CN104530204A - Rape antibacterial peptide BnPRP1 and application thereof - Google Patents
Rape antibacterial peptide BnPRP1 and application thereof Download PDFInfo
- Publication number
- CN104530204A CN104530204A CN201410801776.3A CN201410801776A CN104530204A CN 104530204 A CN104530204 A CN 104530204A CN 201410801776 A CN201410801776 A CN 201410801776A CN 104530204 A CN104530204 A CN 104530204A
- Authority
- CN
- China
- Prior art keywords
- bnprp1
- gene
- antibacterial peptide
- eddie
- rape
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/10—Animals; Substances produced thereby or obtained therefrom
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
Abstract
The invention discloses a rape antibacterial peptide BnPRP1 and application thereof. The invention provides a rape antibacterial peptide BnPRP1 of which the sequence is shown by SEQ ID No.2. Artificial synthesis of the gene is finished by an overlap PCR method, and the synthesized antibacterial peptide gene is cloned onto a pET30a/His-EDDIE-GFP expression vector and transformed into escherichia coli to be expressed in vitro, and an antibacterial peptide product without increasing any redundant amino acid is obtained. The result of antibacterial activity detection indicates that the antibacterial peptide BnPRP1 has relatively strong antibacterial activity against bacteria and fungi. A detached leaf smearing inoculation experiment proves that the BnPRP1 can remarkably enhance the resistance of plants against saprophytic nutritional fungi: sclerotinia sclerotiorum, botrytis cinerea, rhizoctonia solani and gray speck fungi. The BnPRP1 can be used for preventing and controlling sclerotinia sclerotiorum, gray mold, damping off and grey speck disease as a biocontrol agent, and also can be used for breeding the disease-resistant varieties of rape as a resistant marker.
Description
Technical field
The present invention relates to genetically engineered and biological technical field.Be specifically related to a kind of rape cecropin B gene nPRP1 and application thereof.
Background technology
Pathogenic bacteria can cause and comprises the mankind, livestock, the serious plant disease of crop and other biological, causes serious financial loss.Plant pathogenic fungi is the important pathogen of plant, Plant diseases (the Zhang Fuli of more than 80% can be caused, Wang Zhanbin, Wang Zhiying. the effect of chitinase in Genes For Plant Tolerance fungal disease. forestry science and technology .2006,31 (3): 24-27), cause world food crop failure about 20% (Knight S.C., Anthony V.M., Brady A.M., et al.Rationale and perspectives on the developmentof fungicides.Annu Rev Phytopathol, 1997,35:349-372).Many important Plant diseasess are all that fungi is caused, and as the late blight of potato, rice blast, wheat powdery mildew, corn northern and southern leaf blight bacterium, grey speck of soybean, sclerotinia rot of colza etc., all cause very huge financial loss every year.On the other hand, fungi is in the process infecting plant, and the meta-bolites discharged---mycotoxins (mycotoxin), also causes great harm to the health of farm crop and the mankind, as aflatoxin (aflatoxin) etc.
Sclerotinite (Sclerotinia sclerotiorum) belongs to Ascomycotina, discomycete, Helotiales, Sclerotiniaceae, Sclerotinia.It is the global important phytopathogen of a kind of damage to crops and vegetables.Sclerotinite can infect a lot of unifacial leaf and dicotyledons widely.The microbial sclerotium disease of nuclear disk is a kind of saprophytic nutrition type fungi being similar to grey mold, and this destructive pathogeny infects more than 400 kind of plant, widely distributed.At present mainly chemical pesticide is relied on to the control of sclerotium disease, however chemical prevention not only cost is high, contaminate environment, and preventive effect is also undesirable; Meanwhile, the security of food is also had a strong impact on.Rape is one of important in the world oil crops, and sclerotium disease causes the root of rape, and rotting of stem and angle fruit, result in huge production loss.Although sclerotium disease serious threat agriculture production, plant is to the molecular mechanism of the host-resistance of sclerotinite, we still know little about it.Rape cultivation kind (the Liu of immunity or high resistance completely is not also found up till now, S., Wang, H., Zhang, J., Fitt, B.D., Xu, Z., Evans, N., Liu, Y., Yang, W., and Guo, X.2005.In vitro mutation and selection of doubled-haploid Brassica napus lines with improved resistance to Sclerotinia sclerotiorum.Plant Cell Rep.24:133-144), therefore, probe into the resistance mechanism of plant to this pathogeny, find that new resistant gene has far reaching significance.
Botrytis cinerea (Botrytis cinerea), also known as the pathogen of Botrytis cinerea, is a kind of wide host's property, can cause the downright bad nutritional type pathogenic fungi of more than 200 kind of known plants (as fruit, vegetables and flowers) gray mold.It extensively distributes in atmosphere, can not only infect field crops, brings about great losses can to equally the latter stage of adopting of plant.Botrytis cinerea can (0 DEG C) growth under cryogenic, propagating, compared with other postharvest pathogenic fungi, having the advantage that latent infection and low temperature are pathogenic by producing a large amount of grey conidiums.Meanwhile, it also has the feature that breeding is fast, heritable variation is large and fitness is high.The fruits and vegetables run in daily life are put for some time and can be become mildewed, and majority may be just receive infecting of botrytis cinerea.Gray mold is just popular in Europe and America at first, just starts to spread in China from the eighties in 20th century.Due to popularizing of greenhouse and greenhouse gardening technology, crop grey mold disease is serious, has become the key constraints that vegetables, flowers and forestry seedling cultivation base produce.End 2013, not yet find that there is any one plant in the world and resistance (Chen Qi, Dinke heavily fortified point, Tan Genjia, Zhang Xiaowei, ash arrhizus bacteria bacterial strain variation of drug resistance and heredity research thereof are produced to botrytis cinerea.The academic symposial of 2003 East China plant pathology and plant pathology association of Jiangsu Province the tenth member representative assembly collection of thesis).Therefore find that the gene of new anti-botrytis cinerea has profound significance.
Dry thread Pyrenomycetes (Pyricularia grisea Sacc) is a genus of basidiomycetes Invisible element, pathogenic complexity, metamorphosis is large, host range is wide, it is the fungi that a class is widespread in nature, it is distributed widely in global farming and non-farming, and is easy to be separated from infected plant and soil obtain.The host range of rhizoctonia widely, have many Plant diseasess to be belong to fungi thus to cause, can hazard rice, potato, tobacco, wheat, peanut, cotton, rape, sesame, soybean, Chinese cabbage, Plantula Brassicae chinensis, various wild cabbage, Cauliflower, spinach, celery, muskmelon, bottle gourd, Solanaceae and various oranges and tangerines and a large amount of vegetables.This kind of fungi mainly causes overworked sick and damping-off in the seedling stage of plant, also the banded sclerotial blight of cereal crop is caused, thus research interest (yellow Jiang Hua of many phytopathologists and classification of fungi scholar is caused, Yang Mei, Zhou Erxun, Qi Peikun, rhizoctonia progress, Zhongkai University of Agriculture And Technology 2002,15 (1): 61-67; Lilja A; HE1TALAA M; KARJALAINEN R Identification of a uninucleate Rhizoctonia sp.By pathogenicity, hyphal anastomosis and RAPD analysis 1996).
At present conventional disease control measure, mainly relies on chemical pesticide, however chemical prevention not only cost is high, contaminate environment, and preventive effect is also undesirable; Meanwhile, the security of food also can be had a strong impact on.Along with the progress of society, people more and more profoundly recognize that the long-term a large amount of chemical pesticide that uses is to the harm of ecotope and human health.Biological control can overcome these drawbacks effectively, and thus biological pesticide is more and more subject to people's attention.
Antibacterial peptide (antimicrobial peptides, AMPs) be the natural small molecule albumen that a class has anti-microbial activity, extensively be present in organic sphere, it is the important component part of body non-specific immunity, external in vivo all have anti-microbial activity (Gordon YJ, Romanowski EG, A Review of Antimicrobial Peptides and Their Therapeutic Potentialas Anti-Infective Drugs.Curr Eye Res.2005,30 (7): 505 – 515).The biologic activity widely of antibacterial peptide, very strong restraining effect is had to bacterial fungus, protozoon, virus and tumour etc., there is efficient, environmental protection, do not make pathogenic bacteria produce the advantages such as resistance to make it in biological control and (the Gordon YJ that medically has a good application prospect, Romanowski EG, A Review of Antimicrobial Peptides and Their Therapeutic Potential as Anti-Infective Drugs.Curr Eye Res.2005,30 (7): 505 – 515).Genetic engineering of plant for disease resistance, breeding feed additive are become in recent years, the study hotspot of food preservatives, emerging medicine and other fields, antibiotic ideal substitute (Boman HG in diseases prevention and treatment field, Peptide antibiotics and their role in innateimmunity.Annu Rev Immuno1.1995,13:6l-92).In agricultural production process, carry out with antibacterial peptide the threat that plant protection work can avoid agricultural antibiotic to be produced human body by the transmission of food chain.
According to aminoacid sequence and secondary structure, the Antimicrobial Peptides From Plants found can be divided into plant alexin (plant defensins), lipid transfer proteins (1ipidtransfer proteins, LTPs), thionin (thionins), ecdysone (snakins), hevein class (hevein-like), plain class of tiing a knot (knottin-like peptides), Flower of Garden Balsam element (IbAMP), recently the shepherd's purse element (shepherdins) found, (the Hancock REW such as cyclic peptide (cyclotides), Chapple DS, Peptide Antibiotics.AntimicrobAgent Chemother, l999, 43 (6): l3l7-l323).Antibacterial peptide all has some general character substantially, as: small-molecular-weight (<10KDa), cationic surface, positive charge and amphipathic, these characteristics make antibacterial peptide also can be inserted into cell interior with cytolemma binding, and most of antibacterial peptide is by destroying cytolemma thus making target cell death and reach sterilization object.And other antibacterial peptides can be entered into cell interior destruction cell and not destroy cytolemma (Vogel PMHaHJ:Structure – function relationships of antimicrobial peptides.Biochem CellBiol 1998,76:235-246.) by the ionic channel on cytolemma.The sterilization mode of proline rich class antibacterial peptide (PRPs) is not exactly by destroying cytolemma, but (the L.Otvos J:The short proline-rich antibacterial peptidefamily.Cellular and Molecular Life Sciences 2002,59:1138-1150.) that utilize the mode of ionic channel to carry out.The antimicrobial peptide of plant origins of most of type does not all have toxicity (Murad AM.Pelegrini PB.Neto SM.Novel Findings ofDefensins and their Utilization in Construction of Transgenic Plants.Transgenic Plant Journal 2001 (1): 39-48) to animal and plant cell.Compared with animal source antibacterial peptide, antimicrobial peptide of plant origins is easier to express in crop and regulation and control, is not easy by intracellular proteasome degradation.Compared with other sterilant, the impact of antibacterial peptide on environment of plant origin is less, more friendly, have more potentiality (the Hancock REW that exploitation becomes antimycotic biotechnological formulation, Chapple DS, Peptide Antibiotics.Antimicrob Agent Chemother, l999,43 (6): l3l7-l323).As fermented in the Antimicrobial Peptides From Plants channel genes microorganisms such as Rs-AFPs, more easily overcoming and the toxic action of host is produced in a large number.
The small-molecular peptides of antibacterial peptide to be a class to the microorganism such as bacterium, fungi have suppression or killing action, it can by bacterium, fungi or physics, the stimulation of chemistry induce, even some antibacterial peptide can form the expression of composition in plant materials.It can not only resist various bacteria, and can press down fungicidal, virus etc., can be used for transforming crop plants, cultivates disease-resistant variety, thus have broad application prospects in plant breeding genetically engineered field.First succeed in model plant tobacco and potato resistance to bacterial wilt are studied, subsequently in the fire blight of pear of rice leaf spot bacteria and slice germ apple, in the bacterium of the crops such as chrysanthemum, capsicum, eggplant, mycosis research, all achieve certain effect.(the Ren Yuxia such as P. infestans resistant can be obtained by radish antibacterial peptide gene (AFP) transgenosis to potato, Chen Lingna, Chen Jifeng, Chen Zhenghua, potato turns the acquisition of radish antibacterial peptide gene plant and the preliminary evaluation of anti-late blight, China's Vegetable 2012 (6): 68-73).
Antimicrobial peptide of plant origins has broad-spectrum antifungal or bacterial activity, the antibacterial peptide found in a kind of plant can effectively be applied in other various plants, antibacterial peptide as originated in radish can forward by transgenic method the effect (Wei Yujie reaching the anti-late blight of potato and wheat sickle-like bacteria in fruit of Nakedcaule poppy, potato and wheat respectively to, Zhang Meixiu, Chang Ying, Luo Shuzhen, Chen Lingna, fruit of Nakedcaule poppy pollen mediation turns radish antibacterial peptide gene technique study, agriculture of gansu science and technology 2009 (11): 6-9; Ren Yuxia, Chen Lingna, Chen Jifeng, Chen Zhenghua, potato turns the acquisition of radish antibacterial peptide gene plant and the preliminary evaluation of anti-late blight, China's Vegetable 2012 (6): 68-73; Zhao Li, Miaoping Zhou, Zengyan, ZhangLi, juan Ren, LipuDu, Boqiao Zhang, Huijun Xu, Zhiyong Xin, Expression of a radish defensin in transgenic wheat confers increased resistance to Fusarium graminearum and Rhizoctonia cerealis Funct Integr Genomics 2011,11:63 – 70).Antibacterial peptide as emerging disease-resistant gene resource, to crop such as improvement paddy rice, soybean, cotton, rape etc. to the resistance important in inhibiting of fungal disease.
Antibacterial peptide is because of the Antibacterial Mechanism of its uniqueness, the germ resistance of wide spectrum and not easily produce the features such as resistance, good application prospect is had in all trades and professions, therefore more next many concerns have also been subjected to, become study hotspot (HancockREW, Chapple DS, the Peptide Antibiotics.Antimicrob Agent Chemother of Disciplinary Frontiers, l999,43 (6): l3l7-l323).But the antibacterial peptide of current plant origin is also difficult to really be applied in agricultural production practice.Mainly there is the plant origin antibacterial peptide quantity of function little because of what identify at present, thus greatly limit the application of Antimicrobial Peptides From Plants.Reach more than 1600 at present through the antibacterial peptide gene of checking in antibacterial peptide database, and Antimicrobial Peptides From Plants only has less than 300 (http://ercbinfo1.ucd.ie/APPDb/).The major cause that certified plant origin antibacterial peptide gene quantity is few is as follows: 1, antibacterial peptide gene is relatively little, easily degrades, and content is low, is difficult to detect and qualification; 2, antibacterial peptide molecular weight is little, separation and purification difficulty, and extraction step is loaded down with trivial details, yield is low; 3, vivoexpression purification difficult, causes being difficult to carry out In Vitro Bacteriostatic and detects authentication function; 4, shortage predicts screening method efficiently; 5, antibacterial peptide chemosynthesis cost is high, expensive.How efficiently prediction has the new plant antibacterial peptide of function, realizes its horizontal expression and reduces costs the bottleneck becoming current antibacterial peptide research and apply.
Be responsible for by present invention applicant Inst. of Oil Crops, Chinese Academy of Agriculture, vegetables institute of the Chinese Academy of Agricultural Sciences, BGI-Shenzhen, Hua Zhong Agriculture University, Hunan University, Agricultural University Of Southwest, Jiangsu academy of agricultural sciences, Sichuan academy of agricultural sciences, Qinghai University, and absorb English, Australia, beautiful, Fa Deng state related research institutes scientific research personnel cooperates the genome sequencing and the analysis that complete wild cabbage and rape, wild cabbage and rapeseed gene group partial results paper deliver (Shengyi Liu, Yumei Liu, Xinhua Yang, Chaobo Tong, David Edwards, Isobel A.P.Parkin, Meixia Zhao, Jianxin Ma, Jingyin Yu, Shunmou Huang, Xiyin Wang, Junyi Wang, Kun Lu, Zhiyuan Fang, Ian Bancroft, Tae-Jin Yang, Qiong Hu, XinfaWang, Zhen Yue, Haojie Li, Linfeng Yang, Jian Wu, Qing Zhou, Wanxin Wang, Graham J.King, J.Chris Pires, Changxin Lu, ZhangyanWu, Perumal Sampath, ZhuoWang, Hui Guo, Shengkai Pan, Limei Yang, Jiumeng Min, Dong Zhang, Dianchuan Jin, Wanshun Li, Harry Belcram, Jinxing Tu, Mei Guan, Cunkou Qi18, Dezhi Du1, JianaLi, Liangcai Jiang, Jacqueline Batley, Andrew G.Sharpe, Beom-Seok Park, Pradeep Ruperao, Feng Cheng, Nomar Espinosa Waminal Yin Huang, Caihua Dong, LiWang, Jingping Li, Zhiyong Hu, Mu Zhuang, Yi Huang, Junyan Huang, Jiaqin Shi, Desheng Mei, Jing Liu, Tae-Ho Lee, Jinpeng Wang, Huizhe Jin, Zaiyun Li, Xun Li, Jiefu Zhang, Lu Xiao, Yongming Zhou, Zhongsong Liu, Xuequn Liu, Rui Qin, Xu Tang, Wenbin Liu, YupengWang, Yangyong Zhang, Jonghoon Lee, Hyun Hee Kim, France Denoeud, Xun Xu, Xinming Liang, Wei Hua, Xiaowu Wang, Jun Wang, Boulos Chalhoub & Andrew H.Paterson.TheBrassica oleracea genome reveals the asymmetrical evolution of polyploid genomes.2014.Nature Communication.5:3930., Chalhoub B, Denoeud F, Liu S, Parkin IA, Tang H5, Wang X, Chiquet J, etc.Plant genetics.Early allopolyploid evolution in the post-Neolithic Brassica napus oilseed genome.Science.2014,22, 345 (6199): 950-3.).Chinese cabbage, wild cabbage and swede type rape genome sequencing information have been set up can for database http://www.ocri-genomicls.org/bolbase (the Cheng F of applicant's inquiry, Liu S, Wu J, Fang L, Sun S, Liu B, Li P, Hua W, Wang X:BRAD.the genetics and genomics database for brassica plants.BMC Plant Biol, 2011,11:136; JingyinYu, Meixia Zhao, Xiaowu Wang, Chaobo Tong, Shunmou Huang, Sadia Tehrim, Yumei Liu, Wei Hua and Shengyi Liu.Bolbase:a comprehensive genomics database for Brassica oleracea.BMC Genomics, 2013,14:664).By using bioinformatic analysis means, utilize above-mentioned resource, the Predicting and analysis of gene can be carried out, obtain the preliminary election gene that large batch of and known antibacterial peptide has similar sequence constitutional features, therefrom screening interested gene, is the shortcut excavating gene fast.And the mrna length of antibacterial peptide own is little, PCR synthetic technology can be utilized, low cost Fast back-projection algorithm, not need cDNA sequence to do template and carry out the work such as clone, greatly can accelerate the speed of acquisition antibacterial peptide and reduce research difficulty.
Applicant utilizes swede type rape to organize transcript profile sequencing data, develops the method for a potential novel antimicrobial peptide gene of forecast analysis, obtains antibacterial peptide new gene BnPRP1.This gene belongs to proline rich class antibacterial peptide (PRPs), in this kind of antibacterial peptide aminoacid sequence, proline content is more than 30%, existing antibacterial activity also has anti-mycotic activity (Cabras T, Longhi R, Secundo F, Nocca G, Conti S, Polonelli L, Fanali C, Inzitari R, Petruzzelli R, Messana I et al:Structural and functional characterization of the porcine proline-rich antifungalpeptide SP-B isolated from salivary gland granules.J Pept Sci 2008, 14 (3): 251-260.).In conjunction with gene engineering method and utilize a novel antibacterial peptide vivoexpression carrier pET30a/His-EDDIE-GFP (Tao Ke with self cleavage function, Su Liang, Jin Huang, Han Mao, Jibao Chen, Caihua Dong, Junyan Huang, Shengyi Liu, Jianxiong Kang, Dongqi Liu, Xiangdong Ma, A novel PCR-based method forhigh throughput prokaryotic expression of antimicrobial peptide genes.BMC Biotechnol 2012, 12:10.), this research achieves the amalgamation and expression of BnPRP1 in intestinal bacteria, renaturation, self cleavage and purifying, obtain and there is bioactive BnPRP1 protein product.With cup-plate method (Jiang Huilan. cup-plate method measures the influence factor of titer of antibodies and control method. Chinese veterinary drug magazine .2011, (08) 23-36), with the reference culture that intestinal bacteria, Sarcina lutea are Gram-negative bacteria and gram-positive microorganism, carry out bacteriostatic activity using yeast as the BnPRP1 albumen of the indicator of fungi to purifying to detect, find that BnPRP1 gene can the growth of effectively anti-bacteria (intestinal bacteria and Sarcina lutea) and fungi (yeast, sclerotinite, botrytis cinerea, sheath blight fungus and greyness bacterium).This research is laid a good foundation for utilizing bioinformation means and genetic engineering technique Large scale identification new plant to carry out derived antimicrobial peptide, provides a kind of new approach.In addition BnPRP1 can be used as biological reagent and sprays the resistance improving plant against fungal disease in plant surface, simultaneously, auxiliary breeding for disease resistance can also be used for as recruit's mark, plant genetic engineering can also be used for, to cultivate disease-resistant transgenic plant as a new gene source.
Summary of the invention
The object of the invention is to there are provided a rape cecropin B gene nPRP1 had fungus and bacterium bacteriostatic activity, its sequence is for shown in SEQ ID NO.2.This antibacterial peptide length is 35 amino acid, and wherein proline(Pro) is 13, and this antibacterial peptide can strengthen the resistance of plant to saprophytic nutrition type fungi Sclerotinia sclerotiorum, botrytis cinerea, greyness bacterium and dry thread Pyrenomycetes.
Another object of the present invention there are provided nucleotide sequence corresponding to rape cecropin B gene nPRP1, and preferred sequence is the nucleotide sequence shown in SEQ ID NO.1 and SEQ ID NO.3.
A further object of the invention there are provided the synthetic method of rape cecropin B gene nPRP1 gene, and method is simple.Utilize DNAWorks Software tool, by codon optimized design primer sequence, adopt Overlap-PCR technology synthesis BnPRP1 gene order.
Another object of the present invention is the preparation method that there are provided rape cecropin B gene nPRP1, adopts Pestivirus suis protein mutant EDDIE to be fusion rotein; After inclusion body protein purifying, renaturation, EDDIE correctly folds again, recovers its self cleavage ability, at specific site Cys168 and 169 places, the antibacterial peptide that C end merges is sheared, thus obtains the antibacterial peptide product not increasing any additional amino acid.
Last object of the present invention there are provided the application of rape cecropin B gene nPRP1 in preparation antibacterials, this antibacterial peptide can strengthen the resistance of plant to saprophytic nutrition type fungi Sclerotinia sclerotiorum, botrytis cinerea, greyness bacterium and dry thread Pyrenomycetes, can also suppress to be applied to biological control and breeding for disease resistance simultaneously.
In order to complete above-mentioned purpose, the present invention adopts following technical scheme:
In order to obtain the present invention, applicant has carried out deeply comprehensively analysing and comparing and prediction to the genes involved of sclerotium disease anti-in rapeseed gene group and existing antibacterial peptide database, found that the novel antibacterial peptide gene that a proline content is greater than 30%, by having carried out activation analysis to after the external synthesis of this gene and abduction delivering, protein purification, find that this gene not only has antibacterial activity and also has anti-mycotic activity.This invention exploits the BnPRP1 gene that strengthens plant against fungal resistance, the antibacterial peptide of BnPRP1 genetic expression not only has antibacterial activity and also has anti-mycotic activity (comprising yeast, sclerotinite, botrytis cinerea, greyness bacterium and dry thread Pyrenomycetes) in bacteriostatic activity test, imply that this gene has suitable application prospect in the breeding of rape anti-sclerotium disease.
The acquisition of rape antibacterial peptide gene BnPRP1:
Rape leaf has been carried out in current applicant laboratory, and the express spectra order-checking of angle fruit, obtains a large amount of ESTs data message.Simultaneously by Chinese cabbage, wild cabbage and rape and genome sequencing project, construct they Genomic sequence information storehouse (
http: // www.ocri-genomicls.org/bolbase).Utilize these sequence informations and special antibacterial peptide database, as ANTIMIC (Brahmachary M, Krishnan SPT, Koh JLY, et al.ANTIMIC:a database of antimicrobialsequences.Nucleic Acids Research, 2004, 32:D586-D589, identical below), APD (Wang Z, Wang GS.APD:the Antimicrobial Peptide Database.Nucleic Acids Research, 2004, 32:D590-D592, identical below) APPDB (http://ercbinfo1.ucd.ie/APPDb/, identical below), PhytAMP (Hammami R, Hamida JB, Vergoten G, et al.Phytamp:a database dedicated to plant antimicrobial peptides.Nucleic Acids Res.2009, 37:D963-D968, identical below) etc. carry out BLAST comparison (Nucleotide similarity >90% and Identity>90%), obtain the preliminary election gene that large batch of and known antibacterial peptide sequence has similar structures feature.Subsequently to protein sequence (Vector NTI10) and the secondary structure structure (nnpredict:http: //www.cmpharm.ucsf.edu/nomi/nnpredict predictionprotein of these preliminary election genes, identical below) carry out Predicting and analysis, thus set up protein three-dimensional structure figure, secondary structure and function is utilized to build storehouse to the classification that filtered out antibacterial peptide carries out protein families, thus the novel antimicrobial peptide gene that final acquisition is potential.Be numbered EV168192.1, called after BnPRP1.Gene BnPRP1 nucleotides sequence is classified as shown in SEQ ID NO.3, and the aminoacid sequence of cecropin B gene nPRP1 is for shown in SEQ ID NO.2.A preparation method for external synthesis rape BnPRP1 gene, step is as follows:
Codon optimized and the external synthesis of rape BnPRP1 gene
According to the DNA sequence dna of BnPRP1 gene, design primer sequence, synthetic primer 6 covers the primer of BnPRP1 total length altogether, is respectively BnPEV168192_1, BnPEV168192_2, BnPEV168192_3, BnPEV168192_4, backboneF and backboneR.Primer sequence is as shown in table 1,
Table 1 overlap PCR primer sequence
Overlap-PCR technology is adopted to obtain BnPRP1 full length gene.PCR reaction system is as follows: total reaction system is 50 μ L, includes: 10 × Taq buffer is (containing MgCl
2) 10 μ l, 1.5mmol/L dNTP (10mmol/L) 4 μ l, primer backboneF1 and backboneR respectively adds 1 μ l (concentration is 10mmol/L), primer BnPEV168192_1, BnPEV168192_2, BnPEV168192_3 and BnPEV168192_4 respectively adds 1 μ l (concentration is 2mmol/L), Taq (5U/ μ l) 1 μ l, ddH
2o 33 μ l.Reaction conditions be 94 DEG C 5 minutes, 94 DEG C 1 minute, 58 DEG C 1 minute, 72 DEG C 2 minutes 30 seconds, 25 circulations, after 72 DEG C extend 10 minutes, amplification size is 108bp.
PCR primer is through qualification order-checking, and checking order correct is the cecropin B gene nPRP1 gene after optimization, and its sequence is for shown in SEQID NO.1.
The preparation method of cecropin B gene nPRP1, comprises the following steps:
1) structure of fusion expression vector EDDIE-BnPRP1
Adopt inverse PCR technique, BnPRP1 gene is connected on expression vector pET30a/His-EDDIE-GFP.Be specially and utilize 30abackbone-F:TGAGATCCGGCTGCTAACAAAGCCC and 30abackbone-R:GCAGCTGGTCACCCACAGCG primer, by Inverse PCR amplification, by pET30a/His-EDDIE-GFP vector linearization.By the pET30a/His-EDDIE-GFP linearized vector fragment be recovered to and the BnPRP1 full length DNA fragment reclaiming and obtain that increased by Overlap-PCR, transformation of E. coli XL10-Gold bacterial strain simultaneously, by homologous recombination of fixing a point in body, BnPRP1 gene is connected on expression vector pET30a/His-EDDIE-GFP, obtains goal gene fusion expression vector EDDIE-BnPRP1.
2) the external evoked expression of cecropin B gene nPRP1 and separation and purification
To be checked order correct fusion expression vector EDDIE-BnPRP1 plasmid, be transformed in BL21 (DE3) competent cell by heat shock method, obtain EDDIE-BnPRP1 amalgamation and expression engineering bacteria BL21 (DE3)/pETNB.Utilize usual manner to cultivate in LB liquid nutrient medium and inducible protein expression, the bacterial cell disruption of acquisition is centrifugal, after supernatant purifying, obtains target protein cecropin B gene nPRP1, and its sequence is for shown in SEQ ID NO.2.
The application of rape cecropin B gene nPRP1 in preparation antibacterials, comprises and this antibacterial peptide is directly prepared into antibacterials, all have stronger bacteriostatic activity to bacterium and fungi; Sprayed on plant leaf surface, the germ resistance of plant can be strengthened, particularly improve plant to the resistance to the fungal disease such as sclerotinite, botrytis cinerea, vertical withered screw mandrel bacterium, greyness bacterium, BnPRP1 gene is utilized molecular biological means process LAN in rape or other plant, preparation can the transgenic plant of antimycotic and bacterium.
The present invention compared with prior art, has the following advantages and effect:
1. the present invention utilizes the sequence information of Chinese cabbage, wild cabbage and rape and genome sequencing and transcript profile sequencing data and special antibacterial peptide database compare and predict classification analysis, the proline rich class antibacterial peptide PRPs-BnPRP1 that successfully acquisition one is new.For utilizing information biology means and genetic engineering technique Large scale identification new plant derived antimicrobial peptide to lay a good foundation, provide a kind of new approach.
2. utilize Overlap-PCR technology this gene of synthetic in vitro, greatly reduce the technical difficulty and cost that obtain BnPRP1.
3. for solving the problems of antibacterial peptide heterogenous expression, present invention employs a kind of method of new amalgamation and expression antibacterial peptide, Pestivirus suis protein mutant EDDIE is adopted to be fusion rotein, with inclusion bodies efficient expression antimicrobial peptides in e. coli bl21, to reduce the toxic action of antibacterial peptide to host.After inclusion body protein purifying, renaturation, EDDIE correctly folds again, recovers its self cleavage ability, at specific site Cys168 and 169 places, the antibacterial peptide that C end merges is sheared, thus obtains the antibacterial peptide product not increasing any additional amino acid.The method does not need to add any chemical substance and enzyme to remove fusion tag, and to host's nontoxicity, purge process is simple, and can directly be used for after shearing detecting the anti-microbial activity to pathogenic bacteria, highest goal output can reach 12g/L.
4. cup-plate method and blade surface spray inoculation test result and all show that the cecropin B gene nPRP1 of Prokaryotic expression, purification can the growth of effectively anti-bacteria and sclerotinite, botrytis cinerea and dry thread Pyrenomycetes, greyness bacterium four kinds of pathogenic fungies, effectively can improve the resistance of plant to them.
5., because BnPRP1 gene source is in rape, it can also be used for the seed selection of rape disease-resistant variety as resistance marker, or is used for transgenic breeding as engineered candidate gene.
Accompanying drawing explanation
Fig. 1 is expression vector pET30a/His-EDDIE-GFP mode chart.
Fig. 2 is the circular dichroism spectrum structure iron of cecropin B gene nPRP1.
A in Fig. 2: on the impact of antibacterial peptide BnPRP1 structure under different solvents condition, the direction shown in arrow represents the CD spectrum that BnPRP1 antibacterial peptide under different solvents condition presents;
B in Fig. 2: different concns TFE on the impact of antibacterial peptide BnPRP1 structure, and the direction shown in arrow represents the CD spectrum that BnPRP1 antibacterial peptide under the TFE condition of different concns presents.
Fig. 3 is EDDIE-BnPRP1 vector construction agarose gel electrophoresis detection figure.
In Fig. 3, A:overlap PCR synthesizes the sepharose detection of BnPRP1 gene; M:100bp DNA Marker; 1-2:Overlap PCR synthesizes BnPRP1 gene;
B in Fig. 3: expression vector EDDIE-BnPRP1 electrophoresis detection; M:1kb DNA Marker; 1: recombinant vectors pET30a-EDDIE-BnP; 2: empty carrier pET30a/His-EDDIE-GFP;
In Fig. 3, C:BnPRP1 gene PCR detects; M:DL2000DNA Marker; 1: positive control; 2: negative control; 3-4:BnPRP1 recon.
The expression and purification SDS-PAGE electrophoresis detection of Fig. 4 BnPRP1 albumen.
The SDS-PAGE of A in Fig. 4: fusion rotein EDDIE-BnPRP1 abduction delivering analyzes; M: small molecular weight protein Marker; 1,3-6:EDDIE-BnPRP1 precipitates; Lane 7: the EDDIE-BnPRP1 after purifying; Lane 2: renaturation buffer in contrast.
SDS-PAGE electrophoretic analysis after B:EDDIE-BnPRP1 renaturation in Fig. 4; M: small molecular weight protein Marker; After 1,2:EDDIE-BnPRP1 renaturation, 8 hours SDS-PAGE analyze.
The bacteriostatic activity analysis of Fig. 5 BnPRP1 antibacterial peptide.
In Fig. 5 (a): BnPRP1 antibacterial peptide is to the bacteriostatic activity analysis of yeast and bacterium;
A: yeast: Pichia pastoris GS115; B: Sarcina lutea; C: intestinal bacteria;
0: renaturation buffer; 1: artificial synthetic antimicrobial peptide BnPRP1; 2: chemosynthesis antibacterial peptide;
In Fig. 5 (b): cecropin B gene nPRP1 is to the bacteriostatic activity analysis of different fungi;
A: sclerotinite; B: Trichoderma; C: rhizoctonia at once; D: botrytis cinerea;
0: renaturation buffer; 1: artificial synthetic antimicrobial peptide BnPRP1; 2: chemosynthesis antibacterial peptide;
In Fig. 5 (c): microscopic examination cecropin B gene nPRP1 is on the impact of sclerotinite mycelia;
A: normal growth mycelia; B: mycelia is tied a knot; C: mycelia adhesion; D: mycelia ultimate swelling.
Fig. 6 BnPRP1 antibacterial peptide tooth in vitro smears bacteriostatic action figure after rear inoculation sclerotinite.
A in Fig. 6: the blade smeared through cecropin B gene nPRP1;
B in Fig. 6: undressed normal Arabidopsis leaf in contrast.
Embodiment
According to following examples, can better understand the present invention, but described embodiment is to better explain the present invention, instead of limitation of the present invention.Agents useful for same of the present invention if not otherwise specified, all derives from commercial channel, described technical scheme, if not otherwise specified, is the conventional scheme of this area.
Embodiment 1:
The prediction of rape antibacterial peptide gene BnPRP1 and structural analysis
The genome of the Chinese cabbage utilizing contriver laboratory to build, wild cabbage and swede type rape and transcript profile sequence information data storehouse (
h ttp: //www.ocri-genomicls.org/bolbase) with special antibacterial peptide database, as ANTIMIC (already described above), APD (already described above), APPDB (already described above), PhytAMP (already described above) etc. carries out BLAST comparison (Nucleotide similarity >90% and Identity>90%), obtains the preliminary election gene that large batch of and known antibacterial peptide sequence has similar structures feature.Subsequently Predicting and analysis is carried out to the protein sequence (Vector NTI10) of these preliminary election genes and secondary structure structure (already described) above, thus set up protein three-dimensional structure figure, utilize secondary structure and function to build storehouse to the classification that filtered out antibacterial peptide carries out protein families, thus final acquisition is numbered the novel antimicrobial peptide gene of EV168192.1.Called after BnPRP1.The nucleotides sequence of BnPRP1 gene is classified as shown in SEQ ID NO.3, and the aminoacid sequence of cecropin B gene nPRP1 is for shown in SEQ ID NO.2.
BnPRP1 antibacterial peptide contains 35 amino acid, and wherein proline content is more than 35%, is typical proline rich class antibacterial peptide (Proline-rich PRPs).PRPs is typical linear antibacterial peptide, does not contain or less containing semicanal propylhomoserin, can not form disulfide linkage, also lacking the secondary structures such as typical spiral and pleated sheet simultaneously.The secondary structure of protein tertiary structure (already described above) display BnPRP1 mainly presents random coil and contains a small amount of spirane structure.This protein structure determines the mechanism that antibacterium that it occurs and antimycotic binding mode are different from the destruction cytolemma of common antibacterial peptide, but reach antibacterial effect (Balaji Ramanathan EGD by a kind of mechanism not destroying cytolemma, Christopher R.Ross, Frank Blecha:Cathelicidins:microbicidal activity, mechanisms of action, and roles in innate immunity.Microbes and Infection 2002,4:361-372; Boman HG AB, Boman A:Mechanisms of actionon Escherichia coli of cecropin P1and PR-39, two antibacterial peptides from pig intestine.Infection and immunity 1993,61:2978-2984; T.Cabras RL, F.Secundo, G.Nocca, S.Conti, L.Polonelli:Structural and functional characterization of the porcine proline – rich antifungal peptide SP-B isolated from salivary gland granules.Journal of Peptide Science 2008,14:251-260.).
In order to verify above-mentioned protein tertiary structure result, whole 35 amino acid of contriver's artificial synthetic antimicrobial peptide BnPRP1, carry out secondary structure structure detection at Chinese Academy of Sciences's virus research circular dichroism detector used to it.The secondary structure detection of BnPRP1 divides on Photopolarimeter at institute of viruses of Chinese Academy of Sciences Jasco-810 CD spectropolarimeter to be carried out, determined wavelength is 190-260nm, detection step-length is 2nm, and each sample is the mean value of scanning three times, detects and all carries out room temperature about 20 DEG C.Adopt water, methyl alcohol (MeOH), ethanol (EtOH), trifluoroethanol (TFE), acetonitrile (MeCN), PBS damping fluid (NaCl 137mM, KCl 2.7mM, KH respectively
2pO
41.4mM, Na
2hPO
44.3mM, pH less than 7.4 is identical) as solvent, measure the CD spectrum signature of BnPRP1 in different solvents system.In mensuration system, the final concentration of BnPRP1 is 100 μMs/L.The BnPRP1 damping fluid of the PBS buffer 50 μMs/L containing different concns TFE (25%, 50%, 75%) is adopted to carry out CD mensuration.The measurement result of BnPRP1 in different organic solvents and phosphate buffered saline buffer as Fig. 2 in shown in A, peak value increase compared with PBS in 220nm place in organic solution, illustrate antibacterial peptide in organic solvent helical content increase, in order to obtain the details of organic solvent to BnPRP1 secondary structure effect, the trifluoroethanol PBS damping fluid of different concns is adopted to study the formation of organic solvent to the secondary structure of BnPRP1.From Fig. 2, B can find out that TFE can the formation of effective inducing cycloidic structure, and along with the rising of TFE concentration, the intensity at its peak also strengthens gradually, and namely its spirane structure content increases.Derivable spirane structure spirane structure contained in the bright secondary structure of BnPRP1 under normal circumstances of more speaking more is fewer, calculates out that BnPRP1 is made up of the random coil of 90% and the spirane structure of 10% according to the above results.
Its equally being formed primarily of random coil of predicting with secondary of circular dichroism detector detected result result display, includes a small amount of α spiral, belongs to Proline-rich class antibacterial peptide (Fig. 2).Illustrate that the present invention obtains the antibacterial peptide of a new Proline-rich type by analysis of biological information and prediction.
Embodiment 2:
Codon optimized and the external synthesis of rape BnPRP1 gene
Due to antibacterial peptide, lifetime is short in vivo, is difficult to catch, and is difficult to increase from rape cDNA, by then expensive for whole for whole antibacterial peptide synthetic with the round pcr of routine.In order to reduce the cost obtaining antibacterial peptide, the present invention is according to the DNA sequence dna according to BnPRP1 gene, utilize DNAWorks Software tool (http://mcl1.ncifcrf.gov/dnaworks/, Hu F, Ke T, Li X, Mao PH, Jin X, Hui FL, Ma XD, Ma LX.Expression and Purification of an Antimicrobial Peptide by fusion with elastin-like polypeptides in Escherichiacoli.Appl Biochem Biotechnol.2010, 160 (8): 2377-87), by codon optimized (Ke T, Liang S, Huang J, Mao H, Chen J, Dong C, Liu S, Kang J, Liu D, Ma X:A novel PCR-based method for high throughput prokaryotic expression of antimicrobial peptide genes.BMC Biotechnol 2012, 12:10.) design primer sequence, synthetic primer 6 covers the primer (the handsome company in Shanghai synthetic primer) of BnPRP1 total length altogether, be respectively BnPEV168192_1, BnPEV168192_2, BnPEV168192_3, BnPEV168192_4, backboneF and backboneR.Primer sequence is as shown in table 1, boldface represents that (carrier forms for this laboratory reference Ke Tao document builds with carrier pET30a/His-EDDIE-GFP, Ke T, Liang S, Huang J, Mao H, Chen J, Dong C, Liu S, Kang J, Liu D, Ma X:A novel PCR-based method for high throughput prokaryotic expression of antimicrobial peptide genes.BMC Biotechnol 2012,12:10.) part of homology, all the other are gene-specific primer.Adopt Overlap-PCR technology (Zhu D, Zhong X, Tan R, Chen L, Huang G, Li J, Sun X, Xu L, Chen J, Ou Y, Zhang T, Yuan D, Zhang Z, ShuW, Ma L:High-throughput cloning ofhuman liver complete open reading frames using homologousrecombination in Escherichia coli.Anal Biochem 2010,397 (2): 162-167) obtain BnPRP1 full length gene.
PCR reaction system is as follows: total reaction system is 50 μ L, includes: 10 × Taq buffer is (containing MgCl
2) 10 μ l, 1.5mmol/L dNTP (10mmol/L) 4 μ l, primer backboneF1 and backboneR respectively adds 1 μ l (concentration is 10mmol/L), primer BnPEV168192_1, BnPEV168192_2, BnPEV168192_3 and BnPEV168192_4 respectively adds 1 μ l (concentration is 2mmol/L), Taq (5U/ μ l) 1 μ l, ddH
2o 33 μ l.Reaction conditions be 94 DEG C 5 minutes, 94 DEG C 1 minute, 58 DEG C 1 minute, 72 DEG C 2 minutes 30 seconds, 25 circulations, after 72 DEG C extend 10 minutes, amplification size is 108bp (Fig. 3).PCR primer detects through 1.0% agarose gel electrophoresis, after Gel Extraction kit reclaims, be connected to pMD18-T carrier, heat shock method transforms the competent cell of XL10-Gold bacterial strain, coat on the LB solid medium flat board containing penbritin 50 μ g/mL, 37 DEG C of overnight incubation, select hickie 6, adopt M13 primer: 5 ' TGTAAAACGACGGCCAGT3 ' and 5 ' CAGGAAACAGCTATGACC3 ', be bacterium colony PCR and detect.Amplified production size is 200bp, after 1.0% agarose gel electrophoresis detected magnitude is correct.Bacterial plaque correct for PCR detected magnitude is inoculated into the LB liquid medium containing penbritin 50 μ g/mL, at 37 DEG C, 200r/min shaking culture is spent the night, alkalinity extraction plasmid in a small amount, 1.0% agarose gel electrophoresis detects plasmid DNA size correct rear (for 400bp), adopt Kpn I/BamH I enzyme to cut and double digestion is carried out to plasmid, 37 DEG C are spent the night, and 1.0% agarose gel electrophoresis detects.To detect correct Positive recombinant clones called after pMD18-BnPRP1, pMD18-BnPRP1 is served Hai Yingjun company and check order, analytical results, the cecropin B gene nPRP1 full length gene sequence after being optimized, its sequence is for shown in SEQ ID NO.1.
Embodiment 3: the structure of fusion expression vector EDDIE-BnPRP1
According to the method for Ke Tao report, adopt inverse PCR technique, BnPRP1 gene is connected on expression vector pET30a/His-EDDIE-GFP.Utilize 30abackbone-F:TGAGATCCGGCTGCTAACAAAGCCC and 30abackbone-R:GCAGCTGGTCACCCACAGCG primer, by Inverse PCR amplification, by pET30a/His-EDDIE-GFP vector linearization.Concrete reaction system is as follows: adopt 50 μ L systems, and wherein pET30a/His-EDDIE-GFP plasmid 1 μ l (50ng/ μ l) is casting formwork, and 10 × Taq buffer is (containing MgCl
2) 5 μ l, 1.5mmol/L dNTP (10mmol/L) 4 μ l, 5 ' primer 30abackbone-R 2 μ l (10 μm of ol/L), 3 ' primer 30abackbone-F 2 μ l (10 μm of ol/L), Taq enzyme (5U/ μ l) 1 μ l, ddH
2o 31 μ l.Reaction conditions is at 94 DEG C 5 minutes, 94 DEG C 30 minutes, 60 DEG C 30 seconds, 72 DEG C 6 minutes, 25 circulations, extend 10 minutes after 72 DEG C, PCR primer size is 6kb.After 1.0% agarose gel electrophoresis detected magnitude is correct, reclaims test kit with gel and reclaim 6kb large fragment.To be increased in the pET30a/His-EDDIE-GFP linearized vector fragment be recovered to and embodiment two the BnPRP1 full length DNA fragment reclaiming and obtain by Overlap-PCR, transformation of E. coli XL10-Gold bacterial strain (being purchased from Strategene company) simultaneously, by homologous recombination of fixing a point in body, BnPRP1 gene is connected on expression vector pET30a/His-EDDIE-GFP.Concrete grammar is as follows: according to the ratio biased sample of the BnPRP1 full length DNA fragment=3:1 of pET30a/His-EDDIE-GFP linearized vector fragment: 50ng, transform the competent cell of XL10-Gold bacterial strain by heat shock method after, solid LB media flat board containing kantlex (50 μ g/mL) screens, the GFP green fluorescent protein tag of (Fig. 1) on carrier is utilized to screen non-luminous positive colony under UV-irradiation, extract plasmid, through 1.0% agarose gel electrophoresis detected magnitude correct (in Fig. 3 B), serve the order-checking of Hai Ying fine horse biotech firm.Gene fusion expression carrier EDDIE-BnPRP1 for the purpose of the rear sequence of order-checking is correct.
Embodiment 4:
The external evoked expression of cecropin B gene nPRP1 and separation and purification
By fusion expression vector EDDIE-BnPRP1 plasmid correct for order-checking, be transformed in BL21 (DE3) competent cell by heat shock method, obtain EDDIE-BnPRP1 amalgamation and expression engineering bacteria BL21 (DE3)/pETNB.Bacterium liquid after conversion is drawn 5 μ l at the flat lining out of solid LB media containing kantlex (50 μ g/mL), and 37 degree of cultivations chose single bacterium colony from picking kalamycin resistance flat board after 24 hours.Be in the LB nutrient solution of (50ug/mL kantlex) in 10 milliliters of final concentrations by single colony inoculation of picking, spend the night 37 DEG C of shaking culture, be forwarded in 1000 milliliters of LB liquid nutrient mediums with the ratio of 1:100,37 DEG C of shaking culture 3 hours, when absorbance value is about 0.6 under 600nm with spectrophotometer detection LB liquid nutrient medium, in above-mentioned LB liquid nutrient medium, add the IPTG that final concentration is 1mM.At 37 DEG C concussion continue cultivate 6h carry out abduction delivering, with under desk centrifuge (already described above) room temperature with the centrifugation 15min of 5000r/min, outwell supernatant, collect bacterial sediment.
The broken bacterium damping fluid of the thalline upper step collected, with ultrasonic cell disruptor carrying out ultrasonic bacteria breaking 5min under ice bath, then uses whizzer with the centrifugal 15min of the rotating speed of 5000r/min, collects inclusion body precipitation under 4 DEG C of conditions.Inclusion body precipitation is cleaned twice with 10 milliliters of lavation buffer solutions, each 2 minutes under 4 DEG C of conditions.Under 4 DEG C of conditions, use whizzer with the centrifugal 20min of 12000r/min rotating speed, collecting precipitation again.With the expression level (Fig. 4) of target protein in SDS-PAGE electrophoresis detection inclusion body.In Fig. 4, the result of (A) shows that inducing action at IPTG is after 8 hours, and BnPRP1 is great expression in inclusion body precipitation.
With the ratio of volume ratio 1:10 by the inclusion body collected above precipitation be dissolved in urea-denatured damping fluid, at room temperature shake 2 hours with vibrator, in 4 DEG C with whizzer with the centrifugal 20min of 12000r/min rotating speed, get supernatant.Get 1ml Ni-NTA sepharose prepacked column, add 10ml equilibration buffer and prepacked column is at room temperature balanced 30 minutes, use centrifuge 5min with the speed of 5000r/min in 4 DEG C, remove under solution, collect prepacked column.Then get inclusion body protein supernatant 10ml sample with the speed loading of 0.5ml/min in Ni-NTA sepharose prepacked column, the solution collected and flow down in prepacked column is in charge of in below with 2 milliliters of centrifuge tubes, often pipe collects 2 milliliters.Wash away the sample do not adsorbed subsequently with the flow velocity of 1-2ml/min with 15ml lavation buffer solution.The solution collected and flow down in prepacked column is in charge of in below with 2 milliliters of centrifuge tubes, often pipe collects 2 milliliters.Then use 5ml elution buffer with the EDDIE-BnPRP1 fusion rotein of the flow velocity wash-out of 1-2ml/min and Ni-NTA specific binding, the solution collected and flow down in prepacked column is in charge of in below with 2 milliliters of centrifuge tubes, often pipe collects 2 milliliters.Finally use 5ml equilibration buffer pillar, add 1 milliliter of 20% ethanol and use in order to next time.By the content of all solution SDS-PAGE electrophoresis detection target proteins collected and purity, it is best to get purity, and the pipe that concentration is the highest does the renaturation experiment sample of swimming lane 7 (in the Fig. 4 in A).
The protein solution 2 milliliters of swimming lane 7 in Fig. 4 A best after getting step electrophoresis detection, add 100 milliliters of renaturation buffers fast, 6 hours are placed in room temperature, the self cleavage effect of Tricine-SDS-PAGE electrophoresis detection fusion rotein EDDIE-BnPRP1, result is as shown in B in Fig. 4: remaining not containing the BnPRP1 antibacterial peptide of any additional amino acid after obtaining fusion rotein generation self cleavage.Utilize Nanodrop-2000 to measure the protein content of antibacterial peptide after renaturation, concentration is 12mg/ml.
Embodiment 5:
BnPRP1 antibacterial peptide Antibacterial Activity
Respectively with Sarcina lutea (Micrococcus luteus) for gram-positive microorganism representative, intestinal bacteria (Escherichiacoli) are Gram-negative bacteria representative, yeast (Pichia pastoris GS115) as the indicator of fungi, using cup-plate method as the standard method detecting cecropin B gene nPRP1 bacteriostatic activity.
Concrete grammar is as follows: in each Oxford cup, add the cecropin B gene nPRP1 solution that 200 lli are about the good cecropin B gene nPRP1 solution of the artificial purifying of 3 milligrams every milliliter or chemosynthesis, cultivate 12-16 hour under 37 degree of environment after, calculate the anti-microbial activity of BnPRP1 antibacterial peptide by measuring inhibition zone size.Carry out 3 experiments altogether, each experiment is carried out 3 technology and is repeated.
Result, as shown in (a) He table 2 in Fig. 5, is added with around the Oxford cup of expression and purification antibacterial peptide and the Oxford cup of artificial synthetic antimicrobial peptide and all occurs large inhibition zone, and control section does not have obvious inhibition zone to occur.Vivoexpression purifying cecropin B gene nPRP1 more than 1.3 centimetres, shows efficient bacteriostasis to the average antibacterial circle diameter of intestinal bacteria, Sarcina lutea and pichia spp.
Contriver also identifies the bacteriostatic activity of BnPRP1 antibacterial peptide to sclerotinite (Sclerotinia sclerotiorum), botrytis cinerea (Botrytis cinerea) and dry thread Pyrenomycetes (Pyricularia grisea Sacc) three kind of plant pathogenic fungies.Select intact sclerotinite sclerotium, first use 10 milliliter 75% alcohol-pickled 1 minute, then use 10 milliliters of 0.1%HgCl
2middle soaking disinfection 8-10 minute, rinses 3-5 time with sterilized water 10 milliliters subsequently.Sterilizing sclerotium is cut two ends, and middle portion is cut into mung bean size, and tangent plane, is inoculated in PDA flat board down.Usually every sclerotium connects a plate, once inoculates 8-9 plate.In 22 DEG C of quiescent culture 3-4 days, when mycelia is about to be paved with flat board, use
punch tool, along the punching of mycelia outer rim, gets mycelia block, for again inoculating.The mycelia block taken out with punch tool is placed in position, middle on a new PDA flat board, makes the one side contact PDA plane containing mycelia.
The mycelia block of botrytis cinerea and dry thread Pyrenomycetes is immersed in 50% glycerine solution respectively, is stored in-80 DEG C of Ultralow Temperature Freezers.The mycelia block preserved can directly be cultivated on PDA flat board.Botrytis cinerea needs 22 DEG C to cultivate about 48 hours and dry thread Pyrenomycetes needs 26 DEG C to cultivate 48 hours, when mycelia extends to about 1cm, respectively an Oxford cup is placed up and down equally at mycelia block, add the antibacterial peptide (effect of the antibacterial peptide that two kinds of methods obtain is identical) of the good antibacterial peptide of artificial purifying or chemosynthesis respectively, renaturation solution in contrast.Continue cultivation 48 hours, observe bacteriostatic activity situation.Result is as shown in (b) in Fig. 5, and compared with the control, around the Oxford cup being added with antibacterial peptide, Fungal hyphal growth is stoped, and cannot cross Oxford cup, and control section mycelia then can cross the edge that Oxford cup arrives culture dish smoothly.The bacteriostatic diameter of cecropin B gene nPRP1 and the calculation result of bacteriostasis rate are in table 2.The bacteriostasis rate of cecropin B gene nPRP1 to sclerotinite of result display vivoexpression purifying reaches 90%, and reach 86% to the bacteriostasis rate of botrytis cinerea, the bacteriostasis rate of Rhizoctonia solani reaches 84%.
Table 2 vivoexpression purifying cecropin B gene nPRP1 bacteriostatic activity
In order to inquire into the restraining effect of BnPRP1 antibacterial peptide to fungal growth further, using sclerotinite mycelia as research object, inquire into the growth-inhibiting effect of antibacterial peptide to sclerotinite mycelia.By the sclerotinite mycelia of normal growth on PDA flat board above and add BnPRP1 solution Oxford cup near sclerotinite mycelia take off with tweezers respectively, be placed on slide glass, drip upper 1 physiological saline, covered, under being placed in inverted microscope, (Lycra DMI6000B) observes, the sclerotinite mycelia of discovery after cecropin B gene nPRP1 effect and the sclerotinite Hyphal form ratio of normal growth, mycelial growth is suppressed, knotting, wrapping phenomena has been there is on mycelia top, and there is serious adhesion phenomenon between mycelia, as shown in C in Fig. 5.BnPRP1 is described mainly by hindering the growth of pathogenic fungi top mycelia to reach the object suppressing mycelia expansion.
Embodiment 6:
The application of BnPRP1 antibacterial peptide in plant disease-resistant
In order to detect cecropin B gene nPRP1 as biological prevention and control agent for improving the potentiality of the resistance of plant against fungal disease, contriver sprays certain density artificial expression and purification antibacterial peptide solution at plant (Arabidopis thaliana, rape) blade surface, inoculate above-mentioned three kinds of pathogenic fungies subsequently, after 36 hours, measure Lesion size.Concrete mode is as follows:
Get the growth Arabidopsis leaf of 5 weeks and 5 leaf phase rape leafs, the cecropin B gene nPRP1 after blade surface uniform application one deck concentration is the artificial expression and purification of 5ng/ μ l.According to method described in embodiment 5, PDA flat board cultivates sclerotinite, botrytis cinerea and Rhizoctonia Solani respectively, when mycelia is about to be paved with flat board, use
punch tool, along the punching of mycelia outer rim, gets mycelia block, for rape leaf inoculation, uses
punch tool, along the punching of mycelia outer rim, is got mycelia block, is inoculated for Arabidopsis leaf.Be placed in Arabidopis thaliana and rape leaf middle with the mycelia block that punch tool takes out by syringe needle, make the one side contact blade surface containing mycelia.On the Arabidopis thaliana not smearing antibacterial peptide and rape leaf, also inoculate sclerotinite, botrytis cinerea and Rhizoctonia Solani according to the method described above equally fast in contrast simultaneously, 22 DEG C, cultivate under humidity 90% condition and observe susceptible situation in 36 hours, and measure the Lesion size on each blade.Result is as shown in Fig. 6 and table 3, table 4, and the Arabidopsis leaf of smearing antibacterial peptide is compared with rape leaf with the Arabidopis thaliana do not smeared with rape leaf, and inoculation sclerotinite, botrytis cinerea and the lesion area of dry thread Pyrenomycetes after 36 hours all significantly reduce.As do not smear cecropin B gene nPRP1 Arabidopsis leaf inoculation sclerotinite after 36 hours bacterial plaque area expand to 3.04cm
2, and the average bacterial plaque area smearing cecropin B gene nPRP1 Arabidopsis leaf is 0.92cm
2, only have 30% of contrast blade bacterial plaque area.After rape leaf surface smear cecropin B gene nPRP1, connect the bacterial plaque area of bacterium after 36 hours also only has about 27% of contrast equally.The expansion that effectively inhibit sclerotinite at Arabidopis thaliana and rape leave surface smear antibacterial peptide is described, improves the resistance of plant to sclerotinite.The inoculation test of botrytis cinerea and dry thread Pyrenomycetes also obtains similar result (table 3, table 4).Contriver, by method like Noodles, 5 leaf phase soybean leaves smears cecropin B gene nPRP1, inoculates another kind of pathogenic fungi greyness bacterium subsequently, and inoculation blade is 9, repeats 3 times, not smear 5 leaf phase soybean leaves of antibacterial peptide for contrast.According to incidence, within 6 days after connecing bacterium, measure lesion area.Result shows: the lesion area having smeared antibacterial peptide soybean leaves is 0.158 ± 0.01cm
2, compared to the lesion area (0.224 ± 0.013cm of the contrast blade do not smeared
2), its scab spot area on average reduces 30%, presents pole significant difference.This illustrates that spraying cecropin B gene nPRP1 at plant leaf has the effect significantly suppressing sclerotinite, botrytis cinerea, dry thread Pyrenomycetes and greyness bacterium to infect diffusion, effectively raises the resistance of plant to these four kinds of pathogenic fungies.
Lesion area (unit: cm after table 3 Arabidopsis leaf inoculates 36 hours
2)
Numbering | Contrast | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 |
Sclerotinite | 3.04 | 0.96 | 1.08 | 0.88 | 1.01 | 1.14 | 0.95 | 0.59 | 0.78 |
Botrytis cinerea | 4.86 | 1.15 | 1.21 | 1.47 | 1.38 | 1.81 | 1.20 | 1.05 | 1.22 |
Dry thread Pyrenomycetes | 3.65 | 1.56 | 1.12 | 1.02 | 1.76 | 1.79 | 1.44 | 1.35 | 1.61 |
Lesion area (unit: cm after table 4 rape leaf inoculates 36 hours
2)
Numbering | Contrast | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 |
Sclerotinite | 6.21 | 1.52 | 1.74 | 1.85 | 1.96 | 1.35 | 1.78 | 1.85 | 1.66 |
Botrytis cinerea | 8.89 | 2.24 | 2.67 | 2.01 | 2.14 | 2.53 | 2.96 | 2.38 | 2.49 |
Dry thread Pyrenomycetes | 7.01 | 2.25 | 2.59 | 2.23 | 2.65 | 2.98 | 2.87 | 2.98 | 2.44 |
Bacteriostatic activity detected result of the present invention shows that BnPRP1 has stronger bacteriostatic activity to bacterium (intestinal bacteria, Sarcina lutea) fungi (yeast, sclerotinite, botrytis cinerea, dry thread Pyrenomycetes, greyness bacterium).Excised leaf smear connect bacterium experiment confirm BnPRP1 can strengthen plant to saprophytic nutrition type fungi: the resistance of sclerotinite, botrytis cinerea, dry thread Pyrenomycetes, greyness bacterium.BnPRP1 can be used in the control of sclerotium disease, gray mold, damping-off and graywall as biological prevention and control agent.Improve the expression level of BnPRP1 by genetic engineering technique and can strengthen the resistance of plant to sclerotinite, botrytis cinerea, Trichoderma and dry thread Pyrenomycetes, also can be used for the seed selection of rape disease-resistant variety as resistance marker.
SEQUENCE LISTING
<110> Inst. of Oil Crops, Chinese Academy of Agriculture
<120> rape cecropin B gene nPRP1 and application thereof
<130> rape cecropin B gene nPRP1 and application thereof
<160> 3
<170> PatentIn version 3.1
<210> 1
<211> 108
<212> DNA
<213> artificial sequence
<400> 1
atgccgccta cccaaaatcc gagcatggcg cctccaactc agaaccctta cggccagcct 60
atggcacccc ctacccagaa tccgtatggg cagccgatgg ctccaccg 108
<210> 2
<211> 35
<212> PRT
<213> rape
<400> 2
Pro Pro Thr Gln Asn Pro Ser Met Ala Pro Pro Thr Gln Asn Pro Tyr
1 5 10 15
Gly Gln Pro Met Ala Pro Pro Thr Gln Asn Pro Tyr Gly Gln Pro Met
20 25 30
Ala Pro Pro
35
<210> 3
<211> 105
<212> DNA
<213> rape
<400> 3
cctccgaccc agaatccctc tatggctcct ccaactcaga atccgtacgg tcaacctatg 60
gctccaccaa ctcagaatcc atacggtcaa cctatggctc cacca 105
Claims (8)
1. the protein be separated, its sequence is for shown in SEQ ID NO.1.
2. the gene that protein according to claim 1 is corresponding.
3. gene according to claim 2, its sequence is for shown in SEQ ID NO.1.
4. gene according to claim 2, its sequence is for shown in SEQ ID NO.3.
5. protein according to claim 1 or the application of gene according to claim 2 in preparation antibacterials.
6. application according to claim 5, is characterized in that, described antibacterials are anti-sclerotinite medicine, anti-botrytis cinerea medicine, anti-dry thread Pyrenomycetes medicine, Chinese People's Anti-Japanese Military and Political College's enterobacteria medicine, anti-Sarcina lutea medicine or anti-pichia spp medicine.
7. protein according to claim 1 or gene according to claim 2 are enhancing plant to the application of saprophytic nutrition type fungus resistant, and described fungi is dry thread Pyrenomycetes, botrytis cinerea, sclerotinite or greyness bacterium.
8. the preparation method of albumen described in claim 1, comprises the following steps:
1) structure of fusion expression vector EDDIE-BnPRP1
Utilize 30abackbone-F:TGAGATC
cGGCTGCTAACAAAGCCCand 30abackbone-R:GCAGCT
gGTCACCCACAGCGprimer, by Inverse PCR amplification, by pET30a/His-EDDIE-GFP vector linearization; By the nucleotide sequence shown in the pET30a/His-EDDIE-GFP linearized vector fragment that is recovered to and SEQ ID NO.1, transformation of E. coli XL10-Gold bacterial strain simultaneously, by homologous recombination of fixing a point in body, will
bnPRP1gene is connected to expression vector
pET30a/His-EDDIE-GFPon, obtain goal gene fusion expression vector EDDIE-BnPRP1
;
2) the external evoked expression of cecropin B gene nPRP1 and separation and purification
To be checked order correct fusion expression vector EDDIE-BnPRP1 plasmid, be transformed into by heat shock method
bL21 (DE3)in competent cell, obtain EDDIE-BnPRP1 amalgamation and expression engineering bacteria
bL21 (DE3)/pETNB; Utilize usual manner to cultivate in LB liquid nutrient medium and inducible protein expression, the bacterial cell disruption of acquisition is centrifugal, after supernatant purifying, obtains target protein cecropin B gene nPRP1, and its sequence is for shown in SEQ ID NO.2.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410801776.3A CN104530204B (en) | 2014-12-19 | 2014-12-19 | A kind of rape cecropin B gene nPRP1 and its application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410801776.3A CN104530204B (en) | 2014-12-19 | 2014-12-19 | A kind of rape cecropin B gene nPRP1 and its application |
Publications (2)
Publication Number | Publication Date |
---|---|
CN104530204A true CN104530204A (en) | 2015-04-22 |
CN104530204B CN104530204B (en) | 2017-11-10 |
Family
ID=52845867
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410801776.3A Active CN104530204B (en) | 2014-12-19 | 2014-12-19 | A kind of rape cecropin B gene nPRP1 and its application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104530204B (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110278959A (en) * | 2019-06-16 | 2019-09-27 | 浙江大学 | A kind of application of rape small peptide BnPEP4 |
CN110301454A (en) * | 2019-06-16 | 2019-10-08 | 浙江大学 | A kind of application of rape small peptide BnPEP5 |
CN113717977A (en) * | 2021-09-26 | 2021-11-30 | 中国农业科学院油料作物研究所 | Brassica napus tissue-specific P8 promoter and application thereof in preparation of transgenic rape |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101849608B (en) * | 2010-05-18 | 2013-12-18 | 四川大学 | Rape-seed meal antibacterial peptide |
-
2014
- 2014-12-19 CN CN201410801776.3A patent/CN104530204B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101849608B (en) * | 2010-05-18 | 2013-12-18 | 四川大学 | Rape-seed meal antibacterial peptide |
Non-Patent Citations (2)
Title |
---|
詹妍等: "油菜抗菌肽的分离及抑菌机制的初步研究", 《四川大学学报(自然科学版)》 * |
黄金: "抗菌肽基因BnPCD842895克隆表达及活性检测", 《中国油料作物学报》 * |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110278959A (en) * | 2019-06-16 | 2019-09-27 | 浙江大学 | A kind of application of rape small peptide BnPEP4 |
CN110301454A (en) * | 2019-06-16 | 2019-10-08 | 浙江大学 | A kind of application of rape small peptide BnPEP5 |
CN110301454B (en) * | 2019-06-16 | 2020-10-16 | 浙江大学 | Application of rape short peptide BnPEP5 |
CN113717977A (en) * | 2021-09-26 | 2021-11-30 | 中国农业科学院油料作物研究所 | Brassica napus tissue-specific P8 promoter and application thereof in preparation of transgenic rape |
Also Published As
Publication number | Publication date |
---|---|
CN104530204B (en) | 2017-11-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Lorito et al. | Translational research on Trichoderma: from'omics to the field | |
Klimes et al. | Genomics spurs rapid advances in our understanding of the biology of vascular wilt pathogens in the genus Verticillium | |
AU2002236300B2 (en) | Novel protein, gene encoding the same and method of using the same | |
El Enshasy et al. | Trichoderma: biocontrol agents for promoting plant growth and soil health | |
Wang et al. | Study on the biocontrol potential of antifungal peptides produced by Bacillus velezensis against Fusarium solani that infects the passion fruit Passiflora edulis | |
Mercado-Blanco et al. | Pseudomonas fluorescens PICF7 displays an endophytic lifestyle in cultivated cereals and enhances yield in barley | |
Sooriyaarachchi et al. | Expression and β-glucan binding properties of Scots pine (Pinus sylvestris L.) antimicrobial protein (Sp-AMP) | |
Hammami et al. | Purification and characterization of the novel bacteriocin BAC IH7 with antifungal and antibacterial properties | |
Neshani et al. | Preparation and evaluation of a new biopesticide solution candidate for plant disease control using pexiganan gene and Pichia pastoris expression system | |
CN115044505B (en) | Antibacterial lipopeptid produced by bacillus bailii and application of antibacterial lipopeptid in cosmetics and foods | |
Baccelli et al. | Water-soluble Trichogin GA IV-derived peptaibols protect tomato plants from Botrytis cinerea infection with limited impact on plant defenses | |
CN104530204A (en) | Rape antibacterial peptide BnPRP1 and application thereof | |
Montesinos | Functional peptides for plant disease control | |
AU2015383929B2 (en) | Plant protection and/or plant growth promotion system | |
CN101328207B (en) | Citrus fruit fly antibacterial peptide, preparation and use thereof | |
Pan et al. | Bio-active peptides: Role in plant growth and defense | |
JP2012246227A (en) | Soilborne disease controlling agent, and method for controlling soilborne disease using the same | |
CN104530206A (en) | Rape antimicrobial peptide BnCRP1 and application thereof | |
CN106818885A (en) | A kind of acid protease is preparing the application in suppressing cause of disease bacteria preparation | |
CN104530205A (en) | Rape antimicrobial peptide BnLTP1 and application thereof | |
EP2956474B1 (en) | Polypeptides against plant pathogenic fungi | |
RU2352580C1 (en) | Peptide with antifungal activity | |
Pereira-Dias et al. | Peptaibiotics: Harnessing the potential of microbial secondary metabolites for mitigation of plant pathogens | |
CN102408475B (en) | Bt protein Cryt1Da1, and coding gene and application thereof | |
CN109439573A (en) | There is bacterial strain, hydroamidase, encoding gene and its application of single-minded transformation function to S- napropamide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |