CN110105433A - The application of novel lactic acid bacteria antibacterial peptide and high efficient expression and antibacterial anticancer activity - Google Patents
The application of novel lactic acid bacteria antibacterial peptide and high efficient expression and antibacterial anticancer activity Download PDFInfo
- Publication number
- CN110105433A CN110105433A CN201811548163.8A CN201811548163A CN110105433A CN 110105433 A CN110105433 A CN 110105433A CN 201811548163 A CN201811548163 A CN 201811548163A CN 110105433 A CN110105433 A CN 110105433A
- Authority
- CN
- China
- Prior art keywords
- antibacterial peptide
- lhh1
- lactic acid
- acid bacteria
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Abstract
The present invention relates to the applications of a kind of novel lactic acid bacteria antibacterial peptide and high efficient expression and antibacterial anticancer activity, by the genome for analyzing Lactobacillus casei (L.casei HZ1), obtain the gene order of antibacterial peptide LHH1, as shown in sequence 1, its secondary structure is simulated, determines the main physical and chemical of the peptide.According to the optimization of lactic acid bacteria codon-bias and fully synthetic LHH1 gene, by the gene fragment clone into lactic acid bacteria expression vectors pE-SUMO, building obtains pE-SUMO-EA-LHH1 recombinant plasmid.By recombinant plasmid transformed into Escherichia coli Rosetta (DE3) pLysS, inducing expression is carried out to it and is isolated and purified.This method antibacterial peptide LHH1 thermal stability obtained is strong, there is good antibacterial, anticancer effect, can be used as excellent anticorrosive additive and leavening in the industries such as food, drug, feed.
Description
Technical field
The present invention relates to genetic engineerings and field of biotechnology, more particularly, to a kind of novel lactic acid bacteria antibacterial peptide LHH1
High efficient expression and antibacterial anticancer activity application.
Background technique
Since the nineties in last century, the novel antibacterials object Quality Research such as antibacterial peptide is increasingly increased, wherein alexin, richness
The antibacterial active peptides families such as histone (Histatin) are the natural components of human immune system, have antibacterial activity strong, malicious secondary
Small, the advantages that antibody-resistant bacterium is few is acted on, is concerned.Antibacterial peptide can be induced to produce when body is attacked by virus, bacterium etc.
It is raw, it is the component part of animal and plant and human congenital's immunologic mechanism, there is broad-spectrum antibacterial action, especially some generate is resisted
The pathogen of raw element drug resistance, so it is very big in multiple fields application potentials such as agricultural, medical treatment, food.
Lactic acid bacteria is a kind of bacterium for generating lactic acid for raw material with sugar, has and improves food value, improves food wind
Taste extends the holding time, is harmless to safety of human and livestock, has the probiotics of healthcare function, is accordingly regarded as ideal protein and peptide
The oral carrier and expression vector of substance.So far, it has been found that thousands of kinds of natural antibacterial peptides, but its source is more complex, safety
Index waits investigating, accordingly it is desirable to relevant antibacterial peptide can be sought out of probiotics, to guarantee its safety used.
Antibacterial peptide mainly uses three kinds of methods to people in order to obtain: 1. directly extract native peptides from organism；2. changing
Method synthesis；3. using the method for genetic engineering.First two is not suitable for being mass produced since cost is excessively high, gene work
The method of journey expression is increasingly approved by everybody.First construct high efficient expression fermentation strain, and establish its purifying and fermentation
Condition and method, so that the production of antibacterial peptide is promoted with it in various applications.
Summary of the invention
The present invention expresses a kind of novel antimicrobial peptide LHH1 from Lactobacillus casei by technique for gene engineering, obtains it
The fermentation strain of high efficient expression, and confirm the antibacterial anticancer activity of LHH1, and the stability of LHH1 at different temperatures.
In order to solve the above technical problems, the technical scheme is that
A kind of novel lactic acid bacteria antibacterial peptide, nucleotide sequence is as shown in SEQ ID NO.1.
Moreover, the amino acid sequence of the antibacterial peptide, molecular weight, charge number, isoelectric point, hydrophobicity are respectively as follows:
AFALIAGALYRIFHRR, 1875.25 ,+3,11.71,0.98.
A kind of expression of novel lactic acid bacteria antibacterial peptide, it is characterised in that: the following steps are included:
S1. amino acid sequence described in claim 1 is synthesized, which is novel lactic acid bacteria antibacterial peptide gene；
S2. the genetic engineering bacterium of peptide recombined colibacillus containing antibacterial is constructed；
S3. the inducing expression of antibacterial peptide fusion protein；
S4. the purifying of antibacterial peptide.
Moreover, the S1 process includes: according to Lactobacillus casei gene GenBank:(MOAG00000000.1) and apply
Bioinformatics tools calculate each combined level-one characteristic parameter, prediction second level and antibacterial activity, design with therapeutic potential
Antibacterial peptide LHH1；The gene order of antibacterial peptide is translated into nucleic acid sequence according to preferences of the Escherichia coli to codon,
Its both ends adds Bsa I and HindIII restriction endonuclease sites and protectiveness base, and synthetic primer F1, R1 application are described to draw
The following SEQ ID NO.2 and SEQ ID NO.3 of the nucleotide sequence of object.
Moreover, the S2 process includes: building peptide expression plasmid pE-SUMO-LHH1 and identification is sequenced, gene is constructed
Simultaneously identification is sequenced in engineered strain pE-SUMO-EA-LHH1/Rosetta (DE3) pLysS, and SEQ ID NO.4 is identified in the sequencing,
Sequencing result is compared using NCBI Blast and designed gene, and choosing the two consistent recombinant bacterium of result is sequencing knot
The correct recombinant bacterium of fruit.
Moreover, including: by the correct recombinant bacterium of sequencing result in step S2 and containing pair of empty carrier during the S3
Plate culture, seed culture are carried out according to bacterium, IPTG inducing expression will be separately added into after thalli growth to logarithmic phase in fermentation liquid, so
SDS-PAGE analysis and HPLC analysis are carried out afterwards, are chosen and are expressed successful antibacterial peptide.
Moreover, the S4 process includes: that genetic engineering bacterium pE-SUMO-EA-LHH1/Rosetta (DE3) pLysS is big
Amount culture, induction collect thallus and obtain fusion protein, carry out affinitive layer purification, fusion protein after purification is through enterokinase
Cutting removal label, is then quantified, purification of samples retains.
Application of the novel lactic acid bacteria antibacterial peptide as preparation anticancer agent.
Novel lactic acid bacteria antibacterial peptide is as the application for preparing antibiotic preparation.
The invention has the benefit that
The present invention expresses a kind of novel antimicrobial peptide LHH1 from Lactobacillus casei, obtains the zymophyte of its high efficient expression
Strain, and confirm the antibacterial anticancer activity of LHH1, and the stability of LHH1 at different temperatures.
Present invention recombination bacillus coli obtained can be with high efficient expression LHH1, and cellular lysate object is to Staphylococcus aureus
The gram-positive bacterias such as bacterium (Staphylococcus aureus) have stronger bacteriostatic activity, to saccharomyces cerevisiae
Fungies such as (Saccharomyces cerevisiae) also have certain bacteriostatic activity, and even if under 100 DEG C of processing
LHH1 still remains stronger bacteriostasis.Antibacterial peptide addition after purification is layered in the cancer cell of 96 orifice plate cultures, it can be with
Significantly inhibit the increment of cancer cell.Not only analysis has found a kind of novel antimicrobial peptide LHH1 to the method for the present invention in lactic acid bacteria, also
The method for being provided for gene engineering expression, and LHH1 stability obtained is strong, has preferable antibacterial anticancer activity,
Excellent anticorrosive additive and leavening be can be used as in the industries such as food, drug, feed.
Detailed description of the invention
Fig. 1 is the gene map spectrogram of Lactobacillus casei；
Fig. 2 is the Sketch of secondary structure figure of antibacterial peptide LHH1；
Fig. 3 is the building process schematic diagram and recombinant expression of the expression plasmid pE-SUMO-EA-LHH1 of antibacterial peptide LHH1
The PCR of the plasmid of carrier is identified.
Fig. 4 is that the SDS-PAGE of antibacterial peptide LHH1 expression product is analyzed.
Fig. 5 is antibacterial peptide LHH1 high-efficient liquid phase chromatogram, and upper figure is the LHH1 after digestion, for determining that its structure is correct,
The following figure is LHH1 after purification.
The Tricine-SDS-PAGE analysis that Fig. 6 is LHH1 after purification.Wherein swimming lane 1 is the SUMO label of single expression
Albumen, swimming lane 2 are unpurified fusion protein --- SUMO label protein+antibacterial peptide LHH1, and swimming lane 3 is fusion after purification
Albumen, swimming lane 4 are the fusion protein after enterokinase digestion, and swimming lane 5 is the fusion protein after high-efficient liquid phase chromatogram purification.
Fig. 7 is the mass spectral analysis figure of antibacterial peptide LHH1.
Fig. 8 is to inhibit staphylococcus aureus calibrating to the antibacterial peptide LHH1 of expression, and 1 is the LHH1 of expression and purification；2 are
SUMO-LHH1 after expression and purification；3 be the SUMO albumen after expression and purification.
Fig. 9 is that antibacterial peptide LHH1 detects the MTT of cancer cell.
Figure 10 is the antibacterial peptide bacteriostatic activity for the treatment of of different temperature, and 1 is 40 DEG C, and 2 be 60 DEG C, and 3 be 80 DEG C, and 4 be 100 DEG C,
C is control group --- do not pass through heat-treated antibacterial peptide.
Figure 11 is the antimicrobial spectrum for the antibacterial peptide LHH1 that a large amount of bacteriostatic experiments summarize.
Specific embodiment
Below with reference to embodiment, the present invention is further described, and following examples are merely illustrative and not limiting,
This does not limit the scope of protection of the present invention.
The present invention provides a kind of application of the high efficient expression and antibacterial anticancer activity of novel lactic acid bacteria antibacterial peptide LHH1.Specifically
Content includes: to optimize LHH1 gene according to e. coli codon preferences, the LHH1 base after being optimized by PCR amplification
Cause, by the gene fragment clone into coli expression carrier pESUMO, building obtains pESUMO-LHH1 recombinant plasmid.It will
Recombinant plasmid transformed detects the expression for determining LHH1 through SDS-PAGE, through agar hole into Rosetta (DE3) PlysS
Diffusion method and cell mtt assay detection antibacterial and anticancer activity.In addition, for the thermal stability of detection antibacterial peptide LHH1, to it with not
After synthermal processing, its bacteriostatic activity of re-test.
As the result is shown: present invention recombination bacillus coli obtained can be with high efficient expression LHH1, and cellular lysate object is to gold
The gram-positive bacterias such as staphylococcus aureus (Staphylococcus aureus) have stronger bacteriostatic activity, to wine brewing ferment
Fungies such as female (Saccharomyces cerevisiae) also have certain bacteriostatic activity, and even if under 100 DEG C of processing
LHH1 still remains stronger bacteriostasis.Antibacterial peptide addition after purification is layered in the cancer cell of 96 orifice plate cultures, it can be with
Significantly inhibit the increment of cancer cell.Not only analysis has found a kind of novel antimicrobial peptide LHH1 to the method for the present invention in lactic acid bacteria, also
The method for being provided for gene engineering expression, and LHH1 stability obtained is strong, has preferable antibacterial anticancer activity,
Excellent anticorrosive additive and leavening be can be used as in the industries such as food, drug, feed.
Embodiment 1
A kind of preparation of novel lactic acid bacteria antibacterial peptide LHH1, nucleotide sequence are as follows；
Both ends respectively joined Bsa I and Hind III restriction endonuclease sites and protectiveness base, the protectiveness alkali
Base is two end sections.The amino acid sequence of the antibacterial peptide LHH1, molecular weight, charge number, isoelectric point, hydrophobicity are respectively as follows:
AFALIAGALYRIFHRR, 1875.25 ,+3,11.71,0.98.
The second technical problem to be solved by the present invention is to provide a kind of construction method of above-mentioned engineering bacteria.Technical solution is such as
Under:
The present invention is expanded, primer sequence by the gene order of fully synthetic antibacterial peptide LHH1 by round pcr
Are as follows:
F:TTTGGTCTCCAGGTGATGATGATGATAAAGCGTTTGCCTTAATCG
R:GGGGGGAAGCTTTCATTAACGACGATGAAATA
PCR reaction system: double distilled water (ddH2O) 41 μ L, 10 × PCR Buffer, 5 μ L, 1 dNTPMixture μ L, draw
Object F and each 1 μ L of R, Fast Pfu (5/ μ L) 1 μ L amount to 50 μ L.Said components are added in PCR reaction tube, after mixing instantaneously from
The heart makes fluid accumulation react bottom of the tube in PCR, is put into PCR instrument, and reaction condition is 95 DEG C of initial denaturation 5min, 56 DEG C of annealing
30s, 72 DEG C of extension 20s.72 DEG C of extension 10min after 30 circulations.After PCR, take 5 μ L PCR products in 2% containing EB
Agarose gel electrophoresis detection.- 20 DEG C of remaining product saves backup.
Embodiment 2
Construct antibacterial peptide LHH1 recombination bacillus coli genetic engineering bacterium
(1) cloning vector is constructed
The gene glue of antibacterial peptide is connect with pE-SUMO, is transformed into the competent cell of 5 α of Escherichia coli DH, and test
The correctness of confirmatory test result.
The preparation of competent cell: specific method is referring to TaKaRa Competent Cell Preparation Kit
The specification step of (200 secondary amounts).
The glue of PCR product recycles: specification step of the specific method referring to a small amount of plastic recovery kits of pillar.It takes after the completion
5 μ L recovery products are in the 2%Agarose gel electrophoresis detection containing EB.
LHH1 gene is inserted into the multiple cloning sites of coli expression carrier, building obtains LHH1 recombinant plasmid: will
After LHH1 gene and pE-SUMO plasmid Bsa I and Hind III double digestion, connect overnight through the 16 DEG C of water-baths of T4 DNA ligase
It connects, converts bacillus coli DH 5 alpha, on the LB culture medium flat plate containing 50 μ g/mL kanamycins, cultivate picking Dan Ke after 12h
It is grand, plasmid Bsa I and HindIII double digestion and PCR verifying are extracted, agarose gel electrophoresis detection has 48bp LHH1 purpose
The recombinant plasmid of segment is named as pE-SUMO-LHH1 after sequencing identification is correct.
Linked system needed for table 1 constructs plasmid
(2) by LHH1 recombinant plasmid transformed to Escherichia coli Rosetta (DE3) PlysS, LHH1 recombination large intestine bar is obtained
Bacterium.
1. the preparation of competent cell
Specific method is walked referring to the specification of TaKaRa Competent Cell Preparation Kit (200 secondary amounts)
Suddenly.
2. by recombinant plasmid transformed to host strain
100 μ L competent escherichia coli cell Rosetta (DE3) PlysS that -80 DEG C save are melted into 10min in ice,
It is mixed after being put into new centrifuge tube with the 1 μ L of recombinant plasmid of reaction overnight, 30min is placed in ice.42 DEG C of heating 90s, then in ice
Place 1min.The LB culture medium of 37 DEG C of 900 μ L preheatings, 37 DEG C of concussion 60min are added.In the fine jade containing 50 μ g/mL kanamycins
Overnight incubation on rouge plating medium is until form single colonie.Meanwhile empty carrier is transformed into Escherichia coli Rosetta (DE3)
Negative control is done in PlysS competent cell.White colony is selected, is identified using PCR method and double digestion method, and send
Huada gene company sequencing.Sequencing result is compared using NCBI Blast with designed gene.
Simultaneously identification is sequenced in building peptide expression plasmid pE-SUMO-LHH1, constructs engineering strain pE-SUMO-EA-
Simultaneously identification is sequenced in LHH1/Rosetta (DE3) pLysS, the sequencing identification are as follows: AGGTGATGATGATGATAAAGCGTTTGC
CTTAATCGCAGGCGCGTTATA TCGA ATATTTCATCGTCGTTAATGAAAGCT, sequencing result use NCBI Blast
It is compared with designed gene, choosing the two consistent recombinant bacterium of result is the correct recombinant bacterium of sequencing result.
Embodiment 3
The inducing expression of antibacterial peptide LHH1 fusion protein
The correct recombinant bacterium of sequencing result and the control bacterium containing empty carrier are inoculated in LB (OK a karaoke club by 1% inoculum concentration
Mycin) in fluid nutrient medium, after 37 DEG C of 220r/min are incubated overnight, the LB (kalamycin) of 10mL is inoculated in 1% inoculum concentration
Fluid nutrient medium, when 220r/min shaken cultivation to OD 600 is 0.6, takes 1.0mL bacterium solution as right before induction respectively by 37 DEG C
According to (0h), it is then respectively adding IPTG (final concentration of 100mg/mL) inducing expression, 25 DEG C are continued to cultivate, and 4h points after induction
1.0mL bacterium solution is not taken, and 12000r/min is centrifuged 1min and collects thallus, carries out ultrasonic cracking.Ultrasonication is 180W, in ice water
Carry out 20min.Then, 12000r/min is centrifuged 1min and collects cellular lysate object, after being resuspended with PBS, takes 10ul that 1 × albumen is added
After sample-loading buffer 40 μ L, boiling water bath 10min, using SDS-PAGE technology testing goal protein expression situation.Meanwhile it using
BCA protein quantification kit carries out protein quantification.The results showed that SUMO-EA-LHH1 is in recombination bacillus coli cellular lysate
High efficient expression is obtained in object, concentration can reach 78.57 μ g/mL.
Embodiment 4
The purifying of antibacterial peptide LHH1
SUMO-EA-LHH1 fusions are purified using Ni-NTA.Briefly, clear supernatant is with the stream of 1mL/min
Speed flows through pre-filled Ni-NTA agarose column.Then it is eluted with the elution buffer (40mM Tris-HCl) of three times column volume
Albumen；500mM NaCl, 300mM imidazoles, 8mM urea, pH 8.0.Eluent is collected, is removed and is desalted by dialysis.Recombinant protein
Expression and purifying are analyzed using 16.5% Ticine-SDS-PAGE gel.Using BCA protein quantification kit to egg
White concentration is quantified.
SUMO-LHH1 fusion protein is dissolved in the enterokinase reaction buffer (Tris-HCl of 50mM, pH 8.0,1mM
CaCl2, 0.1% Tween-20) in.The digestion of SUMO-EA-LHH1 fusion protein be enterokinase at 37 DEG C for 24 hours.To digestion
Product progress Tricine-SDS-PAGE is detected afterwards, while LHH1 is dissolved in initial liquid phase (acetonitrile: H2O=10:
90, contain 0.1% trifluoroacetic acid) in, it is detected using reversed-phased high performace liquid chromatographic (HPLC).Pillar used is C18 reverse-phase chromatography
30 DEG C of column (Kromasil-C18,4.6 × 250 millimeters, 5.0 μm).Eluent A is 1% TFA in water, and eluent B is in second
It is 0.1% TFA in nitrile.Sample is through eluent B linear gradient elution, eluent 20%~95%, steady flow in 25 minutes
Speed is 1mL/min.Detection wavelength is 220nm.Determining the protein quantity is carried out to fraction product.The result shows that: albumen is dense after purification
Degree is 8.375 μ g/mL.
Embodiment 5
The Mass Spectrometric Identification of antibacterial peptide LHH1
LHH1 albumen after purification is subjected to Mass Spectrometric Identification.Qualification result such as Fig. 7: after SUMO label protein is cut away, LHH1
Molecular size range it is correct.
The antibacterial anticancer activity of 6 antibacterial peptide LHH1 of embodiment is identified
(1) the antibacterial activity identification of antibacterial peptide LHH1
Using the antibacterial activity of agar hole diffusion method testing goal albumen, used pathogenic strain is golden yellow grape
Coccus.Pathogenic bacteria are crossed on LB solid medium culture, after growing single colonie, 37 DEG C in LB liquid medium
220r/min shaken cultivation.The above-mentioned four kinds bacterial strain suspension in logarithmic growth phase are diluted to 10 using plate dilution method8
A/μ L paves plate after taking 55 DEG C of LB liquid mediums of 15 μ L and 15mL to mix, and after to be solidified, is beaten with what high pressure sterilization was handled
Hole device (diameter 5mm) punching is added dropwise 20 μ L liquid respectively into every hole and (inhibits staphylococcus aureus calibrating, 1 is expression and purification
LHH1；2 be the SUMO-LHH1 after expression and purification；3 be the SUMO albumen after expression and purification).37 DEG C in biochemical cultivation case
After culture for 24 hours, the bacteriostatic activity of antibacterial peptide LHH1 is observed, as a result such as Fig. 8.Same method presses down more plants of harmful bacterias and beneficial bacterium
Bacterium effect measuring obtains antimicrobial spectrum such as Fig. 8 of LHH1 at present.Experiment analysis results: LHH1 is to staphylococcus aureus
Gram-positive bacterias such as (Staphylococcus aureus) have stronger bacteriostatic activity, to saccharomyces cerevisiae
Fungies such as (Saccharomyces cerevisiae) also have certain bacteriostatic activity
(2) the anticancer activity identification of antibacterial peptide LHH1
Using the anticancer activity of mtt assay detection LHH1, method is summarized as follows.1×104Uniform kind of cancer cell in 96 orifice plates
On, then, cultivated 24 hours with the LHH1 of various concentration.10 μ LMTT solution are added in every hole, continue to cultivate 4h.Discard supernatant
100 μ L DMSO solutions are added in liquid, every hole.10min is shaken, on horizontal shaker with Rong Xie formazan crystal.Finally, with
Microplate reader (Infinite M200 PRO, TECAN, Swiss) reads absorbance at 570nm.MTT result
Such as Figure 10.The results showed that LHH1 has stronger inhibiting effect to cancer cell.
Embodiment 7
The thermal stability of antibacterial peptide LHH1
The antibacterial peptide LHHI handled at different temperatures, as shown in Figure 10,1 is 40 DEG C, and 2 be 60 DEG C, and 3 be 80 DEG C, and 4 are
100 DEG C, C is control group (not passing through heat-treated antibacterial peptide).Using agar hole diffusion method testing goal albumen
Antibacterial activity, used pathogenic strain are staphylococcus aureus.The results showed that even if under 100 DEG C of processing
LHH1 still remains stronger bacteriostasis, it is seen that antibacterial peptide LHH1 thermal stability is fine.
Sequence table
(1) nucleotide sequence of antibacterial peptide LHH1
(2) amino acid sequence of antibacterial peptide LHH1
AFALIAGALYRIFHRR
(3) expression plasmid constructs the primer sequence
F:TTTGGTCTCCAGGTGATGATGATGATAAAGCGTTTGCCTTAATCG
R:GGGGGGAAGCTTTCATTAACGACGATGAAATA
Claims (9)
1. a kind of novel lactic acid bacteria antibacterial peptide, it is characterised in that: nucleotide sequence is as shown in SEQ ID NO.1.
2. novel lactic acid bacteria antibacterial peptide according to claim 1, it is characterised in that: the amino acid sequence of the antibacterial peptide,
Molecular weight, charge number, isoelectric point, hydrophobicity are respectively as follows: AFALIAGALYRIFHRR, and 1875.25 ,+3,11.71,0.98.
3. a kind of expression of novel lactic acid bacteria antibacterial peptide described in claim 1, it is characterised in that: the following steps are included:
S1. amino acid sequence described in claim 1 is synthesized, which is novel lactic acid bacteria antibacterial peptide gene；
S2. the genetic engineering bacterium of peptide recombined colibacillus containing antibacterial is constructed；
S3. the inducing expression of antibacterial peptide fusion protein；
S4. the purifying of antibacterial peptide.
4. the expression of novel lactic acid bacteria antibacterial peptide according to claim 3, it is characterised in that: the S1 process packet
Include: according to Lactobacillus casei gene GenBank:(MOAG00000000.1) and each combination is calculated using bioinformatics tools
Level-one characteristic parameter, prediction second level and antibacterial activity, design the antibacterial peptide LHH1 with therapeutic potential；According to Escherichia coli pair
The gene order of antibacterial peptide is translated into nucleic acid sequence by the preferences of codon, is limited at its both ends plus Bsa I and HindIII
Property restriction enzyme site and protectiveness base, synthetic primer F1, R1 application, the following SEQ ID of the nucleotide sequence of the primer
NO.2 and SEQ ID NO.3.
5. the expression of novel lactic acid bacteria antibacterial peptide according to claim 3, it is characterised in that: the S2 process packet
Include: simultaneously identification is sequenced in building peptide expression plasmid pE-SUMO-LHH1, constructs engineering strain pE-SUMO-EA-LHH1/
Simultaneously identification is sequenced in Rosetta (DE3) pLysS, and SEQ ID NO.4 is identified in the sequencing, sequencing result using NCBI Blast with
Designed gene compares, and choosing the two consistent recombinant bacterium of result is the correct recombinant bacterium of sequencing result.
6. the expression of novel lactic acid bacteria antibacterial peptide according to claim 3, it is characterised in that: wrapped during the S3
It includes: the correct recombinant bacterium of sequencing result in step S2 and the control bacterium containing empty carrier is subjected to plate culture, seed culture, it will
IPTG inducing expression is separately added into fermentation liquid after thalli growth to logarithmic phase, then carries out SDS-PAGE analysis and HPLC points
Analysis is chosen and expresses successful antibacterial peptide.
7. the expression of novel lactic acid bacteria antibacterial peptide according to claim 3, it is characterised in that: the S4 process packet
It includes: by genetic engineering bacterium pE-SUMO-EA-LHH1/Rosetta (DE3) pLysS mass propgation, induction, collecting thallus and obtain
Fusion protein carries out affinitive layer purification, and fusion protein after purification cuts removal label through enterokinase, is then quantified,
Purification of samples retains.
8. application of the novel lactic acid bacteria antibacterial peptide described in claim 1 as preparation anticancer agent.
9. novel lactic acid bacteria antibacterial peptide described in claim 1 is as the application for preparing antibiotic preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811548163.8A CN110105433B (en) | 2018-12-18 | 2018-12-18 | Lactic acid bacteria antibacterial peptide and application of high-efficiency expression and antibacterial and anticancer activity |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811548163.8A CN110105433B (en) | 2018-12-18 | 2018-12-18 | Lactic acid bacteria antibacterial peptide and application of high-efficiency expression and antibacterial and anticancer activity |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110105433A true CN110105433A (en) | 2019-08-09 |
| CN110105433B CN110105433B (en) | 2022-06-14 |
Family
ID=67483663
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811548163.8A Active CN110105433B (en) | 2018-12-18 | 2018-12-18 | Lactic acid bacteria antibacterial peptide and application of high-efficiency expression and antibacterial and anticancer activity |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110105433B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110746488A (en) * | 2019-10-17 | 2020-02-04 | 广东海洋大学 | Bacteriocin PE-ZYB1 with food preservative and fresh-keeping functions and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105218643A (en) * | 2015-10-30 | 2016-01-06 | 四川大学 | A kind of synthesis of lactobacterium casei antibacterial peptide and antibody preparation |
| US20210267232A1 (en) * | 2020-02-28 | 2021-09-02 | Terragen Holdings Limited | Microbial feed supplement composition and method |
-
2018
- 2018-12-18 CN CN201811548163.8A patent/CN110105433B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105218643A (en) * | 2015-10-30 | 2016-01-06 | 四川大学 | A kind of synthesis of lactobacterium casei antibacterial peptide and antibody preparation |
| US20210267232A1 (en) * | 2020-02-28 | 2021-09-02 | Terragen Holdings Limited | Microbial feed supplement composition and method |
Non-Patent Citations (4)
| Title |
|---|
| JUN-FANG HE等: "LHH1, a novel antimicrobial peptide with anti-cancer cell activity identified from Lactobacillus casei HZ1", 《AMB EXPRESS》 * |
| K. MAKAROVA等: "Comparative genomics of the lactic acid bacteria", 《PNAS》 * |
| 贺军芳等: "新型抗菌肽LHH1的重组表达及对肠道微生态的影响", 《食品科技》 * |
| 陈飞龙等: "抗菌肽F1对金黄色葡萄球菌的胞内作用机制", 《食品科学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110746488A (en) * | 2019-10-17 | 2020-02-04 | 广东海洋大学 | Bacteriocin PE-ZYB1 with food preservative and fresh-keeping functions and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110105433B (en) | 2022-06-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11479516B2 (en) | Nitrogen fixation using refactored NIF clusters | |
| CN106967659A (en) | A kind of structure and fermentation process of the antibiotic-free resistance recombined bacillus subtilis for expressing glutamate decarboxylase | |
| CN110922457B (en) | Plant immune induced resistance protein FgPII1 secreted by fusarium graminearum and application thereof | |
| CN105238809A (en) | Expressing method of antimicrobial peptide CC31 in bacillus subtilis | |
| CN107857803A (en) | Natural antibacterial peptide and its application | |
| CN105062992B (en) | A kind of endolysin and the polynucleotides for encoding this endolysin | |
| CN105255935A (en) | Expression method of antimicrobial peptide CC34 in bacillus subtilis | |
| CN101812459A (en) | Nucleic acid for encoding antimicrobial peptide Lactoferricin B and prokaryotic expression method thereof | |
| CN104726429B (en) | A kind of bacterial virus catenase of the fungistatic effect with enhancing | |
| CN112852794B (en) | Clostridium perfringens bacteriophage lyase and application thereof | |
| CN107266585B (en) | A kind of MLH fusion antibacterial peptide and its preparation method and application | |
| CN104212757A (en) | Method for high-efficiently producing L-theanine through production of coli [gamma]-glutamylmethylamine synthetase with escherichia coli | |
| CN108148123B (en) | Natural antibacterial peptide of burned soil hypha fungi and application thereof | |
| CN106366172A (en) | Bigeminal peptide Cec Md2ys, preparation method and application | |
| CN110105433A (en) | The application of novel lactic acid bacteria antibacterial peptide and high efficient expression and antibacterial anticancer activity | |
| CN104152472A (en) | Diguanylate cyclase gene, vector, engineering bacteria and application | |
| CN104530204B (en) | A kind of rape cecropin B gene nPRP1 and its application | |
| CN110295134A (en) | A kind of building and its application of surface display c-type perfringens alpha, β toxin protein recombinant plant lactobacillus | |
| CN111139207B (en) | Brevibacillus brevis gene recombinant strain and preparation method and application thereof | |
| CN111139208B (en) | High-yield engineering bacterium for producing ivermectin and preparation method and application thereof | |
| CN106336452A (en) | Group of NZ2114 histidine mutants, and preparation method thereof | |
| CN102174553A (en) | Preparation method of exfoliative toxin C (ExhC) proteins of staphylococcus sciuri | |
| CN109251936B (en) | Smooth turtle shell serine protease inhibitor fusion protein and preparation and application thereof | |
| CN102408475B (en) | Bt protein Cryt1Da1, and coding gene and application thereof | |
| CN110028561A (en) | A kind of antibacterial protein and its encoding gene and isolation and purification method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |