CN109439573B

CN109439573B - Bacterial strain with specific conversion function on S-napropamide, amidohydrolase, coding gene and application thereof

Info

Publication number: CN109439573B
Application number: CN201811305990.4A
Authority: CN
Inventors: 蒋建东; 黄俊伟; 陈典
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2018-10-30
Filing date: 2018-11-05
Publication date: 2021-06-01
Anticipated expiration: 2038-11-05
Also published as: CN109439573A

Abstract

The invention discloses a bacterial strain with a specific conversion function on S-napropamide, amidohydrolase, a coding gene and application thereof. A bacterial strain Sphingobium sp.B2 for degrading napropamide is preserved in China center for type culture collection with the preservation date of No. 10/16 in 2018 and the preservation number of CCTCC NO: M2018684. An amidohydrolase gene snaH with specific selection function to S-napropamide, the nucleotide sequence is: SEQ ID N0.1, and the coded protein sequence is shown as SEQ ID N0.2. The SnaH pure enzyme provided by the invention can completely degrade 0.4mM S-napropamide within 1h, has no degradation effect on R-napropamide, can be used for splitting napropamide raceme by an enzyme method to produce optically pure R-napropamide, can also be used for removing S-napropamide pollution in the environment, and has very important theoretical value and application prospect.

Description

Bacterial strain with specific conversion function on S-napropamide, amidohydrolase, coding gene and application thereof

Technical Field

The invention belongs to the fields of bioengineering technology, microbial remediation technology applied to polluted environment and chiral pesticide enzymatic resolution, and relates to a strain, amidohydrolase, coding gene and application thereof for specifically removing S-napropamide with low activity and high toxicity in napropamide raceme.

Background

Chiral isomers refer to enantiomers in which a real object and a mirror image cannot overlap, and a pair of enantiomers exist in a mirror image relationship with each other and cannot overlap. At present, the pesticide with chiral isomers accounts for about 28% of the global pesticide market, and the chiral pesticide accounts for a higher proportion of 40% in China. Due to differences in recognition of chiral isomers by organisms, differences in matching of isomers to target sites, and the like, chiral isomers also differ in terms of biological activity, toxicology, environmental behavior, and the like, and sometimes even exhibit diametrically opposite physiological effects. Therefore, the pollution risk and safe use of chiral pesticides are receiving more and more attention, and the preparation of optical pure chiral pesticides is receiving more and more attention from the industrial world.

Napropamide ((RS) -N, N-diethyl-2- (alpha-naphthoxy) propionamide, also known as naproxen) is an important amide-type high-efficiency, broad-spectrum and selective pre-emergence soil herbicide, has two chiral isomers of R type and S type, and is a racemate (a mixture of the two chiral isomers of R type and S type in equal proportion) which is sold in the market at present. The mechanism of napropamide weeding is to block the formation of G1 and G2 proteins in the cell cycle, inhibit DNA synthesis and cell mitosis, thus causing the root growth to be affected and the heart leaf curl to die finally. After the napropamide enters the field, the half-life period of the napropamide in the soil is as long as two months, and if the napropamide is improperly used, the napropamide can cause phytotoxicity on succeeding crops. Acute poisoning test of the napropamide on young shrimps shows that the safe concentration of the napropamide is 0.389mg/L, while the concentration of the napropamide used in agriculture is in the range of 3-6.66mg/L, and the napropamide can cause adverse effect on human and livestock through a food chain. In addition, napropamide has great water solubility (73mg/L, 25 ℃), and the residual napropamide in soil can easily enter surface water or underground water, and is a potential water pollutant.

Recent studies have shown that R-alachlor has 9.4 times of effect on growth of barnyard grass roots at a concentration of 0.05mg/L, and S-alachlor (EC20 value less than 0.1mg/L) has significantly higher toxicity to Microcystis aeruginosa than R-alachlor (EC20 value of 0.1-1 mg/L). At present, the fenaminosulf used in the domestic market is raceme, which inevitably causes a large amount of S-fenaminosulf with high toxicity and low herbicidal activity to remain in the environment. The synthesis of optically pure napropamide or the resolution of raceme by a chemical method has the defects of high difficulty, high cost, heavy pollution, environment-friendliness and the like. Therefore, the optically pure R-type alachlor obtained by utilizing the enzyme which has specific identification on the chiral isomer of the alachlor to carry out resolution on the alachlor racemate has important innovation and application prospect. However, there have been no reports on strains, enzymes and genes having chiral isomer stereoselectivity to napropamide.

The obtained alachlor degrading strain and degrading gene have the following functions and functions in the technical research and development of preparing optically pure R-alachlor, improving the drug effect and reducing the environmental pollution caused by S-alachlor residue: 1. through modern enzyme catalysis and conversion technology, the production process of dichlormid is optimized, the low-efficiency and high-toxicity S-dichlormid isomer in dichlormid is removed, the drug effect is improved, and the environmental pollution is reduced. 2. The napropamide degrading bacterial strain and the enzyme protein are prepared into a degrading microbial inoculum or an enzyme preparation by a modern microbial fermentation technology and applied to the repair and removal of S-napropamide polluted environment. Therefore, the microorganism specific degradation and chiral pesticide resolution of low-efficiency and high-toxicity isomers in chiral pesticides have very important theoretical and practical application values.

Disclosure of Invention

The invention aims to provide a strain Sphingobium sp.strain B2 with stereoselectivity to S-alachlor, an amidohydrolase gene snaH, a protein coded by the same and application of the protein. And the degradation microbial inoculum or the enzyme preparation can be produced by a fermentation process and applied to the repair and removal of S-napropamide polluted environment.

Another object of the present invention is to provide a strain Sphingobium sp.B2 for degrading S-napropamide and the application thereof in bioremediation of S-napropamide environmental pollution.

A bacterial strain Sphingobium sp.B2 for degrading napropamide is preserved in China Center for Type Culture Collection (CCTCC) with the preservation number of M2018684 and the preservation date of No. 10/16 in 2018.

An amidohydrolase gene snaH with specific selection function to S-napropamide, the nucleotide sequence is: SEQ ID N0.1.

The amino acid sequence of the amidohydrolase coded by the amidohydrolase gene is as follows: SEQ ID N0.2.

A recombinant expression vector containing the amidohydrolase gene.

The recombinant expression vector is preferably characterized in that the amidohydrolase gene snaH is inserted between NdeI and XhoI sites of pET-28a (+), and the N-terminal histidine tag is reserved for purifying protein.

The genetically engineered bacterium contains the amidohydrolase gene snaH.

The expression strain of the genetic engineering bacteria is preferably escherichia coli BL21(DE 3).

The invention relates to an application of amidohydrolase in degrading and converting S-napropamide.

The invention relates to application of amidohydrolase in removing S-napropamide in the environment.

The recombinant expression vector disclosed by the invention is applied to degradation of S-napropamide.

The amide hydrolase is applied to chiral resolution of racemic napropamide to produce optically pure R-napropamide.

The invention has the following beneficial effects:

1. the invention screens and separates a bacterial strain Sphingobium sp.B2 capable of specifically degrading S-napropamide from soil. The gene is successfully cloned to an amidohydrolase gene snaH through a genome sequencing and gene comparison method, the comparison result in GenBank shows that the gene is a new gene and is the first gene capable of specifically degrading S-napropamide, the full length (from an initial codon to a stop codon) of the gene is 1377bp, and 458 amino acids are coded.

3. The SnaH pure enzyme provided by the invention can completely degrade 0.4mM S-napropamide within 1h, has no degradation effect on R-napropamide, can be used for splitting napropamide raceme by an enzyme method to produce optically pure R-napropamide, can also be used for removing S-napropamide pollution in the environment, and has very important theoretical value and application prospect.

Drawings

FIG. 1 shows the degradation curves of racemic napropamide (Rac-NAP), R-napropamide (R-NAP) and S-napropamide (S-NAP) by Sphingobium sp.strain B2.

FIG. 2 HPLC chromatogram of amide hydrolase SnaH degrading Rac-alachlor, R-alachlor, S-alachlor.

FIG. 3 is a schematic view showing the expression strategy of the amidohydrolase gene snaH in BL21(pET-28a (+)).

FIG. 4 is an SDS-PAGE image of the amidohydrolase SnaH. M: protein marker, 1: IPTG-induced crude BL21(SnaH), 2: crude enzyme transpermeate, 3: 50mM imidazole eluent, 4: 100mM imidazole eluent, 5: 150mM imidazole eluent, 6: 200mM imidazole eluent, 7: 250mM imidazole eluent, 8: 300mM imidazole eluent.

FIG. 5 LC-MS/MS profile of degradation of S-naprophane metabolite by amidohydrolase SnaH.

FIG. 6 shows the chiral resolution of the racemate of naproxen by the amidohydrolase SnaH.

Biological material preservation information

The napropamide degrading strain B2 is classified and named as Sphingobium sp.B2, is preserved in China center for type culture collection, has the preservation date of No. 10/16 in 2018, the preservation number of M2018684 and the preservation place of China, Wuhan university.

Detailed Description

Example 1

1.1 isolation and screening of the napropamide-degrading Strain B2

Activated sludge is collected from a certain pesticide factory producing a napropamide technical product from Jiangsutong. Adding 4.0g of activated sludge into 100mL of basic salt culture medium, adding Rac-napropamide with the final concentration of 0.2mM, culturing for 6 days at 30 ℃ and 180rpm/min, transferring into a fresh sterile basic salt culture medium by using the inoculation amount of 5% (V/V), continuously transferring twice, and detecting the content of the napropamide in the third-generation enrichment solution and whether a new metabolite is generated or not by using an ultraviolet spectrophotometer and a high performance liquid chromatograph. Carrying out gradient dilution on the enrichment solution with degradation effect, and taking 10^-2To 10^-5And (3) coating 100 mu L of each gradient dilution enrichment solution on 1/10LB solid culture medium added with 0.8mM Rac-napropamide, culturing for 10d at 30 ℃, selecting single bacterial colonies on a plate, culturing in an LB test tube to an exponential phase, inoculating the obtained bacterial solution into a basic salt liquid culture medium added with Rac-napropamide, culturing for 6 days at 30 ℃ and 180rpm/min, and then verifying whether each single bacterial colony has the napropamide degradation function.

The basic salt culture medium (1L) comprises the following components: 1.0g NaCl, 1.0g NH₄NO₃，1.5g K₂HPO₄，0.5g KH₂PO₄， 0.2g MgSO₄Deionized water was added to 1L, pH 7.0.

The LB medium (1L) formula is as follows: 5.0g NaCl, 5.0g yeast powder, 10g peptone, deionized water to 1L, pH 7.0.

1/10LB medium (1L) formulation was: 0.5g NaCl, 0.5g yeast powder, 1g peptone, adding deionized water to 1L, pH 7.0. 18g of agar powder was added to the solid medium.

And screening a napropamide degrading strain named as B2 through continuous enrichment culture and separation. The bacterium has a degradation rate of 50% to Rac-napropamide in 12.

1.2 identification and biological Properties of the alachlor-degrading Strain B2

The bacterial strain B2 grows on the solid LB culture medium, and the bacterial colony is yellow, opaque, round, neat in edge, convex, moist and not easy to pick. Electron microscope photographThe cells were rod-shaped and had flagella. The genome DNA of the strain B2 is used as a template, a bacterial 16S rRNA gene sequence universal primer is used for amplification to obtain a B216S gene sequence with the length of about 1450bp, and Blast is carried out in an EzBioCloud 16S database (https:// www.ezbiocloud.net), and the result shows that the homology of the strain B2 and a Sphingobacterium (Sphingobium sp.) strain is the highest, and the strain B2 and the Sphingobium xenophagum NBRC 107872 strain have the highest homology^TThe homology of (A) was 99.93%. In addition, B2 was identified as sphingomonas (Sphingobium sp.) by the morphological and physiobiochemical characteristics of the binding strain.

1.3 degradation Properties of Strain B2

Study of degradation characteristics: inoculating the strain B2 into 100mL LB liquid culture medium, culturing at 30 deg.C and 180rpm/min to exponential phase, centrifuging at 6000rpm/mim to collect thallus, washing thallus with fresh and sterile basic salt culture medium for 2 times, resuspending in 4mL basic salt culture medium, inoculating into 100mL inorganic salt liquid culture medium, adjusting OD₆₀₀About 1.0, 0.2mM Rac-napropamide, 0.2mM R-napropamide and 0.2mM S-napropamide were added to each treatment, and shaking cultured at 30 ℃ and 180 rpm/min. Samples were taken periodically every 1h to plot the degradation curve of the strain.

Adding methanol with the same volume into the culture solution at regular time, shaking and mixing uniformly, centrifuging at 12000rpm/min for 5min, filtering the sample with a 0.22 μm nylon filter membrane, and detecting by High Performance Liquid Chromatography (HPLC). The HPLC chromatographic conditions are as follows: the chromatographic column is a Syncronis C18(Thermo Fisher Scientific) reversed phase column with specification of 250mm × 4.6mm × 5 μm; the mobile phase is methanol: water: acetic acid (75:24:1[ v/v ]](ii) a The column temperature is 30 ℃; the flow rate was 0.8 mL/min^-1(ii) a The detection wavelength is 250 nm; the loading was 20. mu.L.

The experimental result shows that the strain B2 can completely degrade 0.2mM S-napropamide within 7h, the degradation rate of Rac-napropamide is about 50%, and the strain B2 can not degrade R-napropamide within 3 days of the experiment (figure 1 and figure 2).

Example 2

Cloning and functional verification of S-naproxen degradation gene snaH

2.1 sequencing analysis of Total DNA of bacterial genomes

2.1.1 extraction of Total DNA of bacterial genome and analysis of sequencing results

The total DNA of the whole genome of the strain B2 is extracted by adopting a CTAB method, and the total DNA of the genome is dissolved in sterile ultrapure water and sent to Shenzhen Hua Dagen corporation for the complete graph sequencing of the bacterial genome. The complete genome of the strain B2 is as follows: the total genome base number is 4078932bp, which comprises 1 chromosome and 6 plasmids, and the G + C content is 62.41%. In the result of the genome prediction analysis, the amidohydrolase is used as a keyword for searching, 11 orfs annotated as the amidohydrolase are found, and each orf is compared and analyzed on NCBI, and 3 of the orfs are further subjected to functional verification.

2.1.2 heterologous expression and functional validation of putative amidohydrolase genes

Primers were designed to amplify the putative amidohydrolase gene fragment using genomic DNA of strain B2 as a template. The primers used are as follows:

TABLE 1 primers used in functional verification experiments

Primer and method for producing the same	Sequences (5 'to 3')
		EP1F	GTGCCGCGCGGCAGCCATATGGTGACCCAAACCGCAATTACTG(SEQ ID NO.3)
EP1R	GTGGTGGTGGTGGTGCTCGAGTCAGGCAGGCTCGCAGCG(SEQ ID NO.4)
		EP2F	GTGCCGCGCGGCAGCCATATGGTGACCCTGCCCTCCCCC(SEQ ID NO.5)
EP2R	GTGGTGGTGGTGGTGCTCGAGTCACGCGACCAATCCCAG(SEQ ID NO.6)
		EP3F	GTGCCGCGCGGCAGCCATATGATGCTTGATGAATATGCAACACTCG(SEQ ID NO.7)
EP3R	GTGGTGGTGGTGGTGCTCGAGTCAGACCTTGAATACGCGCTT(SEQ ID NO.8)

An amplification system:

amplification procedure

a.95 ℃ pre-denaturation for 3 min;

b.95 ℃ denaturation 15sec, 60 ℃ annealing 15sec, 72 ℃ extension 1.0min 24sec, 30 cycles.

c.72 ℃ Final extension for 5min, cool to room temperature.

The extracted pET28a (+) plasmid was digested simultaneously with Nde I and Xho I.

Enzyme digestion system:

the above reaction system was digested in water at 37 ℃ for 4h and purified with gel purification kit.

The linearized expression vector pET28a (+) was ligated to the amplified fragment using the Clonexpress II One Step cloning kit.

A recombination reaction system:

reacting in water at 50 deg.C for 10min, and immediately cooling on ice.

The recombinant product was transformed into BL21(DE3) to construct a recombinant expression strain (FIG. 3). Each recombinant expression strain was cultured in LB liquid medium to OD₆₀₀About 0.6, adding 1mM IPTG, inducing at 16 deg.C and 150rpm/min for 12 hr, centrifuging at 12000rpm/min for 10min, collecting thallus, resuspending with PBS buffer, ultrasonicating for 15min, 12000Centrifuging at rpm/min for 30min, collecting supernatant (i.e. crude enzyme of recombinant expression strain), and verifying the degradation capability of the crude enzyme of each recombinant expression strain on S-alachlor.

Through enzyme activity verification, one recombinant strain crude enzyme can degrade S-napropamide, the gene is named as snaH, the corresponding nucleotide sequence is shown as SEQ ID NO.1, and the amino acid sequence of the coded amidohydrolase is shown as SEQ ID NO. 2.

2.2 expression and purification of snaH in E.coli BL21(DE3-pET-28a (+) -snaH)

The recombinant expression strain is transferred into 20mL liquid LB (containing 50mg/L Kan), when the strain grows to an exponential phase, the culture solution is transferred (the inoculum size is 4 percent, v/v) into 100mL LB (containing 50mg/L Kan) liquid culture medium to be cultured to OD₆₀₀About 0.6, adding 1mM IPTG, inducing at 16 ℃ for 12h, centrifuging at 12000rpm/min for 10min, collecting thalli, re-suspending the thalli by PBS buffer, carrying out ultrasonic crushing for 15min, centrifuging for 30min, collecting supernatant, purifying SnaH by using a nickel ion affinity chromatographic column, detecting the purification effect by SDS-PAGE protein electrophoresis, and ensuring that the size of a band is consistent with the size predicted by theory (figure 4).

2.3 Activity measurement of SnaH for degrading Rac-alachlor and S-alachlor

Enzyme activity reaction system (1 mL): (pH7.4) PBS buffer, Rac-napropamide (or S-napropamide, with 7 concentrations of 0.1,0.15,0.2,0.25,0.3, 0.35 and 0.4 mM), SnaH pure enzyme (purified in FIG. 4), and the reaction was stopped at 30 ℃ for 10min, each reaction started with the addition of the enzyme, and after 10min, the reaction was left in boiling water for 1 min. After cooling the reaction solution, adding methanol with the same volume, fully and uniformly mixing, centrifuging at 12000rpm/min for 5min, filtering through a nylon membrane filter with the diameter of 0.22 mu m, and detecting the generation amount of a product by HPLC. One unit of enzyme activity is defined as: the amount of enzyme required to catalyze the formation of 1. mu. mol of product per minute of the substrate at 30 ℃ at pH 7.4.

The enzymology experiment shows that the specific activity of SnaH on Rac-napropamide is 179.2U/mg, and the specific activity on S-napropamide is 227.4U/mg.

2.4 determination of catabolite products of S-napropamide degradation

2.3, treating the sample by using the liquid enzyme reaction of Rac-alachlor and S-alachlor, and analyzing and identifying the metabolite by using HPLC-MS/MS. The HPLC conditions were as follows: UltiMate 3000RSLC (Thermo Fisher Scientific, usa), Kinetex C18(100mm × 2.1mm, 2.6 μm particle size) column, mobile phase conditions: 0-3min, methanol: water: the acetic acid is 30: 69: 1(v/v/v), 3-15min, mobile phase gradient increased to methanol: water: the acetic acid is 75:24: 1(v/v/v) and maintained for 15min, after which the mobile phase methanol, water, acetic acid ratio was reduced to 30: 69: 1(v/v/v) and maintained for 5 min. The detection wavelength was 230nm and the sample size was 10. mu.L. The mass spectrometer was TripleTOF 5600(AB SCIEX, usa), and the analytical ion source was in positive ion detection mode.

The mass spectrum of HPLC-MS/MS shows that the primary mass spectrum (see FIG. 5) of the product shows that the product has a negative ion peak with m/z of 217.0859. Therefore, based on the degradation characteristics of amidohydrolase and the identification of metabolites, it was shown that the biochemical reaction for degrading S-napropamide is the cleavage of the amide bond to produce S-2- (1-naphthoxy) propionic acid (FIG. 6).

Sequence listing

<110> Nanjing university of agriculture

<120> bacterial strain with specific transformation function on S-napropamide, amidohydrolase, coding gene and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1377

<212> DNA

<213> is Sphingobacterium sp

<400> 1

gtgacccaaa ccgcaattac tggcgcgacc ctgatcgacg ggaatggcgg ttcgccgatc 60

ccggacgcag tcgtcctgtt cgaaggagac cgttttgtcg gtgcaggcgc acgcaacgga 120

tcgacgcttc ccgagggggc gacgcaagtc gacgcatccg gaaagtttct aattccgggg 180

ctgattaact cgaacgtgca tcttctcgac gcgtggactt tcatgatcgg aacggggaca 240

gtggagtatc tcgcccgttt cgagggtcgg ctgcacgagg tgatcgagga ggccgcccag 300

attgctctgg ccaacggcat gaccaccgtt ttcgatacct acaacgccct tcagcccgtg 360

ctgtttgcgc gcgatcgtat cgcatcgggc gaagcgctcg gcgctcggat ctatgcggcc 420

ggcaacatcg tcggcatggg cggccctttc tctgccgact tctcgaagaa ggcgcgcgaa 480

acaagcagcc agaccttctg tgaccgcatg gatgccatgt tcgaggccgg cgtcggccgc 540

aggctagcgg cattgccgcc cgaagaggtg cgtctcatca ttcgcgacta tctcagcaag 600

ggagtcgacc ttctcaaatt tgcgatcagc gatcatattg tgctcgaata tatgaatccg 660

cacctcacat tttcggcgcg cgtacagcgc gtgatcgccg aagagacatg ggcggccgga 720

aagccgctcc tcagccatac gacctcgctc gaaagcctca acgatgccgt gacgctcggg 780

gtcgatgcga tgatgcatac aagtatgacg gcgggagttc cgattcccga tgatatcatc 840

gagcagatca tcaaaaagac ggtgtgggcg gaaatccagc cggttcatga cgagtatcag 900

catcatctcg agacgagcgg cggaatgatg gcgggctacg ccggcggcgt gcaccgcgag 960

aatattcagc ggctcatcgc ggcgggcgca cccattcttc tcggcaccga tgccgggtgt 1020

atggaccccg actgcctcgc agacatgagc gagggcgacc ggcacgagcg cccatggtcg 1080

atcggcggcg atcatttcca ttggttccgt gcaatgcggc agctcggcat gaagccgatg 1140

gacatgctgc aggcggcgac gaagaacatc gcgcgagcct acaagaagga agccgatctc 1200

ggcaccgttg aggccgggaa atttgcggac ttcctgatcc tcgatgccaa tccgctcgac 1260

gacgaggaca attacaagcg cattcacgct atctaccaag gtggccgcaa ggtcgatcgg 1320

tccgcgttgc cggtcaagcg actggtcacc gaatatcccc gctgcgagcc tgcctga 1377

<210> 2

<211> 458

<212> PRT

<213> is Sphingobacterium sp

<400> 2

Met Thr Gln Thr Ala Ile Thr Gly Ala Thr Leu Ile Asp Gly Asn Gly

1 5 10 15

Gly Ser Pro Ile Pro Asp Ala Val Val Leu Phe Glu Gly Asp Arg Phe

20 25 30

Val Gly Ala Gly Ala Arg Asn Gly Ser Thr Leu Pro Glu Gly Ala Thr

35 40 45

Gln Val Asp Ala Ser Gly Lys Phe Leu Ile Pro Gly Leu Ile Asn Ser

50 55 60

Asn Val His Leu Leu Asp Ala Trp Thr Phe Met Ile Gly Thr Gly Thr

65 70 75 80

Val Glu Tyr Leu Ala Arg Phe Glu Gly Arg Leu His Glu Val Ile Glu

85 90 95

Glu Ala Ala Gln Ile Ala Leu Ala Asn Gly Met Thr Thr Val Phe Asp

100 105 110

Thr Tyr Asn Ala Leu Gln Pro Val Leu Phe Ala Arg Asp Arg Ile Ala

115 120 125

Ser Gly Glu Ala Leu Gly Ala Arg Ile Tyr Ala Ala Gly Asn Ile Val

130 135 140

Gly Met Gly Gly Pro Phe Ser Ala Asp Phe Ser Lys Lys Ala Arg Glu

145 150 155 160

Thr Ser Ser Gln Thr Phe Cys Asp Arg Met Asp Ala Met Phe Glu Ala

165 170 175

Gly Val Gly Arg Arg Leu Ala Ala Leu Pro Pro Glu Glu Val Arg Leu

180 185 190

Ile Ile Arg Asp Tyr Leu Ser Lys Gly Val Asp Leu Leu Lys Phe Ala

195 200 205

Ile Ser Asp His Ile Val Leu Glu Tyr Met Asn Pro His Leu Thr Phe

210 215 220

Ser Ala Arg Val Gln Arg Val Ile Ala Glu Glu Thr Trp Ala Ala Gly

225 230 235 240

Lys Pro Leu Leu Ser His Thr Thr Ser Leu Glu Ser Leu Asn Asp Ala

245 250 255

Val Thr Leu Gly Val Asp Ala Met Met His Thr Ser Met Thr Ala Gly

260 265 270

Val Pro Ile Pro Asp Asp Ile Ile Glu Gln Ile Ile Lys Lys Thr Val

275 280 285

Trp Ala Glu Ile Gln Pro Val His Asp Glu Tyr Gln His His Leu Glu

290 295 300

Thr Ser Gly Gly Met Met Ala Gly Tyr Ala Gly Gly Val His Arg Glu

305 310 315 320

Asn Ile Gln Arg Leu Ile Ala Ala Gly Ala Pro Ile Leu Leu Gly Thr

325 330 335

Asp Ala Gly Cys Met Asp Pro Asp Cys Leu Ala Asp Met Ser Glu Gly

340 345 350

Asp Arg His Glu Arg Pro Trp Ser Ile Gly Gly Asp His Phe His Trp

355 360 365

Phe Arg Ala Met Arg Gln Leu Gly Met Lys Pro Met Asp Met Leu Gln

370 375 380

Ala Ala Thr Lys Asn Ile Ala Arg Ala Tyr Lys Lys Glu Ala Asp Leu

385 390 395 400

Gly Thr Val Glu Ala Gly Lys Phe Ala Asp Phe Leu Ile Leu Asp Ala

405 410 415

Asn Pro Leu Asp Asp Glu Asp Asn Tyr Lys Arg Ile His Ala Ile Tyr

420 425 430

Gln Gly Gly Arg Lys Val Asp Arg Ser Ala Leu Pro Val Lys Arg Leu

435 440 445

Val Thr Glu Tyr Pro Arg Cys Glu Pro Ala

450 455

<210> 3

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gtgccgcgcg gcagccatat ggtgacccaa accgcaatta ctg 43

<210> 4

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtggtggtgg tggtgctcga gtcaggcagg ctcgcagcg 39

<210> 5

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gtgccgcgcg gcagccatat ggtgaccctg ccctccccc 39

<210> 6

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gtggtggtgg tggtgctcga gtcacgcgac caatcccag 39

<210> 7

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gtgccgcgcg gcagccatat gatgcttgat gaatatgcaa cactcg 46

<210> 8

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gtggtggtgg tggtgctcga gtcagacctt gaatacgcgc tt 42

Claims

1. A strain Sphingobium sp.B2 with specific conversion function on S-napropamide is preserved in China center for type culture collection with the preservation date of No. 10/16 in 2018 and the preservation number of CCTCC NO of M2018684.

2. Use of the strain Sphingobium sp.B2 according to claim 1 for degrading S-alachlor or for optically resolving Rac-alachlor to give R-alachlor.

3. An amidohydrolase gene snaH, characterized in that the nucleotide sequence is shown in SEQ ID N0.1.

4. The amidohydrolase according to claim 3, wherein the amidohydrolase gene snaH encodes an amidohydrolase characterized by the amino acid sequence shown in SEQ ID N0.2.

5. A recombinant expression vector comprising the amidohydrolase gene of claim 3.

6. The recombinant expression vector according to claim 5, wherein the amidohydrolase gene snaH of claim 3 is inserted between NdeI and XhoI sites of pET-28a (+) and purified from the protein with the histidine tag at the N-terminus retained.

7. A genetically engineered bacterium comprising the amidohydrolase gene snaH according to claim 3.

8. Use of the amidohydrolase gene, snaH, of claim 3 in the degradation of S-napropamide.

9. The use of the amidohydrolase of claim 4 to remove S-napropamide from the environment or to chirally cleave racemic napropamide to produce optically pure R-napropamide.