brassica napus lines with
improved resistance to S clerotinia sclerotiorum.Plant Cell Rep.24:133-144),
Therefore, resistance mechanism of the plant to this pathogeny is probed into, it is found that new resistant gene has far reaching significance.
Botrytis cinerea (Botrytis cinerea), also known as the pathogen of Botrytis cinerea, it is a kind of wide host's property, 200 can be caused
The downright bad auxotype disease fungus of a variety of known plants (such as water fruits and vegetables and flowers) gray molds.It is widely distributed in atmosphere,
Field crops can not only be infected, can equally be brought about great losses to the rear stage of adopting of plant.Botrytis cinerea can be in cryogenic conditions
Under (0 DEG C) growth, propagated by producing substantial amounts of grey conidium, compared with other postharvest pathogenic fungis, had latent
Infect the advantage caused a disease with low temperature.Meanwhile it also has the characteristics of breeding is fast, hereditary variation is big and grade of fit is high.Daily life
In the fruits and vegetables that run into put a period of time and can become mildewed, majority may receive infecting for botrytis cinerea.Gray mold initially simply flows
Row in Europe and America, since the 1980s just spread Chinese.Due to pushing away for greenhouse and greenhouse gardening technology
Broad-spectrum and, crop grey mold disease is serious, it has also become vegetables, flowers and forestry seedling cultivation base production key constraints.Cut
Only 2013, it is not yet found that any plant produces resistance to botrytis cinerea, (Chen Qi, Dinke was hard, Tan Genjia, Zhang Xiao in the world
It is big, ash arrhizus bacteria bacterial strain variation of drug resistance and its hereditary Journal of Sex Research.2003 East China plant pathology science seminars and Jiangsu Province plant
The tenth member representative assembly collection of thesis of thing pathology meeting).Consequently found that the gene of new anti-botrytis cinerea has far-reaching significance.
Rice blast also known as rice blast:It is commonly called as burning pest, cracks a pest between the teeth, rice blast is one of disease important greatly of rice four, mainly
Caused by disease fungus Magnaporthe grisea (Pyricularia oryzae P.oryzae).The significantly underproduction can be caused, the underproduction 40%~50% when serious,
Even No kernels or seeds are gathered, as in a year of scarcity water.Each rice region in the world uniformly occurs, wherein being occured as with leaf portion, section portion more, different journeys can be caused after generation
The underproduction is spent, especially panicle blast or section pest occurs early and weighed, and can cause dead ears so that total crop failure.Main cause harm blade, stalk, fringe portion.
Because evil period, position difference are divided into seedling pest, leaf pest, section pest, panicle blast, grain pest.Before seedling pest betide three leaves, by seed belt
Caused by bacterium.Sick seedling base portion is greyish black, top browning, crispaturas and dead, generation a large amount of grey black mould layers in disease portion when humidity is larger, i.e. cause of disease
Bacterium conidiophore and conidium.Leaf pest can occur in whole breeding time.Tiller to the jointing stage causes harm heavier.Seeding stage is sent out
Become yellowish-brown after being ill and withered, do not form obvious scab, when moist, it is mould cinerous can be grown.In China south and north, rice region is all
There is different degrees of generation, popular time general underproduction 10-20%, the serious underproduction reaches 40-50%, in rice seedling seedling stage and tiller
Phase falls ill, can making blade largely withered, full field is in shape is burnt when serious, though some rice strains are not withered, but the young leaves extracted out is not easy
Elongation, plant atrophy are not eared or extracted out short and small fringe, and the morbidity of booting heading stage, section pest, panicle blast seriously occur, and can cause big
Measure dead ears or half dead ears, loss greatly (Ling Zhongzhi,《Rice blast research paper collection》, Chinese agriculture publishing house).
Currently used disease control measure, chemical pesticide is relied primarily on, but not only cost is high, pollution ring for chemical prevention
Border, and preventive effect is also undesirable;Meanwhile the security of food can be also severely impacted.As the progress of society, people are more next
More profoundly recognize and largely use harm of the chemical pesticide to ecological environment and human health for a long time.Biological control can be effective
Ground overcomes these drawbacks, thus biological pesticide is increasingly valued by people.
Antibacterial peptide (antimicrobial peptides, AMPs) is a kind of natural small molecule egg with antibacterial activity
In vain, living nature is widely present in, is the important component of body nospecific immunity, is respectively provided with antibacterial activity in vitro in vivo
(Gordo n YJ,Romanowski EG,A Review of Antimicrobial Peptides and Their
Therapeutic Potential as Anti-Infective Drugs.Curr Eye Res.2005,30(7):505–
515).The extensive biological activity of antibacterial peptide, there is very strong suppression to make to bacterial fungus, protozoan, virus and tumour etc.
With, have the advantages that efficiently, environmental protection, do not make pathogen produce drug resistance make it in biological control and medically have it is good should
With prospect (Gordon YJ, Romanowski E G, A Review of Antimicrobial Peptides and Their
Therapeutic Potential as Anti-Infective Dr ugs.Curr Eye Res.2005,30(7):505–
515).Have become genetic engineering of plant for disease resistance, breeding feed additive, food preservative, emerging medicine and other fields in recent years
Study hotspot, in disease prevention and cure field be antibiotic ideal substitute (Boman HG, Peptide antibiotics
And their role in innateimmunity.Annu Rev Immuno1.1995,13:6l-92).In agricultural production
Cheng Zhong, transmission of the farm antibiotics by food chain can be avoided to threat caused by human body by carrying out plant protection work with antibacterial peptide.
According to amino acid sequence and secondary structure, it has been found that Antimicrobial Peptides From Plants can be divided into plant alexin (plant
Defensins), lipid transfer proteins (1ipidtransfer proteins, LTPs), thionin (thionins), ecdysone
(snakins), hevein class (hev ein-like), the plain class that knots (knottin-like peptides), balsamine element
(IbAMP), and newly discovered shepherd's purse plain (she pherdins), cyclic peptide (cyclotides) etc. (Hancock REW,
Chapple DS, Peptide Antibiotics.Antimicrob Agent Chemother, l999,43 (6):l3l7-
l323).Antibacterial peptide is substantially all with some general character, such as:Small-molecular-weight (<10KDa), cationic surface, positive charge and two
Parent's property, these characteristics enable antibacterial peptide and cell membrane to bind and be inserted into cell interior, and most of antibacterial peptide is logical
Cross destruction cell membrane so that target cell death and reach sterilization purpose.And other antibacterial peptides can be by cell membrane
Ion channel enter cell interior destroy cell without destroy cell membrane (Vogel PMHaHJ:Structure–
function relationships of antimicrobial peptides.Biochem Cell Biol 1998,76:
235-246.).The sterilization mode of proline rich class antibacterial peptide (PRPs) is exactly to pass through not destroy cell membrane, but utilizes ion
(the L.Otvos J that the mode of passage is carried out:The short proline-rich antibacterial peptide f
amily.Cellular and Molecular Life Sciences 2002,59:1138-1150.).Most types of plant
Material resource antibacterial peptide does not all have toxicity (Murad AM.Pelegrini PB.Neto SM.Novel to animal and plant cell
Findings of Defensins and their Utilization in Construction of Transgenic
Plants.Transgenic Plant Journ al 2001(1):39-48).Compared with animal derived antimicrobial peptide, plant-source antibacterial
Peptide is easier to express and regulate and control in crop, it is not easy to by intracellular proteasome degradation.Compared with other bactericide, plant comes
Influence of the antibacterial peptide in source to environment is smaller, more friendly, is more developed into the potentiality (Hancock of antimycotic biological agent
REW, Chapple DS, Peptide Antibi otics.Antimicrob Agent Chemother, l999,43 (6):
l3l7-l323).It will such as be fermented in Rs-AFPs Antimicrobial Peptides From Plants channel genes microorganisms, it is easier to overcome to host's
Toxic action and largely produced.
Antibacterial peptide is a kind of small-molecular peptides for having suppression or killing action to microorganisms such as bacterium, fungies, it can by bacterium,
Fungi or physics, chemical stimulation is induced, or even some antibacterial peptides can form the expression of composition in plant.It is not
Various bacteria is only resistant to, and can press down antifungal, viral etc., available for conversion crops, culture disease-resistant variety, thus is being planted
Had broad application prospects in thing breeding gene engineering field.Studied first in model plant tobacco and potato resistance to bacterial wilt
In succeed, then in the crop such as fire blight of pear, chrysanthemum, capsicum, eggplant of rice leaf spot bacteria and slice germ apple
Bacterium, achieve certain effect in nosomycosis research.Radish antibacterial peptide gene (AFP) transgenosis can be obtained into potato
P. infestans resistant etc. (Ren Yuxia, Chen Lingna, Chen Jifeng, Chen Zhenghua, potato turn radish antibacterial peptide gene plant acquisition and
The Preliminary Identification of anti-late blight, China's Vegetable 2012 (6):68-73).
Antimicrobial peptide of plant origins has broad-spectrum antifungal or bacterial activity, and the antibacterial peptide found in a kind of plant can be effective
Be applied in other various plants, as the antibacterial peptide in source in radish can go to wild poppy, Ma Ling by transgene method
Respectively reached in potato and wheat anti-late blight of potato and wheat sickle-like bacteria effect (Wei Yujie, Zhang Meixiu, Chang Ying, Luo Shuzhen,
Chen Lingna, wild poppy pollen mediation turn radish antibacterial peptide gene technique study, agriculture of gansu science and technology 2009 (11):6-9;Ren Yu
Rosy clouds, Chen Lingna, Chen Jifeng, Chen Zhenghua, potato turn the acquisition of radish antibacterial peptide gene plant and the Preliminary Identification of anti-late blight,
China's Vegetable 2012 (6):68-73;Zhao Li, Miaoping Zhou, Zengyan, ZhangLi, juan Ren, Lipu Du,
Boqiao Zhang, Huijun Xu, Zhiyong Xin, Expression of a radish defensin in tra
nsgenic wheat confers increased resistance to Fusarium graminearum and
Rhizoctonia cerea lis Funct Integr Genomics 2011,11:63–70).Antibacterial peptide is as emerging disease-resistant
Genetic resources, the resistance important in inhibiting to crops such as improvement rice, soybean, cotton, rapes to fungal disease.
Antibacterial peptide is because of its unique Antibacterial Mechanism, the antibiotic property of wide spectrum and the features such as be not likely to produce drug resistance, in each row
There is good application prospect in each industry, therefore be also subjected to more next more concern, turn into the study hotspot of Disciplinary Frontiers
(Hancock REW, Chapple DS, Peptide Antibiotics.Antimicrob Agent Chemother, l999,
43(6):l3l7-l323).But the antibacterial peptide of plant origin is also difficult to really be applied in agricultural production practice at present.Mainly
It is because the functional plant origin antibacterial peptide quantity identified at present is seldom, so as to greatly limit plants antimicrobial
The application of peptide.Antibacterial peptide gene in antibacterial peptide database by checking reaches more than 1600 at present, and Antimicrobial Peptides From Plants only have
Less than 300 (htt p://ercbinfo1.ucd.ie/APPDb/).Certified plant origin antibacterial peptide gene quantity is few
Main cause is as follows:1st, antibacterial peptide gene is relatively small, easily degraded, and content is low, it is difficult to detection and identification;2nd, antibacterial peptide
Molecular weight is small, isolates and purifies difficulty, and extraction step is loaded down with trivial details, yield is low;3rd, vivoexpression purification difficult, cause to be difficult to carry out in vitro
Bacteriostatic activity detection carrys out authentication function;4th, efficient prediction screening technique is lacked;5th, antibacterial peptide chemical synthesis cost is high, and price is held high
It is expensive.How tool functional new plant antibacterial peptide is efficiently predicted, realizing its horizontal expression and reducing cost turns into current antibacterial
Peptide studies the bottleneck with application.
By present invention applicant Inst. of Oil Crops, Chinese Academy of Agriculture be responsible for, vegetables institute of the Chinese Academy of Agricultural Sciences, Shenzhen
Hua Da gene studies institute, Hua Zhong Agriculture University, Hunan University, Agricultural University Of Southwest, Jiangsu academy of agricultural sciences, Sichuan academy of agricultural sciences, Qinghai
University, and absorb English, Australia, U.S., Fa Deng states related research institutes scientific research personnel cooperate to complete the full-length genome of wild cabbage and rape
Sequencing and analysis, wild cabbage and rapeseed gene group partial results paper have delivered (Shengyi Liu, Yumei Liu, Xinhua
Yang,Ch aobo Tong,David Edwards,Isobel A.P.Parkin,Meixia Zhao,Jianxin Ma,
Jingyin Yu,Shu nmou Huang,Xiyin Wang,Junyi Wang,Kun Lu,Zhiyuan Fang,Ian
Bancroft,Tae-Jin Yan g,Qiong Hu,XinfaWang,Zhen Yue,Haojie Li,Linfeng Yang,
Jian Wu,Qing Zhou,Wa nxin Wang,Graham J.King,J.Chris Pires,Changxin Lu,
ZhangyanWu,Perumal Sampath,ZhuoWang,Hui Guo,Shengkai Pan,Limei Yang,Jiumeng
Min,Dong Zhang,Dianchuan J in,Wanshun Li,Harry Belcram,Jinxing Tu,Mei Guan,
Cunkou Qi18,Dezhi Du1,Jiana Li,Liangcai Jiang,Jacqueline Batley,Andrew
G.Sharpe,Beom-Seok Park,Pradeep Ruperao,Feng Cheng,Nomar Espinosa Waminal Yin
Huang,Caihua Dong,LiWang,Jingping Li,Z hiyong Hu,Mu Zhuang,Yi Huang,Junyan
Huang,Jiaqin Shi,Desheng Mei,Jing Liu,T ae-Ho Lee,Jinpeng Wang,Huizhe Jin,
Zaiyun Li,Xun Li,Jiefu Zhang,Lu Xiao,Yongmi ng Zhou,Zhongsong Liu,Xuequn Liu,
Rui Qin,Xu Tang,Wenbin Liu,YupengWang,Yang yong Zhang,Jonghoon Lee,Hyun Hee
Kim,France Denoeud,Xun Xu,Xinming Liang,Wei Hua,Xiaowu Wang,Jun Wang,Boulos
Chalhoub&Andrew H.Paterson.The Bras sica oleracea genome reveals the
asymmetrical evolution of polyploid genomes.2014.Natu re Communication.5:
3930.;Chalhoub B,Denoeud F,Liu S,Parkin IA,Tang H5,Wang X,Chiquet J,etc.Plant
genetics.Early allopolyploid evolution in the post-Neolithic Brassic a napus
oilseed genome.Science.2014,22;345(6199):950-3.).Chinese cabbage, wild cabbage and the full base of cabbage type rape
Because group sequencing information has built up the database http for being available for applicant to inquire about://www.ocri-genomicls.org/
bolbase(C heng F,Liu S,Wu J,Fang L,Sun S,Liu B,Li P,Hua W,Wang X:BRAD.the
genetic s and genomics database for brassica plants.BMC Plant Biol,2011,11:
136;Jingyin Yu,Meixia Zhao,Xiaowu Wang,Chaobo Tong,Shunmou Huang,Sadia
Tehrim,Yumei Liu,We i Hua and Shengyi Liu.Bolbase:a comprehensive genomics
database for Brassica oleracea.BMC Genomics,2013,14:664).By using biological information credit
Analysis means, using above-mentioned resource, the prediction and analysis of gene can be carried out, obtaining large batch of and known antibacterial peptide has similar sequence
The pre-selection gene of architectural feature, therefrom screens gene interested, is a quick shortcut for excavating gene.And antibacterial peptide is in itself
Mrna length is small, can utilize the artificial synthesized technologies of PCR, inexpensive Fast back-projection algorithm, it is not necessary to which cDNA sequence does template progress gram
It is grand to wait work, the speed for obtaining antibacterial peptide can be greatly speeded up and reduce research difficulty.
Applicant utilizes cabbage type rape tissue transcript profile sequencing data, develops a potential novel antimicrobial peptide of forecast analysis
The method of gene, obtain antibacterial peptide new gene BnLTP1.The gene is to belong to turn lipoprotein antibacterial peptide (LTPs), this kind of antibacterial
Contain even number cysteine in peptide sequence structure, intramolecular disulfide bond can be formed, so as to play stable antibacterial peptide structure
Effect, LTP plays an important role in plant defense mechanism, it can by pathogenic bacterium inducing overexpression, and pathogen can be suppressed
Growth and Induction of Systemic Resistance of Plant generation (Xie Wanqin, king's Zhe, Li Cuifeng, plant turn lipoprotein disease resistance mechanisms research
Progress, natural science progress.2006,16(8):928-932), experiment shows that its existing antibacterial activity also has antimycotic work
Property.With reference to gene engineering method and utilize a new antibacterial peptide vivoexpression carrier pET30a/ with self cleavage function
His-EDD IE-GFP(Tao Ke,Su Liang,Jin Huang,Han Mao,Jibao Chen,Caihua Dong,
Junyan Huan g,Shengyi Liu,Jianxiong Kang,Dongqi Liu,Xiangdong Ma,A novel PCR-
based method for high throughput prokaryotic expression of antimicrobial
peptide genes.BMC Biotechno l 2012,12:10.), this research realizes BnLTP1 melting in Escherichia coli
Expression, renaturation, self cleavage and purifying are closed, obtains the BnLTP1 protein products with bioactivity.With cylinder-plate method (Jiang Hui hazes
Cylinder-plate method determines the influence factor and control method China veterinary drug magazine .2011, (08) 23-36 of titer of antibodies), with large intestine
Bacillus, the reference culture that Sarcina lutea is Gram-negative bacteria and gram-positive bacteria, the finger of fungi is used as using saccharomycete
Show that bacterium carries out bacteriostatic activity detection to the BnLTP1 albumen of purifying, it is found that BnLTP1 genes can effectively suppress bacterium (Escherichia coli
And Sarcina lutea) and fungi (yeast, sclerotinite, botrytis cinerea, Pyricularia oryzae) growth.This research is to utilize biological information
Means and technique for gene engineering Large scale identification new plant carry out derived antimicrobial peptide and laid a good foundation, there is provided a kind of new approach.This
Outer BnLTP1 can spray the resistance that plant against fungal disease is improved in plant surface as biological reagent, at the same time it can also conduct
One recruit is marked for aiding in breeding for disease resistance, is also used as a new gene source and is used for plant genetic engineering, to cultivate
Disease-resistant transgenic plant.
The content of the invention
The purpose of the present invention is to be the provision of a rape antibacterial peptide having to fungi and bacterium bacteriostatic activity
BnLTP1, its sequence are shown in SEQ ID NO.2.The antibacterial peptide totally 93 nucleotides, 31 amino acid are encoded, wherein 4 half
Cystine forms two intramolecular disulfide bonds, is played an important role for the structure for stablizing antibacterial peptide.The antibacterial peptide can be with
Strengthen resistance of the plant to metatrophy type fungi Sclerotinia sclerotiorum, botrytis cinerea and Pyricularia oryzae.
It is another object of the present invention to provide nucleotide sequence, preferred sequence corresponding to rape cecropin B gene nLTP1
For the nucleotide sequence shown in S EQ ID NO.1 and SEQ ID NO.3.
It is also an object of the present invention to provide the synthetic method of rape cecropin B gene nLTP1 genes, method are simple.
Using DNAWorks Software tools, primer sequence is designed by codon optimization, BnLT is synthesized using Overlap-PCR technologies
P1 gene orders.
Another object of the present invention is to be the provision of rape cecropin B gene nLTP1 preparation method, using CSFV
Protein mutant EDDIE is fusion protein;After inclusion body protein purifying, renaturation, EDDIE is correctly folded again, recovers it certainly
Shear ability, at specific site Cys168 and 169 C-terminal merge antibacterial peptide shear off, so as to obtain do not increase it is any
The antibacterial peptide prod of additional amino acid.
Final object of the present invention is the provision of applications of the rape cecropin B gene nLTP1 in antibacterials are prepared,
The antibacterial peptide can be simultaneously good to Sarcina lutea, Escherichia coli, saccharomycete, sclerotinite, botrytis cinerea and Pyricularia oryzae generation
Good inhibition, and resistance of the plant to metatrophy type fungi Sclerotinia sclerotiorum, botrytis cinerea and Pyricularia oryzae can be strengthened, simultaneously
Biological control and breeding for disease resistance can also be applied to.
In order to complete above-mentioned purpose, the present invention adopts the following technical scheme that:
In order to obtain the present invention, applicant is to rape (cabbage type rape Brassica napus) genome moderate resistance sclerotiniose
Related gene and existing antibacterial peptide database carried out it is deeply comprehensive analyse and compare and prediction, be as a result found that one
New turns lipoprotein antibacterial peptide gene, by being lived after the external synthesis of the gene and induced expression, protein purification
Property analysis, find the gene not only with antibacterial activity also with antifungal activity.The present invention develops an enhancing plant
To the BnLTP1 genes of fungus resistant, the antibacterial peptide of BnLTP1 gene expressions not only there is antibacterium to live in bacteriostatic activity experiment
Property also has antifungal activity (including yeast, sclerotinite, botrytis cinerea and Pyricularia oryzae), imply that the gene in rape antibacterial core
There is suitable application prospect in disease, grey speck of soybean and rice blast breeding.
Rape antibacterial peptide gene BnLTP1 acquisition:
Rape leaf has been carried out in applicant laboratory at present, the express spectra sequencing of silique, obtains a large amount of ESTs data letters
Breath.Simultaneously by Chinese cabbage, wild cabbage and rape and genome sequencing project, their Genomic sequence information storehouse is constructed
(http://www.ocri-genomicls.org/bolbase).Using these sequence informations and special antibacterial peptide database,
Such as ANTIMIC (Brahmachary M, Krishnan SPT, Koh JLY, et al.ANTIMIC:a database of
antimicrobial sequences.Nucleic Acids Research,2004,32:D586-D589, same as below),
APD(Wang Z,Wang GS.APD:the Antimicrobial Peptide Database.Nucleic Acids
Research,2004,32:D590-D592, same as below) APPDB (http://ercbinfo1.ucd.ie/APPDb/, below
It is identical), PhytAMP (H ammami R, Hamida JB, Vergoten G, et al.Phytamp:a database
dedicated to plant antimic robial peptides.Nucleic Acids Res.2009,37:D963-
It is D968, same as below) etc. carry out BLAST comparison (nucleotides similarities>90% i.e. Identity>90%), obtain large batch of
There is the pre-selection gene of similar structures feature with known antibacterial peptide sequence.Then to the protein sequence (Vector of these pre-selection genes
) and secondary structure structure (nnpredict NTI10:ht tp://www.cmpharm.ucsf.edu/nomi/nnpredict
Predictionprotein, same as below) be predicted and analyze, so as to establish protein three-dimensional structure figure, utilize two level knot
Storehouse is built in the classification that structure and function carry out protein families to the antibacterial peptide filtered out, so as to finally obtain potential novel antimicrobial peptide
Gene.Numbering is EV53256, is named as BnLTP1.Gene BnL TP1 nucleotides sequences are classified as shown in SEQ ID NO.3, antibacterial peptide
BnLTP1 amino acid sequence is shown in SEQ ID NO.2.A kind of preparation method of external synthesis rape BnLTP1 genes, step
It is as follows:The codon optimization of rape BnLTP1 genes and external synthesis
According to the DNA sequence dna of BnLTP1 genes, primer sequence is designed, synthetic primer 6 covers drawing for BnLTP1 total lengths altogether
Thing, respectively BnPEV53256_1, BnPEV53256_2, BnPEV53256_3, BnPEV53256_4, backbo neF and
backboneR.Primer sequence is as shown in table 1,
Table 1overlap PCR primer sequences
BnLTP1 full length genes are obtained using Overlap-PCR technologies.PCR reaction systems are as follows:Total reaction system is
50 μ L, are included:10 × Taq buffer (contain MgCl2) 10 μ l, 1.5mmol/L dNTP (10mmol/L) 4 μ l, primer b
AckboneF1 and backboneR respectively adds 1 μ l (concentration 10mmol/L), primer BnPEV53256_1, BnPEV53256_2,
BnPEV53256_3 and BnPEV53256_4 respectively adds 1 μ l (concentration 2mmol/L), Taq (5U/ μ l) 1 μ l, ddH2O 33μl。
Reaction condition be 94 DEG C 5 minutes, 94 DEG C 1 minute, 58 DEG C 1 minute, 72 DEG C 30 seconds 2 minutes, 25 circulations, extend 10 points after 72 DEG C
Clock, amplification size are 116bp.(sequence include sequence shown in SEQ ID NO.1 and with each 10 bases for being matched on carrier.)
The identified sequencing of PCR primer, sequencing are correctly the cecropin B gene nLTP1 genes after optimizing, and its sequence is SEQ
Shown in ID NO.1.
Cecropin B gene nLTP1 preparation method, comprises the following steps:
1) fusion expression vector EDDIE-BnLTP1 structure
Using inverse PCR technique, BnLTP1 genes are connected on expression vector pET30a/His-EDDIE-GFP.Specifically
To utilize 30abackbone-F:TGAGATCCGGCTGCTAACAAAGCCC and 30abackbone-R:
GCAGCTGGTCACCCACAGCG primers, by Inverse PCR amplification, by pET30a/His-EDDIE-GFP vector linearizations.Will
The pET30a/His-EDDIE-GFP linearized vectors fragment being recovered to and the BnL obtained by Overlap-PCR amplification recovery
TP1 full length DNA fragments, while Escherichia coli XL10-Gold bacterial strains are converted, by pinpointing homologous recombination in vivo, by BnLTP1 bases
Because being connected on expression vector pET30a/His-EDDIE-GFP, target gene fusion expression vector EDDIE-BnLTP1 is obtained.
2) the external evoked expression of cecropin B gene nLTP1 is with isolating and purifying
Correct fusion expression vector EDDIE-BnLTP1 plasmids will be sequenced, BL21 (DE3) competence is transformed into heat shock method
In cell, EDDIE-BnLTP1 amalgamation and expression engineering bacteria BL21 (DE3)/pETNB is obtained.Using usual manner in LB Liquid Cultures
Culture and inducible protein expression in base, the bacterial cell disruption centrifugation of acquisition, supernatant after purification, produce destination protein antibacterial peptide
BnLTP1, its sequence are shown in SEQ ID NO.2.
Applications of the rape cecropin B gene nLTP1 in antibacterials are prepared, including the antibacterial peptide is directly prepared into antimicrobial
Thing, all there is stronger bacteriostatic activity to bacterium and fungi;The antibacterial of plant can be strengthened on plant leaf blade surface by being sprayed
Property, plant is particularly improved to the resistance to fungal diseases such as sclerotinite, botrytis cinerea, Pyricularia oryzaes, and BnLTP1 genes are utilized
The means of molecular biology are overexpressed in rape or other plant, and preparing can the antimycotic and genetically modified plants of bacterium.
The present invention compared with prior art, has advantages below and effect:
1. the present invention using Chinese cabbage, wild cabbage and rape and the sequence information of genome sequencing and transcript profile sequencing data with
Special antibacterial peptide database is compared and predicted classification analysis, successfully obtains one and new turns lipoprotein antibacterial peptide
LTPs-Bn LTP1.To be established using bioinformatics means and technique for gene engineering Large scale identification new plant derived antimicrobial peptide
A kind of basis, there is provided new approach.
2. utilizing Overlap-PCR technologies artificial synthesized gene in vitro, the technology for obtaining BnLTP1 is greatly reduced
Difficulty and cost.
3. to solve the problems of antibacterial peptide heterogenous expression, present invention employs a kind of new amalgamation and expression antibacterial peptide
Method, use CSFV protein mutant EDDIE as fusion protein, with inclusion bodies in e. coli bl21 efficient table
Up to antibacterial peptide, to reduce toxic action of the antibacterial peptide to host.After inclusion body protein purifying, renaturation, EDDIE correctly rolls over again
It is folded, recover its self cleavage ability, the antibacterial peptide that C-terminal merges is shear off at specific site Cys168 and 169, so as to obtain
The antibacterial peptide prod of any additional amino acid is not increased.This method need not add any chemical substance and enzyme to remove fusion mark
Label, non-toxic to host, purge process is simple, and antibacterial activity of the detection to pathogen, highest goal can be used directly to after shearing
Yield can reach 12g/L.
4. cylinder-plate method and blade surface, which spray inoculation test result, shows that the cecropin B gene nLTP1 of Prokaryotic expression, purification can
Effectively to suppress bacterium and sclerotinite, the growth of three kinds of disease funguses of botrytis cinerea and Pyricularia oryzae, plant can be effectively improved to it
Resistance.
5. because BnLTP1 gene sources are in rape, it is also used as the choosing that resistance marker is used for rape disease-resistant variety
Educate, or be used for transgenic breeding as the candidate gene of genetic engineering.
Brief description of the drawings
Fig. 1 is expression vector pET30a/His-EDDIE-GFP ideographs.
Fig. 2 is cecropin B gene nLTP1 three dimensional structure simulation figures.
Fig. 3 is EDDIE-BnLTP1 vector constructions agarose gel electrophoresis detection figure.
A in Fig. 3:The Ago-Gel detection of overlap PCR synthesis BnLTP1 genes;M:100bp DNA Marker;
1-2:Overlap PCR synthesize BnLTP1 genes;
B in Fig. 3:Expression vector EDDIE-BnLTP1 electrophoresis detections;M:1kb DNA Marker;1:Recombinant vector
pET30a-EDDIE-BnP;2:Empty carrier pET30a/His-EDDIE-GFP;
C in Fig. 3:BnLTP1 gene PCRs detect;M:DL2000DNA Marker;1:Positive control;2:Negative control;3-
5:BnLTP1 recons.
The expression and purification SDS-PAGE electrophoresis detections of Fig. 4 BnLTP1 albumen.
A in Fig. 4:The SDS-PAGE analyses of fusion protein EDDIE-BnLTP1 induced expressions;M:Small molecular weight protein Mark
er;0:Compare bacterium precipitation, 1-4:EDDIE-BnLTP1 is precipitated.
B in Fig. 4:SDS-PAGE electrophoretic analysis after EDDIE-BnLTP1 renaturation;M:Small molecular weight protein Marker;1,2:
SDS-PAGE analyses in 8 hours after EDDIE-BnLTP1 renaturation.
Fig. 5:BnLTP1 antibacterial peptides are analyzed the bacteriostatic activity of bacterium and fungi;
A:Escherichia coli;B:Sarcina lutea;C:Saccharomycete:Pichia pastoris GS115;D:Sclerotinite;E:Pyricularia oryzae;
F:Botrytis cinerea.0 is control liquid in figure, and 1 is artificial synthetic antimicrobial peptide, and 2 be that vivoexpression purifies antibacterial peptide.
Fig. 6 BnLTP1 antibacterial peptide cole in vitro leaf is smeared and is followed by bacteriostasis figure after kind of sclerotinite.
First row:The blade smeared by cecropin B gene nLTP1;
Second row:Undressed normal rape leaf is as control.
Embodiment
According to following examples, the present invention can be better understood from, but described embodiment is to preferably explain this
Invention, rather than limitation of the present invention.Agents useful for same of the present invention if not otherwise specified, derives from commercial channel, the skill
Art scheme, it is the conventional scheme of this area if not otherwise specified.
Embodiment 1:
Rape antibacterial peptide gene BnLTP1 prediction and structural analysis
Utilize the Chinese cabbage of inventor laboratory structure, the genome and transcript profile sequence information number of wild cabbage and cabbage type rape
According to storehouse (h ttp://www.ocri-genomicls.org/bolbase) and special antibacterial peptide database, as ANTIMIC is (preceding
Face is already described), APD (above already described), APPDB (above already described), PhytAMP (above already described) etc. carry out BLAST comparison (nucleotides
Similarity>90% i.e. Identity>90%) the large batch of pre-selection for having similar structures feature with known antibacterial peptide sequence, is obtained
Gene.Then the protein sequence (Vector NTI10) to these pre-selection genes and (above already described) progress of secondary structure structure are pre-
Survey and analyze, so as to establish protein three-dimensional structure figure, egg is carried out to the antibacterial peptide filtered out using secondary structure and function
Storehouse is built in the classification of white matter family, so as to finally obtain the novel antimicrobial peptide gene that numbering is EV53256.It is named as BnLTP1.Bn
The nucleotides sequence of LTP1 genes is classified as shown in SEQ ID NO.3, and cecropin B gene nLTP1 amino acid sequence is SEQ ID NO.2 institutes
Show.
BnLTP1 antibacterial peptides contain 31 amino acid, wherein 4 cysteines form two intramolecular disulfide bonds.Albumen knot
Structure predicts that (above already described) display BnLTP1 secondary structure is mainly presented helical structure (80%) and contains a small amount of random coil
(20%).This protein structure determines that the antibacterium that it is occurred and antimycotic binding mode are mainly destroyed by a kind of
The roller mechanism of cell membrane come have the function that it is antibacterial (Balaji Ramanathan EGD, Christopher R.Ross,
Frank Blecha:Cathelicidins:microbicidal activity,mechanisms of action,and
roles in innate imm unity.Microbes and Infection 2002,4:361-372;Boman HG AB,
Boman A:Mechanisms of action on Escherichia coli of cecropin P1and PR-39,two
antibacterial peptides from pig intestine.Infection and immunity 1993,61:
2978-2984;T.Cabras RL,F.Secundo,G.Noc ca,S.Conti,L.Polonelli:Structural and
functional characterization of the porcine proline–rich antifungal peptide
SP-B isolated from salivary gland granules.Journal of Peptide Sc ience 2008,
14:251-260.).Tertiary structure predictions result shows that BnLTP1 forms 6 αhelix, and wherein N-terminal initially forms company
5 continuous α spirals, the 6th α spiral is formed in C-terminal.The cell membrane that this structure is advantageous to it and bacterium or fungi combine and then
Destroy the integrality (Fig. 2) of cell membrane.
Embodiment 2:
The codon optimization of rape BnLTP1 genes and external synthesis
Due to antibacterial peptide, existence time is short in vivo, it is difficult to catches, the round pcr with routine is difficult from rape cDNA
Middle amplification, and whole antibacterial peptide is all artificial synthesized then expensive.In order to reduce the cost for obtaining antibacterial peptide, root of the present invention
According to the DNA sequence dna according to BnLTP1 genes, DNAWorks Software tools (http is utilized://mcl1.ncifcrf.gov/dnawo
Rks/, Hu F, Ke T, Li X, Mao PH, Jin X, Hui FL, Ma XD, Ma LX.Expression and Purif
ication of an Antimicrobial Peptide by fusion with elastin-like polypeptides
in Escherichia coli.Appl Biochem Biotechnol.2010,160(8):2377-87), it is excellent by codon
Change (Ke T, Liang S, Huang J, Mao H, Chen J, Dong C, Liu S, Kang J, Liu D, Ma X:A novel
PCR-based m ethod for high throughput prokaryotic expression of antimicrobial
peptide genes.BMC Biot echnol 2012,12:10.) primer sequence is designed, altogether 6 coverings of synthetic primer
The primer (the handsome company's synthetic primer in Shanghai) of BnLTP1 total lengths, respectively BnPEV53256_1, BnPEV53256_2,
BnPEV53256_3, BnPEV53256_4, backboneF and backboneR.Primer sequence is as shown in table 1, and boldface represents
With carrier pET30a/His-EDDI E-GFP (carrier be this laboratory with reference to Ke Tao documents it is built-up, Ke T, Liang S,
Huang J,Mao H,Chen J,Dong C,Liu S,Kang J,Liu D,Ma X:A novel PCR-based method
for high throughpu t prokaryotic expression of antimicrobial peptide
genes.BMC Biotechnol 2012,12:10.) homologous part, remaining is gene-specific primer.Using Overlap-
Round pcr (Zhu D, Zhong X, Tan R, Che n L, Huang G, Li J, Sun X, Xu L, Chen J, Ou Y, Zhang
T,Yuan D,Zhang Z,Shu W,Ma L:High-throughput cloning ofhuman liver complete
open reading frames using homolo gousrecombination in Escherichia coli.Anal
Biochem 2010,397(2):162-167) obtain BnLTP1 full length genes.
PCR reaction systems are as follows:Primer is that total reaction system is 50 μ L, is included shown in table 1:10×Taq buffer
(contain MgCl2) 1 μ l of each additions of 10 μ l, 1.5mmol/L dNTP (10mmol/L) 4 μ l, primer backboneF1 and backboneR
(concentration 10mmol/L), primer BnPEV53256_1, BnPEV53256_2, BnPEV53256_3 and B nPEV53256_4 are each
Add 1 μ l (concentration 2mmol/L), Taq (5U/ μ l) 1 μ l, ddH2O 33μl.Reaction condition be 94 DEG C 5 minutes, 94 DEG C 1 point
Clock, 58 DEG C 1 minute, 72 DEG C 30 seconds 2 minutes, 25 circulations, extend 10 minutes after 72 DEG C, amplification size is 116bp (Fig. 3).PCR
Product detects through 1.0% agarose gel electrophoresis, after Gel Extraction kit recovery, is connected to pMD18-T carriers, heat shock
Method converts the competent cell of XL10-Gold bacterial strains, is coated on the LB solid medium flat boards containing the μ g/mL of ampicillin 50
On, 37 DEG C of overnight incubations, hickie 6 is selected, using M13 primers:5 ' TGTAAAACGACGGCCAGT3 ' and 5
' CAGGAAACAGCTATGACC3 ', do bacterium colony PCR detections.Amplified production size is 200bp, and 1.0% agarose gel electrophoresis is examined
After survey size is correct.The correct bacterial plaque of PCR detected magnitudes is inoculated into the LB liquid medium of the μ g/mL containing ampicillin 50,
200r/min shaken cultivations are stayed overnight at 37 DEG C, a small amount of alkalinity extraction plasmids, and 1.0% agarose gel electrophoresis detection DNA is big
Small correct rear (for 400bp), double digestion is carried out to plasmid using Kpn I/BamH I digestions, 37 DEG C overnight, and 1.0% agarose coagulates
Gel electrophoresis detect.Correct Positive recombinant clones will be detected and be named as pMD18-BnLTP1, pMD18-BnLTP1 is served into Hai Ying
Fine horse company is sequenced, analysis result, and the cecropin B gene nLTP1 full length gene sequences after being optimized, its sequence is SEQ ID
Shown in NO.1.
Embodiment 3:Fusion expression vector EDDIE-BnLTP1 structure
The method reported according to Ke Tao, using inverse PCR technique, expression vector pET30a/ is connected to by BnLTP1 genes
On His-EDDIE-GFP.Utilize 30abackbone-F:TGAGATCCGGCTGCTAACAAAGCCC and 30abackbon e-R:
GCAGCTGGTCACCCACAGCG primers, by Inverse PCR amplification, by pET30a/His-EDDIE-GF P vector linearizations.Tool
Precursor reactant system is as follows:Using 50 μ L systems, the wherein μ l of pET30a/His-EDDIE-GFP plasmids 1 (50ng/ μ l) are template mould
Plate, 10 × Taq buffer (contain MgCl2) 5 μ l, 1.5mmol/L dNTP (10mmol/L) 4 μ l, 5 ' primer 30abackbone-R
2 μ l (10 μm of ol/L), the μ l of 3 ' primer 30abackbone-F 2 (10 μm of ol/L), Taq enzyme (5U/ μ l) 1 μ l, ddH2O 31μl.Instead
Answer the condition to be 5 minutes at 94 DEG C, 94 DEG C 30 minutes, 60 DEG C 30 seconds, 72 DEG C 6 minutes, 25 circulations, extend 10 minutes after 72 DEG C,
PCR primer size is 6kb.After 1.0% agarose gel electrophoresis detected magnitude is correct, 6kb is reclaimed with gel reclaims kit
Large fragment.Overlap- will be passed through in the pET30a/His-EDDIE-GFP linearized vectors fragment being recovered to and embodiment two
The BnLTP1 full length DNA fragments that PCR amplification recovery obtains, while convert Escherichia coli XL10-Gold bacterial strains and (be purchased from
Strategene companies), by pinpointing homologous recombination in vivo, BnLTP1 genes are connected to expression vector pET30a/His-
On EDDIE-GFP.Specific method is as follows:According to pET30a/His-EDDIE-GFP linearized vector fragments:50ng BnLTP1
Full length DNA fragment=3:1 ratio biased sample, with heat shock method convert XL10-Gold bacterial strains competent cell after, containing
Screened on the solid LB media flat board of kanamycins (50 μ g/mL), utilize the GFP green fluorescent protein marks of (Fig. 1) on carrier
Label screen non-luminous positive colony under ultraviolet light, extract plasmid, through 1.0% agarose gel electrophoresis detected magnitude just
Really (B in Fig. 3), serve the sequencing of Hai Ying fine horses biotech firm.Sequence is correctly purpose gene fusion expression carrier after sequencing
EDDIE-BnLTP1。
Embodiment 4:
The external evoked expression of cecropin B gene nLTP1 is with isolating and purifying
Correct fusion expression vector EDDIE-BnLTP1 plasmids will be sequenced, BL21 (DE3) impressions are transformed into heat shock method
In state cell, EDDIE-BnLTP1 amalgamation and expression engineering bacteria BL21 (DE3)/pETNB is obtained.Bacterium solution is drawn 5 μ l and existed after converting
In the flat lining out of solid LB media containing kanamycins (50 μ g/mL), 37 degree of cultures resist after 24 hours from kanamycins
Picking chooses single bacterium colony on mild-natured plate.The single bacterium colony of picking is inoculated in the LB of 10 milliliters final concentration of (50ug/mL kanamycins)
In nutrient solution, stayed overnight in 37 DEG C of shaken cultivations, with 1:100 ratio is forwarded in 1000 milliliters of LB fluid nutrient mediums, and 37 DEG C are shaken
Culture 3 hours or so is swung, when absorbance value is 0.6 or so under 600nm with spectrophotometer detection LB fluid nutrient mediums, upper
State the IPTG that final concentration of 1mM is added in LB fluid nutrient mediums.Concussion continues to cultivate 6h progress induced expressions at 37 DEG C, uses platform
Formula centrifuge (above already described) with 5000r/min centrifugation 15min, outwells supernatant at room temperature, collects bacterial sediment.
By the thalline that upper step is collected with bacterium buffer solution is broken, ultrasonic cell disruptor carrying out ultrasonic bacteria breaking 5min is used under ice bath,
Then 15min is centrifuged with 5000r/min rotating speed with centrifuge under the conditions of 4 DEG C, collects inclusion body precipitation.Inclusion body is precipitated
Cleaned twice under the conditions of 4 DEG C with 10 milliliters of lavation buffer solutions, 2 minutes every time.With centrifuge with 12000r/ under the conditions of 4 DEG C
Min rotating speeds centrifuge 20min, collect precipitation again.With the expression (figure of destination protein in SDS-PAGE electrophoresis detection inclusion bodys
4).The result of (A) shows after IPTG inducing action 8 hours in Fig. 4, BnLTP1 great expressions in inclusion body precipitation.
With volume ratio 1:The inclusion body collected above precipitation is dissolved in urea-denatured buffer solution by 10 ratio, at room temperature
Shaken 2 hours with oscillator, 20min is centrifuged with 12000r/min rotating speeds with centrifuge in 4 DEG C, takes supernatant.Take 1ml Ni-NTA
Ago-Gel prepacked column, add 10ml equilibration buffers and balance prepacked column at room temperature 30 minutes, with 5000r/min
Speed in 4 DEG C with centrifuge 5min, remove the solution under, collect prepacked column.Then inclusion body protein supernatant is taken
10ml samples with 0.5ml/min speed loading into Ni-NTA Ago-Gel prepacked columns, with 2 milliliters of centrifuge tubes be in charge of by lower section
The solution flowed down in prepacked column is collected, often pipe collects 2 milliliters.Then washed with 15ml lavation buffer solutions with 1-2ml/min flow velocity
Remove unadsorbed sample.Lower section is in charge of the solution collected and flowed down in prepacked column with 2 milliliters of centrifuge tubes, and often pipe collects 2 milliliters.Then
The EDDIE-BnLTP1 fusion proteins specifically bound with 5ml elution buffers with 1-2ml/min flow velocity elution with Ni-NTA,
Lower section is in charge of the solution collected and flowed down in prepacked column with 2 milliliters of centrifuge tubes, and often pipe collects 2 milliliters.Finally use 5ml level pads
Pillar is balanced, adds 1 milliliter of 20% ethanol in case next time uses.By all solution of collection SDS-PAGE electrophoresis detection purposes
The content and purity of albumen, take purity best, and the pipe of concentration highest one does renaturation experiment (sample of swimming lane 4 in A in Fig. 4).
2 milliliters of the protein solution of swimming lane 4 in best Fig. 4 A after step electrophoresis detection is taken, rapidly joins 100 milliliters of renaturation
Buffer solution, placed 6 hours in room temperature, Tricine-SDS-PAGE electrophoresis detection fusion proteins EDDIE-BnLTP1 self cleavage effect
Fruit, as a result as shown in B in Fig. 4:Obtain fusion protein occur it is remaining without any additional amino acid after self cleavage
BnLTP1 antibacterial peptides.The protein content of antibacterial peptide after renaturation, concentration 12mg/ml are determined using Nanodrop-2000.
Embodiment 5:
BnLTP1 antibacterial peptide Antibacterial Activities
Represented respectively with Sarcina lutea (Micrococcus luteus) for gram-positive bacteria, Escherichia coli
(Escherichia coli) represents for Gram-negative bacteria, and saccharomycete (Pichia pastoris GS115) is as fungi
Indicator bacteria, the standard method using cylinder-plate method as detection cecropin B gene nLTP1 bacteriostatic activities.
Specific method is as follows:The artificial purifying that 200 microlitres of concentration are about 3 milligrams every milliliter is added in each Oxford cup
Good cecropin B gene nLTP1 solution or the cecropin B gene nLTP1 solution of chemical synthesis, cultivated under 37 degree of environment 12-16 small
Shi Hou, the antibacterial activity of BnLTP1 antibacterial peptides is calculated by determining inhibition zone size.Altogether carry out 3 times experiment, test every time into
3 technologies of row repeat.
As a result as shown in (a) and table 2 in Fig. 5, Oxford cup and artificial synthetic antimicrobial peptide added with expression and purification antibacterial peptide
All occur big inhibition zone around Oxford cup, and control section does not have obvious inhibition zone to occur.Vivoexpression purifies antibacterial peptide
BnLTP1 more than 1 centimetre, shows height to the average antibacterial circle diameter of Escherichia coli, Sarcina lutea and Pichia pastoris
The bacteriostasis of effect.
Inventor is also to BnLTP1 antibacterial peptides to sclerotinite (Sclerotinia sclerotiorum), botrytis cinerea
The bacteriostatic activity of (Botrytis cine rea) and Pyricularia oryzae (Pyricularia oryzae) three kinds of plant pathogenic fungis
Identified.Intact sclerotinite sclerotium is selected, it is first alcohol-pickled 1 minute with 10 milliliter 75%, then with 10 milliliter 0.1%
HgCl2Middle soaking disinfection 8-10 minutes, then with flushing 3-5 times of 10 milliliters of sterilized water.Sterilizing sclerotium is cut both ends, pars intermedia
Mung bean size is cut into, section down, is inoculated in PDA plate.Usual every sclerotium connects a plate, is once inoculated with 8-9 plates.In 22 DEG C
Quiescent culture 3-4 days, when mycelia will be paved with flat board, useCard punch punches along mycelia outer rim, takes mycelia block, is used for
It is inoculated with again.The mycelia block taken out with card punch is placed in middle position on a new PDA plate, makes one containing mycelia
Face contacts PDA planes.
The mycelia block of botrytis cinerea and Pyricularia oryzae is separately immersed in 50% glycerite, is stored in -80 DEG C of ultralow temperature ices
Case.The mycelia block of preservation can be cultivated directly on PDA plate.Botrytis cinerea needs 22 DEG C to cultivate about 48 hours and Pyricularia oryzae
Need 26 DEG C to cultivate 48 hours, when mycelia extends to about 1cm, equally respectively place an Oxford cup up and down in mycelia block,
Artificial purified antibacterial peptide or the antibacterial peptide (effect for the antibacterial peptide that two methods obtain is identical) of chemical synthesis are separately added into,
Renaturation solution is as control.Continue culture 48 hours, observe bacteriostatic activity situation.As a result as shown in figure 5, compared with the control, added with
Fungal hyphal growth is prevented around the Oxford cup of antibacterial peptide, can not cross Oxford cup, and control section mycelia then can be suitable
Profit crosses the edge that Oxford cup reaches culture dish.Cecropin B gene nLTP1 bacteriostatic diameter and the result of calculation of bacteriostasis rate are shown in Table 2.Knot
Fruit show vivoexpression purifying cecropin B gene nLTP1 almost can completely and nuclear fungal hyphae growth (Fig. 5 D), to grey mold
Bacterium and Pyricularia oryzae also have good fungistatic effect, more than 90% (Fig. 5 E, F).
The vivoexpression of table 2 purifies cecropin B gene nLTP1 bacteriostatic activities
Embodiment 6:
Application of the BnLTP1 antibacterial peptides in plant disease-resistant
In order to detect potentiality of the cecropin B gene nLTP1 as resistance of the biological prevention and control agent for improving plant against fungal disease, hair
A person of good sense sprays certain density artificial expression and purification antibacterial peptide solution, then inoculation in plant (arabidopsis, rape) blade surface
Above-mentioned three kinds of disease funguses, Lesion size is determined after 36 hours.Concrete mode is as follows:
The Arabidopsis leaf and 5 leaf phase rape leafs of growth 5 weeks are taken, uniformly smearing one layer of concentration in blade surface is
5ng/ μ l labor statements reach cecropin B gene nLTP1 after purification.According to method described in embodiment 5, cultivated respectively on PDA plate
Sclerotinite, botrytis cinerea and Pyricularia oryzae mycelia, when mycelia will be paved with flat board, useCard punch punches along mycelia outer rim,
Mycelia block is taken, is inoculated with for rape leaf, is usedCard punch punches along mycelia outer rim, mycelia block is taken, for Arabidopsis leaf
Inoculation.The mycelia block that card punch takes out is placed in arabidopsis and rape leaf middle with syringe needle, made containing mycelia
Simultaneously contact blade surface.The also same inoculation according to the method described above on the arabidopsis and rape leaf for not smearing antibacterial peptide simultaneously
As control, it is susceptible to cultivate observation in 36 hours soon under the conditions of 22 DEG C, humidity 90% for sclerotinite, botrytis cinerea and Pyricularia oryzae mycelia
Situation, and determine the Lesion size on each blade.As a result such as Fig. 6 and table 3, shown in table 4, the Arabidopsis leaf of antibacterial peptide is smeared
With rape leaf compared with the arabidopsis and rape leaf do not smeared, inoculation sclerotinite, botrytis cinerea and Pyricularia oryzae are after 36 hours
Lesion area be all substantially reduced.Such as without cecropin B gene nLTP1 Arabidopsis leafs inoculation sclerotinite is smeared, after 36 hours bacterial plaque face
Product expands to 3.04cm2, and the average bacterial plaque area for smearing cecropin B gene nLTP1 Arabidopsis leafs is 0.62cm2, only compare leaf
The 20% of piece bacterial plaque area.Bacterial plaque area equally after rape leaf surface smear cecropin B gene nLTP1 is followed by bacterium 36 hours
18% or so only compareed.Illustrate the expansion that sclerotinite is effectively inhibited in arabidopsis and rape leave surface smear antibacterial peptide
Exhibition, improves resistance of the plant to sclerotinite.Botrytis cinerea and the inoculation test of Rhizoctonia solani Kuhn also obtain similar result (table 3,
Table 4).Pole significant difference is presented.This explanation plant leaf blade spray cecropin B gene nLTP1 significantly inhibit sclerotinite, botrytis cinerea,
The effect of diffusion is infected with Pyricularia oryzae, effectively raises resistance of the plant to these three disease funguses.
Lesion area (unit after the Arabidopsis leaf of table 3 is inoculated with 36 hours:cm2)
Numbering | Control | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 |
Sclerotinite | 3.04 | 0.55 | 0.65 | 0.58 | 0.49 | 0.67 | 0.6 | 0.7 | 0.72 |
Botrytis cinerea | 4.86 | 0.95 | 1.17 | 1.36 | 1.05 | 1.38 | 1.20 | 1.11 | 1.22 |
Pyricularia oryzae | 2.75 | 0.56 | 0.76 | 0.722 | 0.65 | 0.79 | 0.44 | 0.61 | 0.72 |
Lesion area (unit after the rape leaf of table 4 is inoculated with 36 hours:cm2)
Numbering | Control | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 |
Sclerotinite | 6.21 | 1.12 | 0.98 | 1.25 | 1.26 | 1.35 | 0.97 | 0.85 | 1.1 |
Botrytis cinerea | 8.89 | 2.59 | 2.67 | 2.65 | 2.87 | 2.98 | 2.96 | 2.98 | 2.49 |
Pyricularia oryzae | 5.24 | 2.05 | 2.14 | 2.03 | 2.01 | 2.23 | 2.14 | 2.18 | 1.94 |
The bacteriostatic activity testing result of the present invention shows BnLTP1 to bacterium (Escherichia coli, Sarcina lutea) fungi
(saccharomycete, sclerotinite, botrytis cinerea, Pyricularia oryzae) all has stronger bacteriostatic activity.Excised leaf, which is smeared, meets bacterium experiment confirmation B
NLTP1 can strengthen plant to metatrophy type fungi:Sclerotinite, botrytis cinerea, the resistance of Pyricularia oryzae.BnLTP1 being capable of conduct
Biological prevention and control agent is used in the preventing and treating of sclerotiniose, gray mold and rice blast.BnLTP1 expression can be improved by technique for gene engineering
Level can strengthen resistance of the plant to sclerotinite, botrytis cinerea and Pyricularia oryzae, can also resist as resistance marker for rape
The seed selection of sick kind.
SEQUENCE LISTING
<110>Inst. of Oil Crops, Chinese Academy of Agriculture
<120>A kind of rape cecropin B gene nLTP1 and its application
<130>A kind of rape cecropin B gene nLTP1 and its application
<160> 9
<170> PatentIn version 3.1
<210> 1
<211> 96
<212> DNA
<213>Artificial sequence
<400> 1
atggcgctga cctgcggcac cgtgaacagc aatgtggcgc cgtgcattgg ctatattacc 60
caggggggac cgctgcccgg agcgtgctgc accggc 96
<210> 2
<211> 31
<212> PRT
<213>Rape
<400> 2
Ala Leu Thr Cys Gly Thr Val Asn Ser Asn Val Ala Pro Cys Ile Gly
1 5 10 15
Tyr Ile Thr Gln Gly Gly Pro Leu Pro Gly Ala Cys Cys Thr Gly
20 25 30
<210> 3
<211> 93
<212> DNA
<213>Rape
<400> 3
gctctgacct gtggcaccgt taacagcaac gtggcaccgt gcattggcta cataacccaa 60
ggtggaaccc ttcccggagc gtgctgcacc ggt 93
<210> 4
<211> 48
<212> DNA
<213>Artificial sequence
<400> 4
cgctgtgggt gaccagctgc ggcgctgacc tgcggcaccg tgaacagc 48
<210> 5
<211> 54
<212> DNA
<213>Artificial sequence
<400> 5
cccccctggg taatatagcc aatgcacggc gccacattgc tgttcacggt gccg 54
<210> 6
<211> 54
<212> DNA
<213>Artificial sequence
<400> 6
ggctatatta cccagggggg accgctgccc ggagcgtgct gcaccggcta aagc 54
<210> 7
<211> 54
<212> DNA
<213>Artificial sequence
<400> 7
gggctttgtt agcagccgga tctcagctat tcagtttgct ttagccggtg cagc 54
<210> 8
<211> 25
<212> DNA
<213>Artificial sequence
<400> 8
tgagatccgg ctgctaacaa agccc 25
<210> 9
<211> 20
<212> DNA
<213>Artificial sequence
<400> 9
gcagctggtc acccacagcg 20
Claims (10)
1. a kind of protein of separation, its sequence is shown in SEQ ID NO.2.
2. gene corresponding to the protein described in claim 1.
3. gene according to claim 2, its sequence is shown in SEQ ID NO.1.
4. gene according to claim 2, its sequence is shown in SEQ ID NO.3.
5. application of the gene described in protein or claim 2 in antibacterials are prepared described in claim 1.
6. application according to claim 5, it is characterised in that described antibacterials are anti-sclerotinite medicine, anti-grey mold
Bacterium medicine, resisting rice blast bacteria medicine, anti-Escherichia coli medicine, anti-Sarcina lutea medicine or anti-Pichia pastoris medicine.
7. the gene described in protein or claim 2 described in claim 1 resists in enhancing plant to metatrophy type fungi
The application of property, described fungi is sclerotinite, botrytis cinerea or Pyricularia oryzae.
8. the preparation method of albumen described in claim 1, comprises the following steps:
1)Fusion expression vector EDDIE-BnLTP1 structure
Utilize 30abackbone-F:TGAGATCCGGCTGCTAACAAAGCCC and 30abackbone-R:
GCAGCTGGTCACCCACAGCG primers, by Inverse PCR amplification, by pET30a/His-EDDIE-GFP vector linearizations;Will
The pET30a/His-EDDIE-GFP linearized vectors fragment being recovered to and the nucleotide sequence shown in SEQ ID NO.1, simultaneously
Escherichia coli XL10-Gold bacterial strains are converted, will by pinpointing homologous recombination in vivoBnLTP1Gene is connected to expression vectorpET30a/His-EDDIE-GFPOn, obtain target gene fusion expression vector EDDIE-BnLTP1;
2)The external evoked expression of cecropin B gene nLTP1 is with isolating and purifying
Correct fusion expression vector EDDIE-BnLTP1 plasmids will be sequenced, be transformed into heat shock methodBL21(DE3)Competent cell
In, obtain EDDIE-BnLTP1 amalgamation and expression engineering bacteriasBL21(DE3)/pETNB;Using usual manner in LB fluid nutrient mediums
Cultivate and inducible protein expression, the bacterial cell disruption centrifugation of acquisition, supernatant after purification, produce destination protein cecropin B gene nLTP1, its
Sequence is shown in SEQ ID NO.2.
9. the gene described in protein or claim 2 described in claim 1 is preparing while is suppressing Sarcina lutea, greatly
Application in enterobacteria, saccharomycete, sclerotinite, botrytis cinerea and Pyricularia oryzae medicine.
10. utilize the primer of gene order described in overlap PCR methods synthesis claim 3:
BnPEV53256_1:CGCTGTGGGTGACCAGCTGCGGCGCTGACCTGCGGCACCGTGAACAGC;
BnPEV53256_2:CCCCCCTGGGTAATATAGCCAATGCACGGCGCCACATTGCTGTTCACGGTGCCG;
BnPEV53256_3:GGCTATATTACCCAGGGGGGACCGCTGCCCGGAGCGTGCTGCACCGGCTAAAGC;
BnPEV53256_4:GGGCTTTGTTAGCAGCCGGATCTCAGCTATTCAGTTTGCTTTAGCCGGTGCAGC;
backboneF:TGAGATCCGGCTGCTAACAAAGCCC;
backboneR:GCAGCTGGTCACCCACAGCG.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510050902.0A CN104530205B (en) | 2015-01-30 | 2015-01-30 | A kind of rape cecropin B gene nLTP1 and its application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510050902.0A CN104530205B (en) | 2015-01-30 | 2015-01-30 | A kind of rape cecropin B gene nLTP1 and its application |
Publications (2)
Publication Number | Publication Date |
---|---|
CN104530205A CN104530205A (en) | 2015-04-22 |
CN104530205B true CN104530205B (en) | 2017-12-01 |
Family
ID=52845868
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510050902.0A Active CN104530205B (en) | 2015-01-30 | 2015-01-30 | A kind of rape cecropin B gene nLTP1 and its application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104530205B (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103710370A (en) * | 2013-08-13 | 2014-04-09 | 浙江省农业科学院 | Method for increasing transgene plant disease resistance by using antibacterial peptide fusion expression |
-
2015
- 2015-01-30 CN CN201510050902.0A patent/CN104530205B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103710370A (en) * | 2013-08-13 | 2014-04-09 | 浙江省农业科学院 | Method for increasing transgene plant disease resistance by using antibacterial peptide fusion expression |
Non-Patent Citations (1)
Title |
---|
抗菌肽基因BnPCD842895克隆表达及活性检测;黄金等;《中国油料作物学报》;20130829;第35卷(第4期);第358页左栏第1-2段,第358页右栏第1.3-1.4节,第359页第1.5-1.7节,第361页第2.5节,第362页右栏第4节,图1,表1 * |
Also Published As
Publication number | Publication date |
---|---|
CN104530205A (en) | 2015-04-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101284876B (en) | Fusion protein Penharpin, preparation method and use | |
Hu et al. | Formulations of the endophytic bacterium Bacillus subtilis Tu-100 suppress Sclerotinia sclerotiorum on oilseed rape and improve plant vigor in field trials conducted at separate locations | |
Jingyuan et al. | A novel pepper (Capsicum annuum L.) WRKY gene, CaWRKY30, is involved in pathogen stress responses | |
CN106834336A (en) | A kind of heterogenous expression and purification process of Trichoderma harzianum acid protease P6281 | |
CN105861517A (en) | Panax notoginseng antimicrobial peptide gene PnSN1 and application thereof | |
CN111171123A (en) | Plant immune activation protein PsPII1 and application thereof | |
CN100389124C (en) | Non-inducing expressing gene engineering strain and structural process and application thereof | |
CN104530204B (en) | A kind of rape cecropin B gene nPRP1 and its application | |
EA012569B1 (en) | Insect peptide having antifungal and/or antibacterial activity and methods of using thereof | |
CN108017698B (en) | Garlic antibacterial peptide AR117 and application thereof | |
López et al. | Isolation of a new fungi and wound-induced chitinase class in corms of Crocus sativus | |
CN106244598B (en) | Radix Notoginseng Dirigent albuminoid gene PnDIR1 and application | |
CN104530206B (en) | A kind of rape cecropin B gene nCRP1 and its application | |
CN104530205B (en) | A kind of rape cecropin B gene nLTP1 and its application | |
CN1693468A (en) | High efficiency secretory expression application of plant multifunction activity and broad spectrum resistance cell signal factor Harpin | |
CN110358778A (en) | SlDALR2 gene is improving the application in tomato bacterial leaf spot resistance | |
JP2012246227A (en) | Soilborne disease controlling agent, and method for controlling soilborne disease using the same | |
CN109721646A (en) | A kind of induction enhances rice blast fungus secretory protein and its application of rice rice blast fungus resistance | |
CN109305996A (en) | Fusarium graminearum secreted protein exciton FgHrip1 and its application | |
CN110035662A (en) | Binary insecticidal cry toxins | |
CN106818885A (en) | A kind of acid protease is preparing the application in suppressing cause of disease bacteria preparation | |
CN102408475B (en) | Bt protein Cryt1Da1, and coding gene and application thereof | |
CN112940135A (en) | Fusion protein, amino acid sequence, coding nucleotide sequence, preparation method and application thereof | |
RU2352580C1 (en) | Peptide with antifungal activity | |
CN109134629A (en) | Botrytis cinerea secreted protein exciton BcXyl1 and its application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |