CN109439573A

CN109439573A - There is bacterial strain, hydroamidase, encoding gene and its application of single-minded transformation function to S- napropamide

Info

Publication number: CN109439573A
Application number: CN201811305990.4A
Authority: CN
Inventors: 蒋建东; 黄俊伟; 陈典
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2018-10-30
Filing date: 2018-11-05
Publication date: 2019-03-08
Anticipated expiration: 2038-11-05
Also published as: CN109439573B

Abstract

The invention discloses bacterial strain, hydroamidase, encoding gene and its applications to S- napropamide with single-minded transformation function.The bacterial strain Sphingobium sp.B2 of one plant of degradation napropamide, is preserved in China typical culture collection center, and the deposit date is on October 16th, 2018, deposit number was CCTCC NO:M2018684.A kind of pair of S- napropamide has the amide hydrolysis enzyme gene snaH of specificity selection function, nucleotide sequence are as follows: SEQ ID N0.1, the protein sequence of coding is as shown in SEQ ID N0.2.The pure enzyme of SnaH provided by the invention can in 1h degradable 0.4mM S- napropamide, and there is no any degradation to R- napropamide, it can be used for Enzymatic Resolution napropamide racemic modification, produce optically pure R- napropamide, it can also be used for S- napropamide pollution in removal environment, there is very important theoretical value and application prospect.

Description

There is bacterial strain, hydroamidase, the encoding gene of single-minded transformation function to S- napropamide And its application

Technical field

The invention belongs to biotechnology, it is applied to pollution environmental microorganism recovery technique and the fractionation of Chiral pesticide zymetology Field is related to bacterial strain, the amide water of the S- napropamide that activity is low, toxicity is big in species specificity removal napropamide racemic modification Solve enzyme, encoding gene and its application.

Background technique

Chiral isomer refer to it is in kind with mirror image cannot it is be overlapped, there is a pair mirror and cannot be overlapped each other Enantiomter.The pesticide with chiral isomer accounts for about 28% in global agrochemical market at present, and China's Chiral pesticide accounts for Than higher, reach 40%.Since the Recognition Different of the chiral isomers of organism, isomers match sex differernce with target site Deng, chiral isomer bioactivity, toxicology and in terms of there is also differences, even show completely sometimes Opposite physiological effect.Therefore, more and more attention has been paid to prepare optical voidness hand for the pollution risk of Chiral pesticide and safe handling Property pesticide is just being increasingly subject to the attention of industry.

Napropamide ((RS)-N, N- diethyl -2- (alpha-naphthoxy base) propionamide also known as proproanmide) is a kind of important amide Class efficiently, Herbicidal agent before broad spectrum activity, selective bud, there are two kinds of chiral isomers of R type and S type, sell currently on the market The napropamide used is racemic modification (two kinds of chiral isomer equal proportion mixtures of R type and S type).Napropamide mechanisms It is that G1 and G2 albumen in the cell cycle is blocked to be formed, inhibits DNA synthesis and cell mitogen, thus keep root growth impacted, Lobus cardiacus curling is last dead.After napropamide enters field, long half time in the soil was up to two months, such as improper use meeting Phytotoxicity is generated to succession crop.Napropamide shows that its safe concentration is 0.389mg/L to the acute poisoning test of juvenile prawn, and agriculture Generally using concentration in 3-6.66mg/L range in industry, adverse effect may be generated to people and animals by food chain.In addition, enemy Careless amine has biggish water-soluble (73mg/L, 25 DEG C), and the napropamide remained in the soil is easily accessible surface water or underground Water is a kind of potential water pollutant.

It recent studies have shown that, R- napropamide is S- napropamide to barnyard grass root growth inhibitory effect under 0.05mg/L concentration 9.4 times, and S- napropamide (EC20 value is less than 0.1mg/L) is significantly higher than R- napropamide (EC20 to the toxicity of microcystic aeruginosa Value is 0.1-1mg/L).The napropamide used on domestic market is racemic modification, inevitably lead to toxicity it is high and The low S- napropamide of activity of weeding largely remains in the environment.Disappeared using being chemically synthesized outside optical voidness napropamide or fractionation It revolves body that there are difficulty is big, at high cost, pollution weight, the defects of environment is unfriendly.Therefore, have using to napropamide chiral isomer There is the enzyme of specific recognition to carry out the fractionation of napropamide racemic modification, obtains optically pure R- type napropamide with important wound New property and application prospect.However, about to napropamide there is chiral isomer stereoselectivity bacterial strain, enzyme and gene yet there are no Report.

It obtains napropamide degradation bacteria strains and degrading genes and is preparing optical voidness R- napropamide, improve drug effect, reduce S- enemy's grass Have the effect that in the technical research of the remaining environmental pollution of amine and function: 1. by modern enzymatic and transformation technology, excellent Change napropamide production technology, remove inefficient, high poison S- napropamide isomers in napropamide, improve drug effect and reduces environment dirt Dye.2. degradation bacterial agent or enzyme preparation application is made in napropamide degradation bacteria strains and zymoprotein by Modern microbiological fermentation technique In the reparation and removal of S- napropamide pollution environment.Therefore, inefficient, high poison isomers microorganism specificity in Chiral pesticide Degradation and Chiral pesticide, which are split, has very important theory and actual application value.

Summary of the invention

The object of the present invention is to provide the bacterial strain Sphingobium that a kind of pair of S- napropamide has stereoselectivity Sp.strain B2, the protein of amide hydrolysis enzyme gene snaH and its coding and its application, the bacterial strain and hydroamidase Can be degraded the S- napropamide that herbicidal effect is low, environmental toxicity is high in specific manner, and therefore, the bacterial strain and hydroamidase can answer For napropamide production technology, S- napropamide is removed in specific manner, obtains the active optically pure R- enemy grass of low toxicity, high herbicidal Amine.Degradation bacterial agent can also be produced by zymotechnique or enzyme preparation is applied to reparation and removal that S- napropamide pollutes environment.

It is repaired it is a further object of the present invention to provide the bacterial strain Sphingobium sp.B2 of degradation S- napropamide and its in biology Application in multiple S- napropamide environmental pollution.

The bacterial strain Sphingobium sp.B2 of one plant of degradation napropamide, is preserved in China typical culture collection center, protects The hiding date is on October 16th, 2018, and deposit number is CCTCC NO:M2018684.

A kind of pair of S- napropamide has the amide hydrolysis enzyme gene snaH of specificity selection function, nucleotide sequence are as follows: SEQ ID N0.1。

The hydroamidase of amide hydrolysis enzyme gene coding of the present invention, amino acid sequence are as follows: SEQ ID N0.2.

Recombinant expression carrier containing the amide hydrolysis enzyme gene.

The recombinant expression carrier, preferably by amide hydrolysis enzyme gene snaH insertion pET-28a (+) Between the site NdeI and XhoI, and retain the histidine tag purifying protein of N-terminal.

Genetic engineering bacterium containing the amide hydrolysis enzyme gene snaH.

The preferred e. coli bl21 of expression bacterial strain (DE3) of the genetic engineering bacterium.

The application in S- napropamide is being degraded and converted to hydroamidase of the present invention.

The application of hydroamidase of the present invention S- napropamide in removal environment.

Application of the recombinant expression carrier of the present invention in degradation S- napropamide.

Hydroamidase of the present invention is in chiral resolution racemic modification napropamide production optical voidness R- napropamide Using.

Beneficial effects of the present invention are as follows:

1. the bacterial strain Sphingobium that present invention screening from soil is separated to one plant of energy specific degradation S- napropamide sp.B2.By gene order-checking and gene comparison method successful clone to amide hydrolysis enzyme gene snaH, compared in GenBank The result shows that the gene is a new gene, it is the gene of first disclosed energy specific degradation S- napropamide, the gene is complete Long (from initiation codon to terminator codon) is 1377bp, encodes 458 amino acid.

3. the pure enzyme of SnaH provided by the invention can in 1h degradable 0.4mM S- napropamide, and do not have to R- napropamide There is any degradation, can be used for Enzymatic Resolution napropamide racemic modification, produces optically pure R- napropamide, it can also be used to remove S- napropamide pollutes in environment, has very important theoretical value and application prospect.

Detailed description of the invention

Fig. 1 Sphingobium sp.strain B2 degrades racemic napropamide (Rac-NAP), R- napropamide (R-NAP) With the degradation curve of S- napropamide (S-NAP).

Fig. 2 hydroamidase SnaH degradation Rac- napropamide, R- napropamide, the HPLC map of S- napropamide.

Expression strategy figure of Fig. 3 amide hydrolysis enzyme gene snaH in BL21 (pET-28a (+)).

The SDS-PAGE of Fig. 4 hydroamidase SnaH schemes.M: the BL21 (SnaH) of albumen marker, 1:IPTG induction is thick Enzyme, 2: thick enzyme penetrates liquid, 3:50mM imidazole elution, 4:100mM imidazole elution, 5:150mM imidazole elution, 6:200mM Imidazole elution, 7:250mM imidazole elution, 8:300mM imidazole elution.

The LC-MS/MS map of Fig. 5 hydroamidase SnaH degradation S- napropamide metabolite.

Fig. 6 hydroamidase SnaH chiral resolution napropamide racemic modification schematic diagram.

Biomaterial preservation information

Napropamide degradation bacteria strains B2, classification naming are Sphingobium sp.B2, are preserved in China typical culture collection The heart, the deposit date is on October 16th, 2018, deposit number was CCTCC NO:M2018684, and preservation place is the China Wuhan Wuhan University.

Specific embodiment

Embodiment 1

The separation screening of 1.1 napropamide degradation bacteria strains B2

Activated sludge is acquired from certain insecticide factory of Nantong production napropamide raw medicine.Activated sludge 4.0g is taken to be added In 100mL basal salt media, the Rac- napropamide of final concentration of 0.2mM is added, 30 DEG C, 180rpm/min is cultivated 6 days, with The inoculum concentration of 5% (V/V) is transferred in the basal salt media of fresh sterile, and continuous switching twice, utilizes uv-spectrophotometric The content of napropamide and whether there is the generation of new metabolite in meter and high performance liquid chromatograph detection third generation pregnant solution. Gradient dilution is carried out to the pregnant solution for having degradation effect, takes 10^-2To 10^-5Each 100 μ L of gradient dilution pregnant solution, is respectively coated on On 1/10LB solid medium added with 0.8mM Rac- napropamide, 30 DEG C of culture 10d, the single bacterium on picking plate falls within LB examination It cultivates in pipe to exponential phase, then obtained bacterium solution is inoculated in the basic salt fluid nutrient medium added with Rac- napropamide, 30 DEG C, 180rpm/min is cultivated 6 days, then verifies whether each single colonie has napropamide degradation function.

Basal salt media (1L) formula are as follows: 1.0g NaCl, 1.0g NH₄NO₃, 1.5g K₂HPO₄, 0.5g KH₂PO₄, 0.2g MgSO₄, add deionized water to 1L, pH 7.0.

LB culture medium (1L) formula are as follows: 5.0g NaCl, 5.0g yeast powder, 10g peptone, addition deionized water to 1L, pH 7.0。

1/10LB culture medium (1L) formula are as follows: 0.5g NaCl, 0.5g yeast powder, 1g peptone are added and add deionized water To 1L, pH 7.0.18g agar powder is added in solid medium.

By continuous enrichment culture separation screening to one plant of napropamide degradation bacteria strains, it is named as B2.The bacterium is right in 12 Rac- napropamide degradation rate reaches 50%.

The identification of 1.2 napropamide degradation bacteria strains B2 and biological characteristics

Bacterial strain B2 is grown on solid LB media, and bacterium colony is in yellow, and opaque, round, edge is neat, and protrusion is wetter Profit, is not easy picking.Electromicroscopic photograph shows that thallus is in the shape of a rod, amphitrichous.Using the genomic DNA of bacterial strain B2 as template, bacterium is utilized 16S rRNA gene order universal primer is expanded, and the B2 16S gene order that length is about 1450bp is obtained, Blast is carried out in EzBioCloud 16S database (https: //www.ezbiocloud.net), as the result is shown bacterial strain B2 with The homology highest of Sphingobacterium (Sphingobium sp.) bacterial strain, with Sphingobium xenophagum NBRC 107872^THomology be 99.93%.In addition, B2 is accredited as sphingol by the morphology and physiological and biochemical property in conjunction with bacterial strain Bacillus (Sphingobium sp.).

The degradation characteristic of 1.3 bacterial strain B2

The research of degradation characteristic: bacterial strain B2 is seeded in 100mL LB liquid medium, and 30 DEG C, 180rpm/min, training It supports to exponential phase, thalline were collected by centrifugation by 6000rpm/mim, and thallus is washed 2 times with fresh, sterilized base salt culture medium, is resuspended in It in 4ml basal salt media, is seeded in 100mL inorganic salt liquid culture medium, adjusts OD₆₀₀About 1.0 or so, each processing In be separately added into 0.2mM Rac- napropamide, 0.2mM R- napropamide, 0.2mM S- napropamide, in 30 DEG C, 180 rpm/min are shaken Bed shaken cultivation.Every 1h timing sampling, the degradation curve of bacterial strain is drawn.

Isometric methanol is added in timing sampling culture solution, and after oscillation mixes, 12000rpm/min is centrifuged 5min, and sample is used 0.22 μm of nylon leaching film filtering, high performance liquid chromatography (HPLC) are detected.HPLC chromatogram condition are as follows: chromatographic column is Syncronis C18 (Thermo Fisher Scientific) reversed-phase column, specification are 250mm × 4.6mm × 5 μm；Mobile phase For methanol: water: acetic acid (75:24:1 [v/v/v]；Column temperature is 30 DEG C；Flow velocity is 0.8mLmin^-1；Detection wavelength is 250nm； Applied sample amount is 20 μ L.

The experimental results showed that bacterial strain B2 can be degradable by 0.2mM S- napropamide in 7h, and Rac- napropamide degradation rate 50% or so, can degrade R- napropamide (Fig. 1, Fig. 2) is not found within the 3 day time of experiment.

Embodiment 2

The clone of S- napropamide degrading genes snaH and functional verification

The sequencing analysis of 2.1 bacterial genomes total DNAs

2.1.1 the extraction of bacterial genomes total DNA and sequencing result analysis

Bacterial strain B2 full-length genome total DNA is extracted using CTAB method, and genome DNA, which is dissolved in sterile ultrapure water, to be sent Shenzhen Hua Da gene limited liability company carries out bacterial genomes and completes figure sequencing.Bacterial strain B2 full-length genome completes figure information are as follows: Full-length genome base number is 4078932bp, wherein including 1 chromosome and 6 plasmids, G+C content is 62.41%.In gene It in group predictive analysis results, is retrieved by keyword of hydroamidase, finds the orf that 11 annotations are hydroamidase, The each orf of comparative analysis on NCBI, to wherein 3 further functional verifications of hydroamidase.

2.1.2 the heterogenous expression of the amide hydrolysis enzyme gene speculated and functional verification

Using bacterial strain B2 genomic DNA as template, design primer is used to expand the hydroamidase genetic fragment of supposition.Institute It is as follows: with primer

Used primer is tested in 1 functional verification of table

Primer	Sequence (5 ' to 3 ')
		EP1F	GTGCCGCGCGGCAGCCATATGGTGACCCAAACCGCAATTACTG(SEQ ID NO.3)
EP1R	GTGGTGGTGGTGGTGCTCGAGTCAGGCAGGCTCGCAGCG(SEQ ID NO.4)
		EP2F	GTGCCGCGCGGCAGCCATATGGTGACCCTGCCCTCCCCC(SEQ ID NO.5)
EP2R	GTGGTGGTGGTGGTGCTCGAGTCACGCGACCAATCCCAG(SEQ ID NO.6)
		EP3F	GTGCCGCGCGGCAGCCATATGATGCTTGATGAATATGCAACACTCG(SEQ ID NO.7)
EP3R	GTGGTGGTGGTGGTGCTCGAGTCAGACCTTGAATACGCGCTT(SEQ ID NO.8)

Amplification system:

Amplification program

A.95 DEG C initial denaturation 3min；

B.95 DEG C denaturation 15sec, 60 DEG C of annealing 15sec, 72 DEG C of extension 1.0min 24sec, carry out 30 circulations.

C.72 DEG C whole extension 5min, is cooled to room temperature.

PET28a (+) plasmid of extraction Nde Ι and Xho I double digestion.

Digestion system:

Above-mentioned reaction system is purified in 37 DEG C of waters digestion 4h with gel purification kit.

The above-mentioned expression vector pET28a (+) linearized and amplified fragments are passed through into ClonExpress II One Step cloning kit kit is attached.

Recombining reaction system:

10min is reacted in 50 DEG C of waters, is immediately placed on cooled on ice.

Above-mentioned recombinant products are converted into BL21 (DE3), are constructed recombinant strains (Fig. 3).Each recombinant strains It cultivates in LB liquid medium to OD₆₀₀About 0.6 or so, 1mM IPTG is added in 16 DEG C, 150rpm/min induction 12 is small When, 12000rpm/min is centrifuged 10min, collects thallus, thallus is resuspended with PBS buffer solution, ultrasonication 15min, and 12000 Rpm/min is centrifuged 30min, collects supernatant (i.e. the thick enzyme of recombinant strains), verifies the thick enzyme of each recombinant strains and opposes grass to S- The degradation capability of amine.

It is verified by enzyme activity, has the thick enzyme of recombinant bacterial strain that can degrade S- napropamide, be snaH by the unnamed gene, Its corresponding nucleotide sequence is as shown in SEQ ID NO.1, the amide hydrolysis enzyme amino acid sequence such as SEQ ID of coding Shown in NO.2.

Expression and purifying of the 2.2snaH in E.coli BL21 (DE3-pET-28a (+)-snaH)

Recombinant strains are transferred in 20mL liquid LB (Kan containing 50mg/L), to bacterial strain length to exponential phase, then will training It cultivates in nutrient solution switching (inoculum concentration 4%, v/v) to 100mL LB (Kan containing 50mg/L) fluid nutrient medium to OD₆₀₀For 0.6 left side The right side, adds 1mM IPTG, and 16 DEG C of inductions 12h, 12000rpm/min are centrifuged 10min, collect thallus, bacterium is resuspended with PBS buffer solution Body, ultrasonication 15min are centrifuged 30min, collect supernatant, are purified with nickel ion affinity chromatograph column to SnaH, SDS- PAGE protein electrophoresis detects purification effect, and the size of stripe size and theoretical prediction is consistent (Fig. 4).

The vitality test of 2.3SnaH degradation Rac- napropamide, S- napropamide

Enzyme activity reaction system (1mL): (pH7.4) PBS buffer solution, Rac- napropamide (or S- napropamide, if 0.1,0.15,0.2, 0.25,0.3,0.35 and 0.4mM, 7 kinds of concentration), the pure enzyme of SnaH (Fig. 4 purifying gained), 30 DEG C of reaction 10min, it is each react with Enzyme is added and starts timing, places 1min after 10min in boiling water, terminates reaction.Isometric methanol is added after reaction solution is cooling, It mixes well, 12000rpm/min is centrifuged 5min, crosses 0.22 μm of nylon membrane filter, and HPLC detects the production quantity of product.One enzyme Unit of activity is defined as: under the conditions of pH7.4,30 DEG C of temperature, enzyme amount needed for catalysis substrate per minute generates 1 μm of ol product.

Enzymatic assay shows that SnaH is 179.2U/mg to the specific enzyme activity of Rac- napropamide, and the Rate activity to S- napropamide is 227.4 U/mg。

The determination of 2.4S- napropamide catabolite

The enzyme reaction solution of Rac- napropamide and S- napropamide in 2.3 handles sample, produces with HPLC-MS/MS to metabolism The analysis and identification of object.HPLC condition are as follows: UltiMate 3000RSLC (Thermo Fisher Scientific, the U.S.), Chromatographic column is Kinetex C18 (100mm × 2.1mm, partial size are 2.6 μm), mobile phase condition are as follows: 0-3min, methanol: water: second Acid is 30:69:1 (v/v/v), and 3-15min, eluent gradient increases to methanol: water: acetic acid is 75:24:1 (v/v/v), and And maintaining 15min constant, mobile phase methanol, water, proportion of acetic acid are down to 30:69:1 (v/v/v) and maintain 5min constant later. Detection wavelength is 230nm, and sample volume is 10 μ L.Mass spectrometer is TripleTOF 5600 (AB SCIEX, the U.S.), analysis Ion source is positive ion detection mode.

It is 217.0859 that the mass spectrogram of HPLC-MS/MS, which shows that the first mass spectrometric figure (see Fig. 5) of its product shows that it has m/z, Anion peak.Therefore, S- enemy's grass of degrading is shown according to the qualification result of the degradation characteristic of hydroamidase and metabolite The biochemical reaction of amine is that disconnected amido bond generates S-2- (1- naphthoxy) propionic acid (Fig. 6).

Sequence table

<110>Agricultural University Of Nanjing

<120>there is bacterial strain, hydroamidase, encoding gene and its application of single-minded transformation function to S- napropamide

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1377

<212> DNA

<213>it is Sphingobacterium (Sphingobium sp.)

<400> 1

gtgacccaaa ccgcaattac tggcgcgacc ctgatcgacg ggaatggcgg ttcgccgatc 60

ccggacgcag tcgtcctgtt cgaaggagac cgttttgtcg gtgcaggcgc acgcaacgga 120

tcgacgcttc ccgagggggc gacgcaagtc gacgcatccg gaaagtttct aattccgggg 180

ctgattaact cgaacgtgca tcttctcgac gcgtggactt tcatgatcgg aacggggaca 240

gtggagtatc tcgcccgttt cgagggtcgg ctgcacgagg tgatcgagga ggccgcccag 300

attgctctgg ccaacggcat gaccaccgtt ttcgatacct acaacgccct tcagcccgtg 360

ctgtttgcgc gcgatcgtat cgcatcgggc gaagcgctcg gcgctcggat ctatgcggcc 420

ggcaacatcg tcggcatggg cggccctttc tctgccgact tctcgaagaa ggcgcgcgaa 480

acaagcagcc agaccttctg tgaccgcatg gatgccatgt tcgaggccgg cgtcggccgc 540

aggctagcgg cattgccgcc cgaagaggtg cgtctcatca ttcgcgacta tctcagcaag 600

ggagtcgacc ttctcaaatt tgcgatcagc gatcatattg tgctcgaata tatgaatccg 660

cacctcacat tttcggcgcg cgtacagcgc gtgatcgccg aagagacatg ggcggccgga 720

aagccgctcc tcagccatac gacctcgctc gaaagcctca acgatgccgt gacgctcggg 780

gtcgatgcga tgatgcatac aagtatgacg gcgggagttc cgattcccga tgatatcatc 840

gagcagatca tcaaaaagac ggtgtgggcg gaaatccagc cggttcatga cgagtatcag 900

catcatctcg agacgagcgg cggaatgatg gcgggctacg ccggcggcgt gcaccgcgag 960

aatattcagc ggctcatcgc ggcgggcgca cccattcttc tcggcaccga tgccgggtgt 1020

atggaccccg actgcctcgc agacatgagc gagggcgacc ggcacgagcg cccatggtcg 1080

atcggcggcg atcatttcca ttggttccgt gcaatgcggc agctcggcat gaagccgatg 1140

gacatgctgc aggcggcgac gaagaacatc gcgcgagcct acaagaagga agccgatctc 1200

ggcaccgttg aggccgggaa atttgcggac ttcctgatcc tcgatgccaa tccgctcgac 1260

gacgaggaca attacaagcg cattcacgct atctaccaag gtggccgcaa ggtcgatcgg 1320

tccgcgttgc cggtcaagcg actggtcacc gaatatcccc gctgcgagcc tgcctga 1377

<210> 2

<211> 458

<212> PRT

<213>it is Sphingobacterium (Sphingobium sp.)

<400> 2

Met Thr Gln Thr Ala Ile Thr Gly Ala Thr Leu Ile Asp Gly Asn Gly

1 5 10 15

Gly Ser Pro Ile Pro Asp Ala Val Val Leu Phe Glu Gly Asp Arg Phe

20 25 30

Val Gly Ala Gly Ala Arg Asn Gly Ser Thr Leu Pro Glu Gly Ala Thr

35 40 45

Gln Val Asp Ala Ser Gly Lys Phe Leu Ile Pro Gly Leu Ile Asn Ser

50 55 60

Asn Val His Leu Leu Asp Ala Trp Thr Phe Met Ile Gly Thr Gly Thr

65 70 75 80

Val Glu Tyr Leu Ala Arg Phe Glu Gly Arg Leu His Glu Val Ile Glu

85 90 95

Glu Ala Ala Gln Ile Ala Leu Ala Asn Gly Met Thr Thr Val Phe Asp

100 105 110

Thr Tyr Asn Ala Leu Gln Pro Val Leu Phe Ala Arg Asp Arg Ile Ala

115 120 125

Ser Gly Glu Ala Leu Gly Ala Arg Ile Tyr Ala Ala Gly Asn Ile Val

130 135 140

Gly Met Gly Gly Pro Phe Ser Ala Asp Phe Ser Lys Lys Ala Arg Glu

145 150 155 160

Thr Ser Ser Gln Thr Phe Cys Asp Arg Met Asp Ala Met Phe Glu Ala

165 170 175

Gly Val Gly Arg Arg Leu Ala Ala Leu Pro Pro Glu Glu Val Arg Leu

180 185 190

Ile Ile Arg Asp Tyr Leu Ser Lys Gly Val Asp Leu Leu Lys Phe Ala

195 200 205

Ile Ser Asp His Ile Val Leu Glu Tyr Met Asn Pro His Leu Thr Phe

210 215 220

Ser Ala Arg Val Gln Arg Val Ile Ala Glu Glu Thr Trp Ala Ala Gly

225 230 235 240

Lys Pro Leu Leu Ser His Thr Thr Ser Leu Glu Ser Leu Asn Asp Ala

245 250 255

Val Thr Leu Gly Val Asp Ala Met Met His Thr Ser Met Thr Ala Gly

260 265 270

Val Pro Ile Pro Asp Asp Ile Ile Glu Gln Ile Ile Lys Lys Thr Val

275 280 285

Trp Ala Glu Ile Gln Pro Val His Asp Glu Tyr Gln His His Leu Glu

290 295 300

Thr Ser Gly Gly Met Met Ala Gly Tyr Ala Gly Gly Val His Arg Glu

305 310 315 320

Asn Ile Gln Arg Leu Ile Ala Ala Gly Ala Pro Ile Leu Leu Gly Thr

325 330 335

Asp Ala Gly Cys Met Asp Pro Asp Cys Leu Ala Asp Met Ser Glu Gly

340 345 350

Asp Arg His Glu Arg Pro Trp Ser Ile Gly Gly Asp His Phe His Trp

355 360 365

Phe Arg Ala Met Arg Gln Leu Gly Met Lys Pro Met Asp Met Leu Gln

370 375 380

Ala Ala Thr Lys Asn Ile Ala Arg Ala Tyr Lys Lys Glu Ala Asp Leu

385 390 395 400

Gly Thr Val Glu Ala Gly Lys Phe Ala Asp Phe Leu Ile Leu Asp Ala

405 410 415

Asn Pro Leu Asp Asp Glu Asp Asn Tyr Lys Arg Ile His Ala Ile Tyr

420 425 430

Gln Gly Gly Arg Lys Val Asp Arg Ser Ala Leu Pro Val Lys Arg Leu

435 440 445

Val Thr Glu Tyr Pro Arg Cys Glu Pro Ala

450 455

<210> 3

<211> 43

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

gtgccgcgcg gcagccatat ggtgacccaa accgcaatta ctg 43

<210> 4

<211> 39

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

gtggtggtgg tggtgctcga gtcaggcagg ctcgcagcg 39

<210> 5

<211> 39

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

gtgccgcgcg gcagccatat ggtgaccctg ccctccccc 39

<210> 6

<211> 39

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

gtggtggtgg tggtgctcga gtcacgcgac caatcccag 39

<210> 7

<211> 46

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

gtgccgcgcg gcagccatat gatgcttgat gaatatgcaa cactcg 46

<210> 8

<211> 42

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

gtggtggtgg tggtgctcga gtcagacctt gaatacgcgc tt 42

Claims

1. one plant of bacterial strain Sphingobium sp.B2 to S- napropamide with single-minded transformation function is preserved in Chinese Typical Representative training Object collection is supported, the deposit date is on October 16th, 2018, deposit number CCTCC

NO:M2018684。

2. bacterial strain Sphingobium sp.B2 described in claim 1 carries out light in conversion S- napropamide or to Rac- napropamide Learn the application in splitting.

3. a kind of amide hydrolysis enzyme gene snaH, it is characterised in that nucleotide sequence is as shown in SEQ ID N0.1.

4. the hydroamidase of amide hydrolysis enzyme gene snaH coding as claimed in claim 3, it is characterised in that amino acid sequence As shown in SEQ ID N0.2.

5. containing the recombinant expression carrier of amide hydrolysis enzyme gene as claimed in claim 3.

6. recombinant expression carrier according to claim 5, it is characterised in that by hydroamidase base as claimed in claim 3 It is inserted between the site NdeI and XhoI of pET-28a (+), and retains obtained by the histidine tag purifying protein of N-terminal because of snaH.

7. containing the genetic engineering bacterium of amide hydrolysis enzyme gene snaH as claimed in claim 3.

8. application of the amide hydrolysis enzyme gene snaH as claimed in claim 3 in degradation S- napropamide.

9. the application in S- napropamide is being degraded and converted to hydroamidase as claimed in claim 4.

10. hydroamidase as claimed in claim 4 S- napropamide or careless in chiral resolution racemic modification enemy in removal environment Amine produces the application in optical voidness R- napropamide.