CN104530206B - A kind of rape cecropin B gene nCRP1 and its application - Google Patents
A kind of rape cecropin B gene nCRP1 and its application Download PDFInfo
- Publication number
- CN104530206B CN104530206B CN201510050960.3A CN201510050960A CN104530206B CN 104530206 B CN104530206 B CN 104530206B CN 201510050960 A CN201510050960 A CN 201510050960A CN 104530206 B CN104530206 B CN 104530206B
- Authority
- CN
- China
- Prior art keywords
- gene
- bncrp1
- rape
- antibacterial peptide
- ncrp1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/10—Animals; Substances produced thereby or obtained therefrom
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Agronomy & Crop Science (AREA)
- Pest Control & Pesticides (AREA)
- Virology (AREA)
- Dentistry (AREA)
- Environmental Sciences (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a kind of rape cecropin B gene nCRP1 and its application.The invention provides a kind of rape cecropin B gene nCRP1, its sequence is shown in SEQ ID NO.2.The artificial synthesized of the gene is completed by overlap PCR methods, the antibacterial peptide gene of synthesis is cloned on pET30a/His EDDIE GFP expression vectors and is transformed into Escherichia coli and carries out vivoexpression, obtains the antibacterial peptide prod for not increasing any additional amino acid.Bacteriostatic activity testing result shows that cecropin B gene nCRP1 has stronger bacteriostatic activity to bacterium and fungi.Excised leaf, which is smeared, connects bacterium experiment confirmationBnCRP1Resistance of the plant to metatrophy type fungi Sclerotinia sclerotiorum can be significantly increased.BnCRP1 can be used in the preventing and treating of sclerotiniose as biological prevention and control agent, and the seed selection of rape disease-resistant variety can also be used for as resistance marker.
Description
Technical field
The present invention relates to genetic engineering and biological technical field.More particularly to a kind of rape cecropin B gene nCRP1 and its answer
With.
Background technology
Pathogen can cause the serious plant disease for including the mankind, livestock, crop and other biological, cause serious economic damage
Lose.Plant pathogenic fungi is the important pathogen of plant, can cause more than 80% plant disease (Zhang Fuli, Wang Zhanbin, Wang Zhi
Effect forestry science and technology .2006 of the English chitinases in plant resistance to fungal disease, 31 (3):24-27), world food is caused to make
(Knight S.C., Anthony V.M., Brady A.M., the et al.Rationale and of the thing underproduction about 20%
perspectives on the developmentof fungicides.Annu Rev Phytopathol,1997,35:
349-372).Caused by many important plant diseases are all fungi, such as the late blight of potato, rice blast, wheat powdery mildew, corn
Northern and southern leaf blight bacterium, grey speck of soybean, sclerotinia sclerotiorum etc., very huge economic loss is all caused every year.On the other hand, fungi
During plant is infected, metabolite --- the mycotoxin (mycotoxin) that discharges, to crops and the mankind
Health also result in great harm, such as aflatoxin (aflatoxin).
Sclerotinite (Sclerotinia sclerotiorum) belongs to Ascomycotina, discomycete, Helotiales, sclerotinite
Section, Sclerotinia.It is the global important phytopathogen of a kind of damage to crops and vegetables.Sclerotinite can widely invade
Contaminate many unifacial leaves and dicotyledon.Sclerotiniose caused by sclerotinite is a kind of metatrophy type fungi similar to grey mold,
This destructive pathogeny infects more than 400 kinds plants, widely distributed.The preventing and treating to sclerotiniose relies primarily on chemical pesticide at present,
But not only cost is high, pollution environment for chemical prevention, and preventive effect is also undesirable;Meanwhile the security of food is also by serious
Influence.Rape is one of oil crops important in the world, and sclerotiniose causes the root of rape, rotting for stem and silique, be result in
Huge production loss.Although the agricultural production of sclerotiniose serious threat, plant to the molecular mechanism of the host resistance of sclerotinite,
We still know little about it.Untill up till now it has not been found that completely immune or high anti-rape cultivation kind (Liu, S.,
Wang,H.,Zhang,J.,Fitt,B.D.,Xu,Z.,Evans,N.,Liu,Y.,Yang,W.,and Guo,X.2005.In
vitro mutation and selection of doubled-haploid Brassica napus lines with
improved resistance to Sclerotinia sclerotiorum.Plant Cell Rep.24:133-144), because
This, probes into resistance mechanism of the plant to this pathogeny, it is found that new resistant gene has far reaching significance.
Currently used disease control measure, chemical pesticide is relied primarily on, but not only cost is high, pollution ring for chemical prevention
Border, and preventive effect is also undesirable;Meanwhile the security of food can be also severely impacted.With the development of the society, people are more next
More profoundly recognize and largely use harm of the chemical pesticide to ecological environment and human health for a long time.Biological control can be effective
Ground overcomes these drawbacks, thus biological pesticide is increasingly valued by people.
Antibacterial peptide (antimicrobial peptides, AMPs) is a kind of natural small molecule egg with antibacterial activity
In vain, living nature is widely present in, is the important component of body nospecific immunity, is respectively provided with antibacterial activity in vitro in vivo
(Gordon YJ,Romanowski EG,A Review of Antimicrobial Peptides and Their
Therapeutic Potential as Anti-Infective Drugs.Curr Eye Res.2005,30(7):505–
515).The extensive biological activity of antibacterial peptide, there is very strong suppression to make to bacterial fungus, protozoan, virus and tumour etc.
With, have the advantages that efficiently, environmental protection, do not make pathogen produce drug resistance make it in biological control and medically have it is good should
With prospect (Gordon YJ, Romanowski EG, A Review of Antimicrobial Peptides and Their
Therapeutic Potential as Anti-Infective Drugs.Curr Eye Res.2005,30(7):505–
515).Have become genetic engineering of plant for disease resistance, breeding feed additive, food preservative, emerging medicine and other fields in recent years
Study hotspot, in disease prevention and cure field be antibiotic ideal substitute (Boman HG, Peptide antibiotics
And their role in innateimmunity.Annu Rev Immuno1.1995,13:6l-92).In agricultural production
Cheng Zhong, transmission of the farm antibiotics by food chain can be avoided to threat caused by human body by carrying out plant protection work with antibacterial peptide.
According to amino acid sequence and secondary structure, it has been found that Antimicrobial Peptides From Plants can be divided into plant alexin (plant
Defensins lipoprotein (1ipidtransfer proteins, LTPs), thionin (thionins), ecdysone), are turned
(snakins), hevein class (hevein-like), the plain class that knots (knottin-like peptides), balsamine element
(IbAMP), and newly discovered shepherd's purse plain (shepherdins), cyclic peptide (cyclotides) etc. (Hancock REW,
Chapple DS, Peptide Antibiotics.Antimicrob Agent Chemother, l999,43 (6):l3l7-
l323).Antibacterial peptide is substantially all with some general character, such as:Small-molecular-weight (<10KDa), cationic surface, positive charge and two
Parent's property, these characteristics enable antibacterial peptide and cell membrane to bind and be inserted into cell interior, and most of antibacterial peptide is logical
Cross destruction cell membrane so that target cell death and reach sterilization purpose.And other antibacterial peptides can be by cell membrane
Ion channel enter cell interior destroy cell without destroy cell membrane (Vogel PMHaHJ:Structure–
function relationships of antimicrobial peptides.Biochem Cell Biol 1998,76:
235-246.).Most types of antimicrobial peptide of plant origins does not all have toxicity (Murad to animal and plant cell
AM.Pelegrini PB.Neto SM.Novel Findings of Defensins and their Utilization in
Construction of Transgenic Plants.Transgenic Plant Journal 2001(1):39-48).With
Animal derived antimicrobial peptide is compared, and antimicrobial peptide of plant origins is easier to express and regulate and control in crop, it is not easy to by intracellular protease
Degraded.Compared with other bactericide, the influence of the antibacterial peptide of plant origin to environment is smaller, more friendly, is more developed into resisting
Potentiality (Hancock REW, Chapple DS, the Peptide Antibiotics.Antimicrob of fungal organism preparation
Agent Chemother, l999,43 (6):l3l7-l323).Such as by Rs-AFPs Antimicrobial Peptides From Plants channel genes microorganisms
Fermented, it is easier to overcome to the toxic action of host and largely produced.
Antibacterial peptide is a kind of small-molecular peptides for having suppression or killing action to microorganisms such as bacterium, fungies, it can by bacterium,
Fungi or physics, chemical stimulation is induced, or even some antibacterial peptides can form the expression of composition in plant.It is not
Various bacteria is only resistant to, and can press down antifungal, viral etc., available for conversion crops, culture disease-resistant variety, thus is being planted
Had broad application prospects in thing breeding gene engineering field.Studied first in model plant tobacco and potato resistance to bacterial wilt
In succeed, then in the crop such as fire blight of pear, chrysanthemum, capsicum, eggplant of rice leaf spot bacteria and slice germ apple
Bacterium, achieve certain effect in nosomycosis research.Radish antibacterial peptide gene (AFP) transgenosis can be obtained into potato
P. infestans resistant etc. (Ren Yuxia, Chen Lingna, Chen Jifeng, Chen Zhenghua, potato turn radish antibacterial peptide gene plant acquisition and
The Preliminary Identification of anti-late blight, China's Vegetable 2012 (6):68-73).
Antimicrobial peptide of plant origins has broad-spectrum antifungal or bacterial activity, and the antibacterial peptide found in a kind of plant can be effective
Be applied in other various plants, as the antibacterial peptide in source in radish can go to wild poppy, Ma Ling by transgene method
Respectively reached in potato and wheat anti-late blight of potato and wheat sickle-like bacteria effect (Wei Yujie, Zhang Meixiu, Chang Ying, Luo Shuzhen,
Chen Lingna, wild poppy pollen mediation turn radish antibacterial peptide gene technique study, agriculture of gansu science and technology 2009 (11):6-9;Ren Yu
Rosy clouds, Chen Lingna, Chen Jifeng, Chen Zhenghua, potato turn the acquisition of radish antibacterial peptide gene plant and the Preliminary Identification of anti-late blight,
China's Vegetable 2012 (6):68-73;Zhao Li, Miaoping Zhou, Zengyan, ZhangLi, juan Ren, LipuDu,
Boqiao Zhang, Huijun Xu, Zhiyong Xin, Expression of a radish defensin in
transgenic wheat confers increased resistance to Fusarium graminearum and
Rhizoctonia cerealis Funct Integr Genomics 2011,11:63–70).Antibacterial peptide is as emerging disease-resistant
Genetic resources, the resistance important in inhibiting to crops such as improvement rice, soybean, cotton, rapes to fungal disease.
Antibacterial peptide is because of its unique Antibacterial Mechanism, the antibiotic property of wide spectrum and the features such as be not likely to produce drug resistance, in each row
There is good application prospect in each industry, therefore be also subjected to more next more concern, turn into the study hotspot of Disciplinary Frontiers
(Hancock REW, Chapple DS, Peptide Antibiotics.Antimicrob Agent Chemother, l999,
43(6):l3l7-l323).But the antibacterial peptide of plant origin is also difficult to really be applied in agricultural production practice at present.Mainly
It is because the functional plant origin antibacterial peptide quantity identified at present is seldom, so as to greatly limit plants antimicrobial
The application of peptide.Antibacterial peptide gene in antibacterial peptide database by checking reaches more than 1600 at present, and Antimicrobial Peptides From Plants only have
Less than 300 (http://ercbinfo1.ucd.ie/APPDb/).Certified plant origin antibacterial peptide gene quantity is few
Main cause is as follows:1st, antibacterial peptide gene is relatively small, easily degraded, and content is low, it is difficult to detection and identification;2nd, antibacterial peptide
Molecular weight is small, isolates and purifies difficulty, and extraction step is loaded down with trivial details, yield is low;3rd, vivoexpression purification difficult, cause to be difficult to carry out in vitro
Bacteriostatic activity detection carrys out authentication function;4th, efficient prediction screening technique is lacked;5th, antibacterial peptide chemical synthesis cost is high, and price is held high
It is expensive.How tool functional new plant antibacterial peptide is efficiently predicted, realizing its horizontal expression and reducing cost turns into current antibacterial
Peptide studies the bottleneck with application.
By present invention applicant Inst. of Oil Crops, Chinese Academy of Agriculture be responsible for, vegetables institute of the Chinese Academy of Agricultural Sciences, Shenzhen
Hua Da gene studies institute, Hua Zhong Agriculture University, Hunan University, Agricultural University Of Southwest, Jiangsu academy of agricultural sciences, Sichuan academy of agricultural sciences, Qinghai
University, and absorb English, Australia, U.S., Fa Deng states related research institutes scientific research personnel cooperate to complete the full-length genome of wild cabbage and rape
Sequencing and analysis, wild cabbage and rapeseed gene group partial results paper have delivered (Shengyi Liu, Yumei Liu, Xinhua
Yang,Chaobo Tong,David Edwards,Isobel A.P.Parkin,Meixia Zhao,Jianxin Ma,
Jingyin Yu,Shunmou Huang,Xiyin Wang,Junyi Wang,Kun Lu,Zhiyuan Fang,Ian
Bancroft,Tae-Jin Yang,Qiong Hu,XinfaWang,Zhen Yue,Haojie Li,Linfeng Yang,Jian
Wu,Qing Zhou,Wanxin Wang,Graham J.King,J.Chris Pires,Changxin Lu,ZhangyanWu,
Perumal Sampath,ZhuoWang,Hui Guo,Shengkai Pan,Limei Yang,Jiumeng Min,Dong
Zhang,Dianchuan Jin,Wanshun Li,Harry Belcram,Jinxing Tu,Mei Guan,Cunkou Qi18,
Dezhi Du1,Jiana Li,Liangcai Jiang,Jacqueline Batley,Andrew G.Sharpe,Beom-Seok
Park,Pradeep Ruperao,Feng Cheng,Nomar Espinosa Waminal Yin Huang,Caihua Dong,
LiWang,Jingping Li,Zhiyong Hu,Mu Zhuang,Yi Huang,Junyan Huang,Jiaqin Shi,
Desheng Mei,Jing Liu,Tae-Ho Lee,Jinpeng Wang,Huizhe Jin,Zaiyun Li,Xun Li,
Jiefu Zhang,Lu Xiao,Yongming Zhou,Zhongsong Liu,Xuequn Liu,Rui Qin,Xu Tang,
Wenbin Liu,YupengWang,Yangyong Zhang,Jonghoon Lee,Hyun Hee Kim,France
Denoeud,Xun Xu,Xinming Liang,Wei Hua,Xiaowu Wang,Jun Wang,Boulos Chalhoub&
Andrew H.Paterson.The Brassica oleracea genome reveals the asymmetrical
evolution of polyploid genomes.2014.Nature Communication.5:3930.;Chalhoub B,
Denoeud F,Liu S,Parkin IA,Tang H5,Wang X,Chiquet J,etc.Plant genetics.Early
allopolyploid evolution in the post-Neolithic Brassic a napus oilseed
genome.Science.2014,22;345(6199):950-3.).Chinese cabbage, wild cabbage and cabbage type rape genome sequencing
Information has built up the database http for being available for applicant to inquire about://www.ocri-genomicls.org/bolbase(Cheng
F,Liu S,Wu J,Fang L,Sun S,Liu B,Li P,Hua W,Wang X:BRAD.the genetics and
genomics database for brassica plants.BMC Plant Biol,2011,11:136;Jingyin Yu,
Meixia Zhao,Xiaowu Wang,Chaobo Tong,Shunmou Huang,Sadia Tehrim,Yumei Liu,Wei
Hua and Shengyi Liu.Bolbase:a comprehensive genomics database for Brassica
oleracea.BMC Genomics,2013,14:664)., can using above-mentioned resource by using bioinformatic analysis means
The prediction and analysis of gene are carried out, obtains the large batch of pre-selection gene for having similar sequence architectural feature with known antibacterial peptide, from
Middle screening gene interested, it is a quick shortcut for excavating gene.And antibacterial peptide mrna length itself is small, can utilize
The artificial synthesized technologies of PCR, inexpensive Fast back-projection algorithm, it is not necessary to which cDNA sequence does template and carries out the work such as cloning, can greatly greatly
The speed of antibacterial peptide is obtained soon and reduces research difficulty.
Applicant utilizes cabbage type rape tissue transcript profile sequencing data, develops a potential novel antimicrobial peptide of forecast analysis
The method of gene, obtain antibacterial peptide new gene BnCRP1.The gene be one it is new be rich in cysteine class antibacterial peptide, therefore
It is named as CRP (cystin rich protein).It has 9 conservative cysteines, and amino acid length is more than 30.Experiment
Show that its existing antibacterial activity also has antifungal activity.New there is self cleavage with reference to gene engineering method and using one
Antibacterial peptide vivoexpression carrier pET30a/His-EDDIE-GFP (Tao Ke, Su Liang, the Jin Huang, Han of function
Mao,Jibao Chen,Caihua Dong,Junyan Huang,Shengyi Liu,Jianxiong Kang,Dongqi
Liu,Xiangdong Ma,A novel PCR-based method for high throughput prokaryotic
expression of antimicrobial peptide genes.BMC Biotechnol 2012,12:10.), this research
Amalgamation and expression, renaturation, self cleavage and purifying of the BnCRP1 in Escherichia coli are realized, is obtained with bioactivity
BnCRP1 protein products.With cylinder-plate method (influence factor of Jiang Hui haze cylinder-plate methods measure titer of antibodies and control method China
Veterinary drug magazine .2011, (08) 23-36), using Escherichia coli, Sarcina lutea as Gram-negative bacteria and gram-positive bacteria
Reference culture, indicator bacteria using saccharomycete as fungi carries out bacteriostatic activity detection to the BnCRP1 albumen of purifying, finds
BnCRP1 genes can effectively suppress the growth of bacterium (Escherichia coli and Sarcina lutea) and fungi (yeast, sclerotinite).This
Study to be laid a good foundation using biological information means and technique for gene engineering Large scale identification new plant come derived antimicrobial peptide, there is provided
A kind of new approach.In addition BnCRP1 can spray as biological reagent improves the anti-of plant against fungal disease in plant surface
Property, at the same time it can also be marked as a recruit for aiding in breeding for disease resistance, it is also used as a new gene source and is used to plant
Thing genetic engineering, to cultivate disease-resistant transgenic plant.
The content of the invention
The purpose of the present invention is to be the provision of a rape antibacterial peptide having to fungi and bacterium bacteriostatic activity
BnCRP1, its sequence are shown in SEQ ID NO.2.The antibacterial peptide length is 33 amino acid, and wherein cysteine is 9, should
Antibacterial peptide can strengthen resistance of the plant to metatrophy type fungi Sclerotinia sclerotiorum.
It is another object of the present invention to provide nucleotide sequence, preferred sequence corresponding to rape cecropin B gene nCRP1
For the nucleotide sequence shown in SEQ ID NO.1 and SEQ ID NO.3.
It is also an object of the present invention to provide the synthetic method of rape cecropin B gene nCRP1 genes, method are simple.
Using DNAWorks Software tools, primer sequence is designed by codon optimization, BnCR is synthesized using Overlap-PCR technologies
P1 gene orders.
Another object of the present invention is to be the provision of rape cecropin B gene nCRP1 preparation method, using CSFV
Protein mutant EDDIE is fusion protein;After inclusion body protein purifying, renaturation, EDDIE is correctly folded again, recovers it certainly
Shear ability, at specific site Cys168 and 169 C-terminal merge antibacterial peptide shear off, so as to obtain do not increase it is any
The antibacterial peptide prod of additional amino acid.
Final object of the present invention is the provision of applications of the rape cecropin B gene nCRP1 in antibacterials are prepared,
The antibacterial peptide can strengthen resistance of the plant to metatrophy type fungi Sclerotinia sclerotiorum, can be simultaneously to Sarcina lutea, large intestine bar
Bacterium, saccharomycete, sclerotinite produce fungistatic effect, can also be applied to biological control and breeding for disease resistance.
In order to complete above-mentioned purpose, the present invention adopts the following technical scheme that:
In order to obtain the present invention, applicant is to rape (cabbage type rape Brassica napus) genome moderate resistance sclerotiniose
Related gene and existing antibacterial peptide database carried out it is deeply comprehensive analyse and compare and prediction, be as a result found that one
New is rich in cysteine class antibacterial peptide gene, by being carried out after the external synthesis of the gene and induced expression, protein purification
Activity analysis, finds the gene not only with antibacterial activity also with antifungal activity.The present invention develops an enhancing
The BnCRP1 genes of plant against fungal resistance, the antibacterial peptide of BnCRP1 gene expressions not only has in bacteriostatic activity experiment to be resisted carefully
Bacterium activity also has antifungal activity (including yeast, sclerotinite), imply that the gene has phase in the anti-sclerotiniose breeding of rape
When application prospect.
Rape antibacterial peptide gene BnCRP1 acquisition:
Rape leaf has been carried out in applicant laboratory at present, the express spectra sequencing of silique, obtains a large amount of ESTs data letters
Breath.Simultaneously by Chinese cabbage, wild cabbage and rape and genome sequencing project, their Genomic sequence information storehouse is constructed
(http://www.ocri-genomicls.org/bolbase).Using these sequence informations and special antibacterial peptide database,
Such as ANTIMIC (Brahmachary M, Krishnan SPT, Koh JLY, et al.ANTIMIC:a database of
antimicrobial sequences.Nucleic Acids Research,2004,32:D586-D589, same as below),
APD(Wang Z,Wang GS.APD:the Antimicrobial Peptide Database.Nucleic Acids
Research,2004,32:D590-D592, same as below) APPDB (http://ercbinfo1.ucd.ie/APPDb/, below
It is identical), PhytAMP (Hammami R, Hamida JB, Vergoten G, et al.Phytamp:a database
dedicated to plant antimic robial peptides.Nucleic Acids Res.2009,37:D963-
It is D968, same as below) etc. carry out BLAST comparison (nucleotides similarities>90% i.e. Identity>90%), obtain large batch of
There is the pre-selection gene of similar structures feature with known antibacterial peptide sequence.Then to the protein sequence (Vector of these pre-selection genes
) and secondary structure structure (nnpredict NTI10:http://www.cmpharm.ucsf.edu/nomi/nnpredict
Predictionprotein, same as below) be predicted and analyze, so as to establish protein three-dimensional structure figure, utilize two level knot
Storehouse is built in the classification that structure and function carry out protein families to the antibacterial peptide filtered out, so as to finally obtain potential novel antimicrobial peptide
Gene.Numbering is Bn52760D, is named as BnCRP1.Gene BnCRP1 nucleotides sequences are classified as shown in SEQ ID NO.3, antibacterial peptide
BnCRP1 amino acid sequence is shown in SEQ ID NO.2.A kind of preparation method of external synthesis rape BnCRP1 genes, step
It is as follows:
The codon optimization of rape BnCRP1 genes and external synthesis
According to the DNA sequence dna of BnCRP1 genes, primer sequence is designed, synthetic primer 6 covers drawing for BnCRP1 total lengths altogether
Thing, respectively BnPEV52760D_1, BnPEV52760D_2, BnPEV52760D_3, BnPEV52760D_4, backboneF and
backboneR.Primer sequence is as shown in table 1,
The overlap PCR primer sequences of table 1
BnCRP1 full length genes are obtained using Overlap-PCR technologies.PCR reaction systems are as follows:Total reaction system is
50 μ L, are included:10 × Taq buffer (contain MgCl2) 10 μ l, 1.5mmol/L dNTP (10 mmol/L) 4 μ l, primer
BackboneF1 and backboneR respectively adds 1 μ l (concentration is 10 mmol/L), primer BnPEV52760D_1,
BnPEV52760D_2, BnPEV52760D_3 and BnPEV52760D_4 respectively add 1 μ l (concentration 2mmol/L), Taq (5 U/ μ
L) 1 μ l, ddH2O 33μl.Reaction condition be 94 DEG C 5 minutes, 94 DEG C 1 minute, 58 DEG C 1 minute, 72 DEG C 30 seconds 2 minutes, 25 are followed
Ring, extend 10 minutes after 72 DEG C, amplification size is 122 bp (including objective gene sequences shown in 102bp SEQ ID NO.1
And with each 10 bases for being matched on carrier).
The identified sequencing of PCR primer, sequencing are correctly the cecropin B gene nCRP1 genes after optimizing, and its sequence is SEQ
Shown in ID NO.1.
Cecropin B gene nCRP1 preparation method, comprises the following steps:
1) fusion expression vector EDDIE-BnCRP1 structure
Using inverse PCR technique, BnCRP1 genes are connected on expression vector pET30a/His-EDDIE-GFP.Specifically
To utilize 30abackbone-F:TGAGATCCGGCTGCTAACAAAGCCC and 30abackbone-R:
GCAGCTGGTCACCCACAGCG primers, by Inverse PCR amplification, by pET30a/His-EDDIE-GFP vector linearizations.Will
The pET30a/His-EDDIE-GFP linearized vectors fragment being recovered to by Overlap-PCR amplifications with reclaiming what is obtained
BnCRP1 full length DNA fragments, while Escherichia coli XL10-Gold bacterial strains are converted, by pinpointing homologous recombination in vivo, by BnCRP1
Gene is connected on expression vector pET30a/His-EDDIE-GFP, obtains target gene fusion expression vector EDDIE-
BnCRP1。
2) the external evoked expression of cecropin B gene nCRP1 is with isolating and purifying
Correct fusion expression vector EDDIE-BnCRP1 plasmids will be sequenced, BL21 (DE3) competence is transformed into heat shock method
In cell, EDDIE-BnCRP1 amalgamation and expression engineering bacteria BL21 (DE3)/pETNB is obtained.Using usual manner in LB Liquid Cultures
Culture and inducible protein expression in base, the bacterial cell disruption centrifugation of acquisition, supernatant after purification, produce destination protein antibacterial peptide
BnCRP1, its sequence are shown in SEQ ID NO.2.
Applications of the rape cecropin B gene nCRP1 in antibacterials are prepared, including the antibacterial peptide is directly prepared into antimicrobial
Thing, all there is stronger bacteriostatic activity to bacterium and fungi;The antibacterial of plant can be strengthened on plant leaf blade surface by being sprayed
Property, resistance of the plant to this fungal disease of sclerotinite is particularly improved, BnCRP1 genes are utilized to the means of molecular biology
It is overexpressed in rape or other plant, preparing can the antimycotic and genetically modified plants of bacterium.
The present invention compared with prior art, has advantages below and effect:
1. the present invention using Chinese cabbage, wild cabbage and rape and the sequence information of genome sequencing and transcript profile sequencing data with
Special antibacterial peptide database is compared and predicted classification analysis, successfully obtains one and new is rich in cysteine class antibacterial peptide
BnCRP1.To be laid a good foundation using bioinformatics means and technique for gene engineering Large scale identification new plant derived antimicrobial peptide,
Provide a kind of new approach.
2. utilizing Overlap-PCR technologies artificial synthesized gene in vitro, the technology for obtaining BnCRP1 is greatly reduced
Difficulty and cost.
3. to solve the problems of antibacterial peptide heterogenous expression, present invention employs a kind of new amalgamation and expression antibacterial peptide
Method, use CSFV protein mutant EDDIE as fusion protein, with inclusion bodies in e. coli bl21 efficient table
Up to antibacterial peptide, to reduce toxic action of the antibacterial peptide to host.After inclusion body protein purifying, renaturation, EDDIE correctly rolls over again
It is folded, recover its self cleavage ability, the antibacterial peptide that C-terminal merges is shear off at specific site Cys168 and 169, so as to obtain
The antibacterial peptide prod of any additional amino acid is not increased.This method need not add any chemical substance and enzyme to remove fusion mark
Label, non-toxic to host, purge process is simple, and antibacterial activity of the detection to pathogen, highest goal can be used directly to after shearing
Yield can reach 12g/L.
4. cylinder-plate method and blade surface, which spray inoculation test result, shows that the cecropin B gene nCRP1 of Prokaryotic expression, purification can
Effectively to suppress the growth of bacterium and fungi and plant pathogenic fungi sclerotinite, resistance of the plant to them can be effectively improved.
5. because BnCRP1 gene sources are in rape, it is also used as the choosing that resistance marker is used for rape disease-resistant variety
Educate, or be used for transgenic breeding as the candidate gene of genetic engineering.
Brief description of the drawings
Fig. 1 is expression vector pET30a/His-EDDIE-GFP ideographs.
Fig. 2 rape cecropin B gene nCRP1 three dimensional structure simulation figures.
Fig. 3 is EDDIE-BnCRP1 vector constructions agarose gel electrophoresis detection figure.
A in Fig. 3:The Ago-Gel detection of overlap PCR synthesis BnCRP1 genes;M:100 bp DNA Marker;
1-2:Overlap PCR synthesize BnCRP1 genes;
B in Fig. 3:Expression vector EDDIE-BnCRP1 electrophoresis detections;M:1 kb DNA Marker;1:Recombinant vector
pET30a-EDDIE-BnP;2:Empty carrier pET30a/His-EDDIE-GFP;
C in Fig. 3:BnCRP1 gene PCRs detect;M:DL2000 DNA Marker;1:Positive control;2:Negative control;3-
4:BnCRP1 recons.
The expression and purification SDS-PAGE electrophoresis detections of Fig. 4 BnCRP1 albumen.
A in Fig. 4:The SDS-PAGE analyses of fusion protein EDDIE-BnCRP1 induced expressions;M:Small molecular weight protein
Marker;0:Compare bacterium precipitation, 1-6:EDDIE-BnLTP1 is precipitated.
B in Fig. 4:SDS-PAGE electrophoretic analysis after EDDIE-BnCRP1 renaturation;M:Small molecular weight protein Marker;1,2:
SDS-PAGE analyses in 8 hours after EDDIE-BnCRP1 renaturation.
Fig. 5:BnCRP1 antibacterial peptides are analyzed the bacteriostatic activity of bacterium and fungi;
A:Saccharomycete:Pichia pastoris GS115;B:Sarcina lutea;C:Escherichia coli;D:Sclerotinite.
Fig. 6 BnCRP1 antibacterial peptide arabidopsis tooth in vitro is smeared and is followed by kind of a sclerotinite bacteriostasis figure.
First row:The Arabidopsis leaf smeared by cecropin B gene nCRP1;
Second row:Undressed normal Arabidopsis leaf is as control.
Embodiment
According to following examples, the present invention can be better understood from, but described embodiment is to preferably explain this
Invention, rather than limitation of the present invention.Agents useful for same of the present invention if not otherwise specified, derives from commercial channel, the skill
Art scheme, it is the conventional scheme of this area if not otherwise specified.
Embodiment 1:
Rape antibacterial peptide gene BnCRP1 prediction and structural analysis
Utilize the Chinese cabbage of inventor laboratory structure, the genome and transcript profile sequence information number of wild cabbage and cabbage type rape
According to storehouse (http://www.ocri-genomicls.org/bolbase) and special antibacterial peptide database, as ANTIMIC is (preceding
Face is already described), APD (above already described), APPDB (above already described), PhytAMP (above already described) etc. carry out BLAST comparison (nucleotides
Similarity>90% i.e. Identity>90%) the large batch of pre-selection for having similar structures feature with known antibacterial peptide sequence, is obtained
Gene.Then the protein sequence (Vector NTI10) to these pre-selection genes and (above already described) progress of secondary structure structure are pre-
Survey and analyze, so as to establish protein three-dimensional structure figure, egg is carried out to the antibacterial peptide filtered out using secondary structure and function
Storehouse is built in the classification of white matter family, so as to finally obtain the novel antimicrobial peptide gene that numbering is EV52760D.1.It is named as BnCRP1.
The nucleotides sequence of BnCRP1 genes is classified as shown in SEQ ID NO.3, and cecropin B gene nCRP1 amino acid sequence is SEQ ID NO.2
It is shown.
BnCRP1 antibacterial peptides contain 33 amino acid, and wherein cysteine content is a kind of half new Guang more than 27%
Propylhomoserin enrichment class antibacterial peptide (Cystin rich protein CRPs).It is different from the same ecdysone rich in cysteine, this
It is a kind of antibacterial peptide of the new type of rare report, there is 12 cysteine conservation sequences and amino acid length in ecdysone
More than 60.(Padovan L,Scocchi M,Tossi A.Structural aspects of plant antimicrobial
peptides,Curr Protein Pept Sci.2010,11(3):210-9;Bindschedler LV1,Whitelegge
JP, Millar DJ, Bolwell GP, A two component chitin-binding protein from French
bean--association of a proline-rich protein with a cysteine-rich
Polypeptide.FEBS Lett.2006,6;580(6):1541-6.Epub 2006 Feb 2).Protein tertiary structure is (above
It is already described) display BnCRP1 secondary structure in the presence of substantial amounts of disulfide bond, primarily form helical structure, whole polypeptide is by 50%
α spirals and 50% random coil composition.This protein structure determines the antibacterium and antimycotic effect that it is occurred
Pattern is to have the function that antibacterial (Balaji Ramanathan EGD, Christopher by destroying the mechanism of cell membrane
R.Ross,Frank Blecha:Cathelicidins:microbicidal activity,mechanisms of action,
and roles in innate immunity.Microbes and Infection 2002,4:361-372.).Protein three-dimensional
The result of structure prediction also supports the above results, forms a big α spiral from N-terminal, remainder forms random coil
Structure (Fig. 2).
Embodiment 2:
The codon optimization of rape BnCRP1 genes and external synthesis
Due to antibacterial peptide, existence time is short in vivo, it is difficult to catches, the round pcr with routine is difficult from rape cDNA
Middle amplification, and whole antibacterial peptide is all artificial synthesized then expensive.In order to reduce the cost for obtaining antibacterial peptide, root of the present invention
According to the DNA sequence dna according to BnCRP1 genes, DNAWorks Software tools (http is utilized://mcl1.ncifcrf.gov/
Dnaworks/, Hu F, Ke T, Li X, Mao PH, Jin X, Hui FL, Ma XD, Ma LX.Expression and
Purification of an Antimicrobial Peptide by fusion with elastin-like
polypeptides in Escherichiacoli.Appl Biochem Biotechnol.2010,160(8):2377-87),
Pass through codon optimization (Ke T, Liang S, Huang J, Mao H, Chen J, Dong C, Liu S, Kang J, Liu D, Ma
X:A novel PCR-based method for high throughput prokaryotic expression of
antimicrobial peptide genes.BMC Biotechnol 2012,12:10.) primer sequence is designed, synthesis altogether is drawn
The primer (the handsome company's synthetic primer in Shanghai) of 6 covering BnCRP1 total lengths of thing, respectively BnPEV52760D_1,
BnPEV52760D_2, BnPEV52760D_3, BnPEV52760D_4, backboneF and backboneR.Primer sequence such as table 1
It is shown, boldface represent with carrier pET30a/His-EDDIE-GFP (carrier be this laboratory with reference to Ke Tao documents structure and
Into Ke T, Liang S, Huang J, Mao H, Chen J, Dong C, Liu S, Kang J, Liu D, Ma X:A novel
PCR-based method for high throughput prokaryotic expression of antimicrobial
peptide genes.BMC Biotechnol 2012,12:10.) homologous part, remaining is gene-specific primer.Using
Overlap-PCR technologies (Zhu D, Zhong X, Tan R, Chen L, Huang G, Li J, Sun X, Xu L, Chen J, Ou
Y,Zhang T,Yuan D,Zhang Z,Shu W,Ma L:High-throughput cloning ofhuman liver
complete open reading frames using homologousrecombination in Escherichia
coli.Anal Biochem 2010,397(2):162-167) obtain BnCRP1 full length genes.
PCR reaction systems are as follows:Total reaction system is 50 μ L, is included:10 × Taq buffer (contain MgCl2) 10 μ l,
1.5mmol/L dNTP (10 mmol/L) 4 μ l, primer backboneF1 and backboneR respectively add 1 μ l (concentration 10mmol/
L), primer BnPEV52760D_1, BnPEV52760D_2, BnPEV52760D_3 and BnPEV52760D_4 respectively add 1 μ l (concentration
For 2mmol/L), Taq (5U/ μ l) 1 μ l, ddH2O 33μl.Reaction condition be 94 DEG C 5 minutes, 94 DEG C 1 minute, 58 DEG C 1 minute,
72 DEG C 30 seconds 2 minutes, 25 circulations, extend 10 minutes after 72 DEG C, amplification size is 122bp (Fig. 3).PCR primer is through 1.0% fine jade
Sepharose electrophoresis detection, after Gel Extraction kit recovery, it is connected to pMD18-T carriers, heat shock method conversion XL10-
The competent cell of Gold bacterial strains, it is coated on the LB solid medium flat boards containing the μ g/mL of ampicillin 50,37 DEG C of cultures
Overnight, hickie 6 is selected, using M13 primers:5 ' TGTAAAACGACGGCCAGT3 ' and 5 ' CAGGAAACAGCTATGACC3 ',
Do bacterium colony PCR detections.Amplified production size is 200bp, after 1.0% agarose gel electrophoresis detected magnitude is correct.PCR is detected
The correct bacterial plaque of size is inoculated into the LB liquid medium of the μ g/mL containing ampicillin 50,200r/min shaken cultivations at 37 DEG C
Overnight, a small amount of alkalinity extraction plasmids, after 1.0% agarose gel electrophoresis detection DNA size is correct (for 400bp), use
Kpn I/BamH I digestions carry out double digestion to plasmid, and 37 DEG C overnight, the detection of 1.0% agarose gel electrophoresis.It will detect correct
Positive recombinant clones are named as pMD18-BnCRP1, and pMD18-BnCRP1 is served into Hai Yingjun companies is sequenced, analysis result,
Cecropin B gene nCRP1 full length gene sequences after being optimized, its sequence are shown in SEQ ID NO.1.
Embodiment 3:Fusion expression vector EDDIE-BnCRP1 structure
The method reported according to Ke Tao, using inverse PCR technique, expression vector pET30a/ is connected to by BnCRP1 genes
On His-EDDIE-GFP.Utilize 30abackbone-F:TGAGATCCGGCTGCTAACAAAGCCC and 30abackbone-R:
GCAGCTGGTCACCCACAGCG primers, by Inverse PCR amplification, by pET30a/His-EDDIE-GFP vector linearizations.Tool
Precursor reactant system is as follows:Using 50 μ L systems, the wherein μ l of pET30a/His-EDDIE-GFP plasmids 1 (50ng/ μ l) are template mould
Plate, 10 × Taq buffer (contain MgCl2) 5 μ l, 1.5mmol/L dNTP (10mmol/L) 4 μ l, 5 ' primer 30abackbone-R
2 μ l (10 μm of ol/L), the μ l of 3 ' primer 30abackbone-F 2 (10 μm of ol/L), Taq enzyme (5U/ μ l) 1 μ l, ddH2O 31μl.Instead
Answer the condition to be 5 minutes at 94 DEG C, 94 DEG C 30 minutes, 60 DEG C 30 seconds, 72 DEG C 6 minutes, 25 circulations, extend 10 minutes after 72 DEG C,
PCR primer size is 6kb.After 1.0% agarose gel electrophoresis detected magnitude is correct, 6kb is reclaimed with gel reclaims kit
Large fragment.Overlap- will be passed through in the pET30a/His-EDDIE-GFP linearized vectors fragment being recovered to and embodiment two
The BnCRP1 full length DNA fragments that PCR amplification recovery obtains, while convert Escherichia coli XL10-Gold bacterial strains and (be purchased from
Strategene companies), by pinpointing homologous recombination in vivo, BnCRP1 genes are connected to expression vector pET30a/His-
On EDDIE-GFP.Specific method is as follows:According to pET30a/His-EDDIE-GFP linearized vector fragments:50ng BnCRP1
Full length DNA fragment=3:1 ratio biased sample, with heat shock method convert XL10-Gold bacterial strains competent cell after, containing
Screened on the solid LB media flat board of kanamycins (50 μ g/mL), utilize the GFP green fluorescent protein marks of (Fig. 1) on carrier
Label screen non-luminous positive colony under ultraviolet light, extract plasmid, through 1.0% agarose gel electrophoresis detected magnitude just
Really (B in Fig. 3), serve the sequencing of Hai Ying fine horses biotech firm.Sequence is correctly purpose gene fusion expression carrier after sequencing
EDDIE-BnCRP1。
Embodiment 4:
The external evoked expression of cecropin B gene nCRP1 is with isolating and purifying
Correct fusion expression vector EDDIE-BnCRP1 plasmids will be sequenced, BL21 (DE3) impressions are transformed into heat shock method
In state cell, EDDIE-BnCRP1 amalgamation and expression engineering bacteria BL21 (DE3)/pETNB is obtained.Bacterium solution is drawn 5 μ l and existed after converting
In the flat lining out of solid LB media containing kanamycins (50 μ g/mL), 37 degree of cultures resist after 24 hours from kanamycins
Picking chooses single bacterium colony on mild-natured plate.The single bacterium colony of picking is inoculated in the LB of 10 milliliters final concentration of (50ug/mL kanamycins)
In nutrient solution, stayed overnight in 37 DEG C of shaken cultivations, with 1:100 ratio is forwarded in 1000 milliliters of LB fluid nutrient mediums, and 37 DEG C are shaken
Culture 3 hours or so is swung, when absorbance value is 0.6 or so under 600nm with spectrophotometer detection LB fluid nutrient mediums, upper
State the IPTG that final concentration of 1mM is added in LB fluid nutrient mediums.Concussion continues to cultivate 6h progress induced expressions at 37 DEG C, uses platform
Formula centrifuge (above already described) with 5000r/min centrifugation 15min, outwells supernatant at room temperature, collects bacterial sediment.
By the thalline that upper step is collected with bacterium buffer solution is broken, ultrasonic cell disruptor carrying out ultrasonic bacteria breaking 5min is used under ice bath,
Then 15min is centrifuged with 5000r/min rotating speed with centrifuge under the conditions of 4 DEG C, collects inclusion body precipitation.Inclusion body is precipitated
Cleaned twice under the conditions of 4 DEG C with 10 milliliters of lavation buffer solutions, 2 minutes every time.With centrifuge with 12000r/ under the conditions of 4 DEG C
Min rotating speeds centrifuge 20min, collect precipitation again.With the expression (figure of destination protein in SDS-PAGE electrophoresis detection inclusion bodys
4).The result of (A) shows after IPTG inducing action 8 hours in Fig. 4, BnCRP1 great expressions in inclusion body precipitation.
With volume ratio 1:The inclusion body collected above precipitation is dissolved in urea-denatured buffer solution by 10 ratio, at room temperature
Shaken 2 hours with oscillator, 20min is centrifuged with 12000r/min rotating speeds with centrifuge in 4 DEG C, takes supernatant.Take 1ml Ni-NTA
Ago-Gel prepacked column, add 10ml equilibration buffers and balance prepacked column at room temperature 30 minutes, with 5000r/min
Speed in 4 DEG C with centrifuge 5min, remove the solution under, collect prepacked column.Then inclusion body protein supernatant is taken
10ml samples with 0.5ml/min speed loading into Ni-NTA Ago-Gel prepacked columns, with 2 milliliters of centrifuge tubes be in charge of by lower section
The solution flowed down in prepacked column is collected, often pipe collects 2 milliliters.Then washed with 15ml lavation buffer solutions with 1-2ml/min flow velocity
Remove unadsorbed sample.Lower section is in charge of the solution collected and flowed down in prepacked column with 2 milliliters of centrifuge tubes, and often pipe collects 2 milliliters.Then
The EDDIE-BnCRP1 fusion proteins specifically bound with 5ml elution buffers with 1-2ml/min flow velocity elution with Ni-NTA,
Lower section is in charge of the solution collected and flowed down in prepacked column with 2 milliliters of centrifuge tubes, and often pipe collects 2 milliliters.Finally use 5ml level pads
Pillar is balanced, adds 1 milliliter of 20% ethanol in case next time uses.By all solution of collection SDS-PAGE electrophoresis detection purposes
The content and purity of albumen, take purity best, and the pipe of concentration highest one does renaturation experiment (sample of swimming lane 5 in Fig. 4 A).
2 milliliters of the protein solution of swimming lane 5 in best Fig. 4 A after step electrophoresis detection is taken, rapidly joins 100 milliliters of renaturation
Buffer solution, placed 6 hours in room temperature, Tricine-SDS-PAGE electrophoresis detection fusion proteins EDDIE-BnCRP1 self cleavage effect
Fruit, as a result as shown in B in Fig. 4:Obtain fusion protein occur it is remaining without any additional amino acid after self cleavage
BnCRP1 antibacterial peptides.The protein content of antibacterial peptide after renaturation, concentration 12mg/ml are determined using Nanodrop-2000.
Embodiment 5:BnCRP1 antibacterial peptide Antibacterial Activities
Represented respectively with Sarcina lutea (Micrococcus luteus) for gram-positive bacteria, Escherichia coli
(Escherichiacoli) represented for Gram-negative bacteria, finger of the saccharomycete (Pichia pastoris GS115) as fungi
Show bacterium, the standard method using cylinder-plate method as detection cecropin B gene nCRP1 bacteriostatic activities.
Specific method is as follows:The artificial purifying that 200 microlitres of concentration are about 3 milligrams every milliliter is added in each Oxford cup
Good cecropin B gene nCRP1 solution or the cecropin B gene nCRP1 solution (fungistatic effect of two kinds of solution is identical) of chemical synthesis,
After cultivating 12-16 hour under 37 degree of environment, the antibacterial activity of BnCRP1 antibacterial peptides is calculated by determining inhibition zone size.Altogether
3 experiments are carried out, 3 technologies of experiment progress repeat every time.
As a result as shown in Fig. 5 and table 2, the Oxford cup of Oxford cup and artificial synthetic antimicrobial peptide added with expression and purification antibacterial peptide
All there is big inhibition zone in surrounding, and control section does not have obvious inhibition zone to occur.Vivoexpression purifying cecropin B gene nCRP1
To the average antibacterial circle diameter of Escherichia coli, Sarcina lutea and Pichia pastoris all more than 1.3 centimetres, show efficient
Bacteriostasis.
Inventor is also to BnCRP1 antibacterial peptides to sclerotinite (Sclerotinia sclerotiorum), this pathogenic
The bacteriostatic activity of fungi is identified.Intact sclerotinite sclerotium is selected, it is first alcohol-pickled 1 minute with 10 milliliter 75%, then
With 10 milliliters of 0.1%HgCl2Middle soaking disinfection 8-10 minutes, then with flushing 3-5 times of 10 milliliters of sterilized water.Sterilizing sclerotium is cut
Both ends are gone to, mung bean size is cut into center section, and section down, is inoculated in PDA plate.Usual every sclerotium connects a plate, once connects
Kind 8-9 plates.In 22 DEG C of quiescent cultures 3-4 days, when mycelia will be paved with flat board, useCard punch punches along mycelia outer rim,
Mycelia block is taken, for being inoculated with again.The mycelia block taken out with card punch is placed in middle position on a new PDA plate,
The one side containing mycelia is set to contact PDA planes.When mycelia extends to about 1cm, each up and down in mycelia block places one
Oxford cup, it is separately added into the antibacterial peptide (effect for the antibacterial peptide that two methods obtain of artificial purified antibacterial peptide or chemical synthesis
Fruit is identical), renaturation solution is as control.Continue culture 48 hours, observe bacteriostatic activity situation.As a result as shown in figure 5, with to photograph
Than Fungal hyphal growth is prevented around the Oxford cup added with antibacterial peptide, can not cross Oxford cup, and control section mycelia is then
The edge that Oxford cup reaches culture dish can smoothly be crossed.Cecropin B gene nCRP1 bacteriostatic diameter the results are shown in Table 2.As a result display body
The cecropin B gene nCRP1 of outer expression and purification has significant fungistatic effect to sclerotinite, and bacteriostatic diameter reaches 2.83 centimetres.
The vivoexpression of table 2 purifies cecropin B gene nCRP1 bacteriostatic activities
Embodiment 6:
Application of the BnCRP1 antibacterial peptides in plant disease-resistant
In order to detect potentiality of the cecropin B gene nCRP1 as resistance of the biological prevention and control agent for improving plant against fungal disease, hair
A person of good sense sprays certain density artificial expression and purification antibacterial peptide solution, then inoculation in plant (arabidopsis, rape) blade surface
Above-mentioned disease fungus, Lesion size is determined after 36 hours.Concrete mode is as follows:
The Arabidopsis leaf and 5 leaf phase rape leafs of growth 5 weeks are taken, uniformly smearing one layer of concentration in blade surface is
5ng/ μ l labor statements reach cecropin B gene nCRP1 after purification.According to method described in embodiment 5, nuclear disk is cultivated on PDA plate
Bacterium is used when mycelia will be paved with flat boardCard punch punches along mycelia outer rim, takes mycelia block, is inoculated with for rape leaf,
WithCard punch punches along mycelia outer rim, takes mycelia block, is inoculated with for Arabidopsis leaf.With syringe needle by card punch
The mycelia block of taking-up is placed in arabidopsis and rape leaf middle, the one side containing mycelia is contacted blade surface.Simultaneously not
Smear and be also equally inoculated with nuclear fungal hyphae block on the arabidopsis and rape leaf of antibacterial peptide according to the method described above as control, 22
DEG C, cultivate 36 hours under the conditions of humidity 90% and observe susceptible situation, and determine the Lesion size on each blade.As a result such as Fig. 6
Shown in table 3, smear antibacterial peptide Arabidopsis leaf and rape leaf compared with the arabidopsis and rape leaf do not smeared, inoculation
Lesion area of the sclerotinite after 36 hours is substantially reduced.Such as without smearing cecropin B gene nCRP1 Arabidopsis leaf inoculation sclerotinite 36
Bacterial plaque area expands to 3.04cm after hour2, and the average bacterial plaque area for smearing cecropin B gene nCRP1 Arabidopsis leafs is
0.76cm2, only compare the 25% of blade bacterial plaque area.Equally bacterium 36 is followed by rape leaf surface smear cecropin B gene nCRP1
Bacterial plaque area after hour also only has 27% or so of control, has significant difference.This explanation sprays antibacterial peptide in plant leaf blade
BnCRP1 significantly inhibits sclerotinite and infects diffusion, effectively raises resistance of the plant to this disease fungus.
Lesion area (unit after the arabidopsis of table 3 and rape leaf are inoculated with 36 hours:cm2)
Numbering | Control | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 |
Arabidopsis | 3.04 | 0.76 | 0.98 | 0.68 | 0.81 | 0.84 | 0.75 | 0.69 | 0.57 |
Rape | 6.21 | 1.74 | 1.87 | 1.68 | 1.52 | 1.41 | 1.6 | 1.82 | 1.69 |
The bacteriostatic activity testing result of the present invention shows BnCRP1 to bacterium (Escherichia coli, Sarcina lutea) fungi
(saccharomycete, sclerotinite) all has stronger bacteriostatic activity.Excised leaf smearing, which connects bacterium experiment, confirms that BnCRP1 can strengthen plant
Resistance of the thing to metatrophy type fungi Sclerotinia sclerotiorum.BnCRP1 can be used as biological prevention and control agent to be used in sclerotiniose preventing and treating.It can pass through
The expression that technique for gene engineering improves BnCRP1 can strengthen resistance of the plant to sclerotinite, can also be used as resistance marker
Seed selection for rape disease-resistant variety.
SEQUENCE LISTING
<110>Inst. of Oil Crops, Chinese Academy of Agriculture
<120>A kind of rape cecropin B gene nCRP1 and its application
<130>A kind of rape cecropin B gene nCRP1 and its application
<160> 9
<170> PatentIn version 3.1
<210> 1
<211> 102
<212> DNA
<213>Artificial sequence
<400> 1
atgaattggt gcggtgggaa atgcgaagtg cgttgcaaag atgtgggcat gaatgatcgt 60
tgcctgaaat attgcggcat ttgttgtaaa gaatgtaaat gc 102
<210> 2
<211> 33
<212> PRT
<213>Rape
<400> 2
Asn Trp Cys Gly Gly Lys Cys Glu Val Arg Cys Lys Asp Val Gly Met
1 5 10 15
Asn Asp Arg Cys Leu Lys Tyr Cys Gly Ile Cys Cys Lys Glu Cys Lys
20 25 30
Cys
<210> 3
<211> 99
<212> DNA
<213>Rape
<400> 3
aaatggtgtg gagggaagtg tgaagtgaga tgcgaagaag cagggatgaa ggatagatgt 60
ttgaagtatt gtgggatatg ctgcaaagag tgtaagtgt 99
<210> 4
<211> 47
<212> DNA
<213>Artificial sequence
<400> 4
cgctgtgggt gaccagctgc gaattggtgc ggtgggaaat gcgaagt 47
<210> 5
<211> 53
<212> DNA
<213>Artificial sequence
<400> 5
ggcaacgatc attcatgccc acatctttgc aacgcacttc gcatttccca ccg 53
<210> 6
<211> 53
<212> DNA
<213>Artificial sequence
<400> 6
ggcatgaatg atcgttgcct gaaatattgc ggcatttgtt gtaaagaatg taa 53
<210> 7
<211> 53
<212> DNA
<213>Artificial sequence
<400> 7
gggctttgtt agcagccgga tctcagcatt tacattcttt acaacaaatg ccg 53
<210> 8
<211> 25
<212> DNA
<213>Artificial sequence
<400> 8
tgagatccgg ctgctaacaa agccc 25
<210> 9
<211> 20
<212> DNA
<213>Artificial sequence
<400> 9
gcagctggtc acccacagcg 20
Claims (6)
1. a kind of protein of separation, its sequence is shown in SEQ ID NO.2.
2. gene corresponding to the protein described in claim 1.
3. application of the gene described in protein or claim 2 in antibacterials are prepared described in claim 1.
4. application according to claim 3, it is characterised in that described antibacterials are anti-sclerotinite medicine, anti-large intestine
Bacillus medicine, anti-Sarcina lutea medicine or anti-Pichia pastoris medicine.
5. the gene described in protein or claim 2 described in claim 1 resists in enhancing plant to metatrophy type fungi
Application in property, described fungi is sclerotinite.
6. the gene described in protein or claim 2 described in claim 1 is preparing while is suppressing Sarcina lutea, greatly
Enterobacteria, saccharomycete, the application in the medicine of sclerotinite.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510050960.3A CN104530206B (en) | 2015-01-30 | 2015-01-30 | A kind of rape cecropin B gene nCRP1 and its application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510050960.3A CN104530206B (en) | 2015-01-30 | 2015-01-30 | A kind of rape cecropin B gene nCRP1 and its application |
Publications (2)
Publication Number | Publication Date |
---|---|
CN104530206A CN104530206A (en) | 2015-04-22 |
CN104530206B true CN104530206B (en) | 2018-02-13 |
Family
ID=52845869
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510050960.3A Active CN104530206B (en) | 2015-01-30 | 2015-01-30 | A kind of rape cecropin B gene nCRP1 and its application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104530206B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101830792B1 (en) * | 2016-01-27 | 2018-02-21 | 건국대학교 산학협력단 | Method for producing antimicrobial peptide using insoluble fusion protein containing antimicrobial peptide |
-
2015
- 2015-01-30 CN CN201510050960.3A patent/CN104530206B/en active Active
Non-Patent Citations (2)
Title |
---|
A novel PCR-based method for high throughput;Tao Ke等;《BMC Biotechnology》;BIOMED CENTRAL;20120323;第12卷;1-7页 * |
抗菌肽基因BnPCD842895克隆表达及活性检测;黄金等;《中国油料作物学报》;CNKI;20130829;第35卷(第4期);第358页左栏第1-2段,右栏第1.3节,第359页第1.5节和第1.6节,第361页第2.5节,第362页右栏第4节 * |
Also Published As
Publication number | Publication date |
---|---|
CN104530206A (en) | 2015-04-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Ma et al. | A cooperative system of silicon transport in plants | |
CN101284876B (en) | Fusion protein Penharpin, preparation method and use | |
CN106834336A (en) | A kind of heterogenous expression and purification process of Trichoderma harzianum acid protease P6281 | |
CN104530204B (en) | A kind of rape cecropin B gene nPRP1 and its application | |
López et al. | Isolation of a new fungi and wound-induced chitinase class in corms of Crocus sativus | |
CN107266585B (en) | A kind of MLH fusion antibacterial peptide and its preparation method and application | |
CN104530206B (en) | A kind of rape cecropin B gene nCRP1 and its application | |
CN106244598B (en) | Radix Notoginseng Dirigent albuminoid gene PnDIR1 and application | |
CN104744577B (en) | Beauveria bassiana antibacterial protein Bbafp and its expression vector, genetically modified plants containing its gene preparation method and application | |
CN106929516A (en) | Cucumber CsDIR16 genes and its application in plant Propamocarb residues of pesticides are reduced | |
CN106589086A (en) | Radix notoginseng disease resistance-related protein PnPR10-2, and coding gene and application thereof | |
CN104694558B (en) | A kind of esterase gene estZ and its coding protein and application | |
CN106520791B (en) | Grape disease-resistant related gene VvPUB21 and its plant expression vector and application | |
CN113105532B (en) | Aspergillus oryzae elicitor protein SGP1, short peptide and application thereof | |
CN104530205B (en) | A kind of rape cecropin B gene nLTP1 and its application | |
CN108164589A (en) | One kind is from cotton plant fungal disease resistance Protein G hGLP2 and its encoding gene and application | |
CN102408475B (en) | Bt protein Cryt1Da1, and coding gene and application thereof | |
CN103525837B (en) | Bt PROTEIN C ry72Aa1 operon genes and its application | |
CN109134629B (en) | Botrytis cinerea secretory protein elicitor BcXyl1 and application thereof | |
CN112940135A (en) | Fusion protein, amino acid sequence, coding nucleotide sequence, preparation method and application thereof | |
CN113817747B (en) | Sisal hemp defensin gene and application thereof | |
CN110105433A (en) | The application of novel lactic acid bacteria antibacterial peptide and high efficient expression and antibacterial anticancer activity | |
CN109295068A (en) | A kind of Radix Notoginseng class sweet protein gene PnTLP2 and application | |
CN104356215B (en) | A kind of citrus fruit fly antibacterial peptide and its derivative and application | |
CN102584960B (en) | Bt (Bacillus thuringiensis) protein Cry70Aa1 as well as encoding gene and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |