CN112980855A - Pyrazosulfuron-ethyl hydrolase gene pyfE and protein coded by same and application - Google Patents
Pyrazosulfuron-ethyl hydrolase gene pyfE and protein coded by same and application Download PDFInfo
- Publication number
- CN112980855A CN112980855A CN202010737689.1A CN202010737689A CN112980855A CN 112980855 A CN112980855 A CN 112980855A CN 202010737689 A CN202010737689 A CN 202010737689A CN 112980855 A CN112980855 A CN 112980855A
- Authority
- CN
- China
- Prior art keywords
- pyfe
- pyrazosulfuron
- ethyl
- hydrolase
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B09—DISPOSAL OF SOLID WASTE; RECLAMATION OF CONTAMINATED SOIL
- B09C—RECLAMATION OF CONTAMINATED SOIL
- B09C1/00—Reclamation of contaminated soil
- B09C1/10—Reclamation of contaminated soil microbiologically, biologically or by using enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
Abstract
The invention provides a pyrazosulfuron-ethyl hydrolase gene pyfE, and a protein coded by the gene pyfE and application of the gene pyfE, wherein the nucleotide sequence of the hydrolase gene pyfE is SEQ ID NO.1 in a sequence table and is used for coding pyrazosulfuron-ethyl hydrolase protein. The amino acid sequence of the pyrazosulfuron-ethyl hydrolase protein is SEQ ID NO.2 in the sequence table. The invention extracts the first pyrazosulfuron-ethyl degradation gene, and the nucleotide sequence of the pyrazosulfuron-ethyl degradation gene can be used for constructing pyrazosulfuron-ethyl resistant transgenic crops, thereby effectively removing phytotoxicity. The invention also provides a purification method of the hydrolase PyfE, which can effectively degrade pyrazosulfuron-ethyl residues when being thrown into polluted soil.
Description
Technical Field
The invention relates to a pyrazosulfuron-ethyl hydrolase gene pyfE, and a protein coded by the pyrazosulfuron-ethyl hydrolase gene pyfE and application of the pyrazosulfuron-ethyl hydrolase gene pyfE.
Background
In China, the use of chemical pesticides is an important measure for ensuring the yield of agricultural products. The sulfonylurea herbicide is one of the herbicides with the largest use amount in the world at present, and has the advantages of high efficiency, broad spectrum, low toxicity to mammals, various use modes, various varieties, strong pertinence, convenient storage and transportation and the like. Although sulfonylurea herbicides have many advantages over other herbicides, some sulfonylurea herbicides have long residual period and serious residual accumulation in soil, resulting in chemical damage to the next crop and thus great economic loss.
Pyrazosulfuron-ethyl is a sulfonylurea side chain amino acid synthesis inhibitor, has the characteristics of high activity, high conduction speed and long persistent period, is mainly used for preventing and controlling broadleaf weeds, sedges and other malignant weeds in paddy fields, but has long half-life period in soil, strong mobility and easy pollution to soil and underground water, and particularly has high pyrazosulfuron-ethyl content in industrial wastewater discharged by pyrazosulfuron-ethyl production enterprises and great influence on the safety of environment and crops. The method for restoring the polluted environment by utilizing functional microorganisms is an in-situ bioremediation technology, has the characteristics of high efficiency, economy, no secondary pollution and the like, and is the mainstream and development direction of the soil and water organic pollutant restoration technology. In recent years, studies on the microbial degradation of sulfonylurea herbicides in soil have been reported at home and abroad, and the microorganisms involved in the degradation of sulfonylurea herbicides include fungi, bacteria and actinomycetes. And the research on the microbial degradation of pyrazosulfuron-ethyl is less, key enzyme genes in the degradation process are not reported, the metabolic pathway and the degradation mechanism are not clear, and the research on the aspects of the restoration of the environment polluted by pyrazosulfuron-ethyl and the ecological safety is seriously restricted.
Disclosure of Invention
One purpose of the invention is to provide a pyrazosulfuron-ethyl hydrolase gene pyfE, and a protein coded by the pyrazosulfuron-ethyl hydrolase gene pyfE and an application of the pyrazosulfuron-ethyl hydrolase gene pyfE, so that the pyrazosulfuron-ethyl degradation efficiency is safely and quickly improved.
Particularly, the invention provides a pyrazosulfuron-ethyl hydrolase gene pyfE for encoding pyrazosulfuron-ethyl hydrolase protein, wherein the nucleotide sequence of the hydrolase gene pyfE is SEQ ID NO.1 in a sequence table.
The invention also provides pyrazosulfuron-ethyl hydrolase protein PyfE, wherein the amino acid sequence of the pyrazosulfuron-ethyl hydrolase protein is SEQ ID No.2 in the sequence table.
The invention also provides a construction method of an expression vector pET29a-pyfE of the pyrazosulfuron-ethyl hydrolase gene pyfE, which comprises the following steps:
s1: designing a pair of specific primers for a hydrolase gene pyfE nucleic acid sequence, introducing NdeI enzyme cutting sites into a forward primer, and introducing HindIII enzyme cutting sites into a reverse primer;
s2: amplifying by PCR a pyfE gene containing an enzyme cleavage site, said pyfE gene not containing a stop codon;
s3: the PCR product of S2 was digested simultaneously with restriction endonucleases Nde I and Hind III and purified using a gel recovery kit;
s4: the product of S3 was ligated with pET29a vector, which had been subjected to the same double-restriction enzyme digestion, by T4 DNA ligase, thereby obtaining recombinant expression vector pET29 a-pyfE.
Preferably, the specific primer is a primer selected from the group consisting of,
a forward primer:
S-F:5’-CTGATTGCATATGGAAACTGACAACGTGGAGCT-3’；
reverse primer:
S-R:5’-TACAAGCTTGCTTTCGTTCTGATCTAAGC-3’。
the hydrolase gene pyfE cloned from the pyrazosulfuron-ethyl degrading bacteria BI-1 disclosed by the invention is a first pyrazosulfuron-ethyl degrading gene, breaks ester bonds of a pyrazosulfuron-ethyl side chain to form corresponding acid, has important significance for researching a pyrazosulfuron-ethyl microbial degradation mechanism and ecological safety, and can also be used for introducing the degrading gene into crops through modern biotechnology to construct pyrazosulfuron-ethyl resistant transgenic crops so as to effectively remove phytotoxicity.
The invention discloses a method for constructing a genetically engineered bacterium of a pyrazosulfuron-ethyl degradation gene pyfE, which is characterized in that an expression vector pET29a-pyfE is introduced into an expression strain Escherichia coli BL21(DE3), a large amount of pyrazosulfuron-ethyl hydrolase PyfE is expressed, and the purified pyrazosulfuron-ethyl hydrolase PyfE is applied to pyrazosulfuron-ethyl contaminated soil, so that pyrazosulfuron-ethyl in the soil can be degraded quickly and efficiently, and the normal growth of corn can be maintained. The stem and leaf length, the root length, the fresh weight of the stem and leaf and the fresh weight of the root of the corn are obviously reduced due to the presence of pyrazosulfuron-ethyl in soil, and the inhibition rates are 71.5%, 87.9%, 73.2% and 82.3% respectively. When the reaction solution treated by PyfE hydrolase is added, the indexes of the corn growth are not obviously different from those of the control, which shows that the reaction product has no influence on the corn growth. The pyrazosulfuron-ethyl-containing enzyme is thrown into polluted soil, can effectively degrade pyrazosulfuron-ethyl residues, ensures the normal growth of crops because metabolites have no toxicity to the crops, can be subsequently prepared into an enzyme preparation for in-situ remediation, and has very good application prospect.
The above and other objects, advantages and features of the present invention will become more apparent to those skilled in the art from the following detailed description of specific embodiments thereof, taken in conjunction with the accompanying drawings.
Drawings
Some specific embodiments of the invention will be described in detail hereinafter, by way of illustration and not limitation, with reference to the accompanying drawings. The same reference numbers in the drawings identify the same or similar elements or components. Those skilled in the art will appreciate that the drawings are not necessarily drawn to scale. In the drawings:
FIG. 1 is an HPLC chart of the effect of wild type strain BI-1 and mutant strain delta BI-1 on pyrazosulfuron-ethyl degradation, A: pyrazosulfuron-ethyl control; b: pyrazosulfuron-ethyl + BI-1; c: pyrazosulfuron-ethyl +. DELTA.BI-1;
FIG. 2 is an SDS-PAGE picture of pyrazosulfuron-ethyl hydrolase PyfE;
FIG. 3 is the effect of temperature on enzyme activity and stability;
FIG. 4 is a graph showing the effect of pH on enzyme activity and stability.
FIG. 5 is a graph of the effect of metal ions and chemical agents on enzyme activity;
figure 6 metabolic pathway for PyfE hydrolase degradation of pyrazosulfuron-ethyl, a: pyrazosulfuron-ethyl primary mass spectrum; b: pyrazosulfuron-ethyl secondary mass spectrometry; c: a first-order mass spectrum of the product; d: and (5) performing secondary mass spectrum on the product.
Detailed Description
The nucleotide sequence of the pyrazosulfuron-ethyl hydrolase gene pyfE is SEQ ID NO.1 and 1197 bp.
The amino acid sequence of the pyrazosulfuron-ethyl hydrolase PyfE is SEQ ID NO.2, 398 aa.
BI-1, identified as a bacterium of the genus Chenggangzhanggellla, deposited at the China center for type culture Collection on 7.7.26.2019 under accession number: CCTCC M2019586.
Aiming at the lack of the existing pyrazosulfuron-ethyl microbial degradation mechanism research, the invention clones a hydrolase gene pyfE from a strain BI-1, the gene is the first reported gene about pyrazosulfuron-ethyl microbial degradation, the length of the gene is 1197bp, the hydrolase PyfE coded by the gene is relatively stable below 40 ℃, and the enzyme activity is kept above 70% of the original enzyme activity. The enzyme activity is sharply reduced from 40 ℃, and completely loses activity at 70 ℃. The optimum temperature experiment shows that the enzyme activity of PyfE is lower below 15 ℃, and the enzyme activity gradually increases along with the temperatureIt gradually rises. The activity is strong between 35 ℃ and 50 ℃, and the optimal temperature is 40 ℃. The PyfE is stable in the pH range of 6.0-9.0, the relative enzyme activity is still more than 80%, and the PyfE is most stable in the pH range of 7.5-8.0. And when the pH value is more than 9.0 or less than 5.0, the relative enzyme activity of PyfE is sharply reduced, and the enzyme activity is basically lost when the pH value is 4.0. The PyfE enzyme activity is stronger within the pH range of 7.0-8.0, and the optimum reaction pH is 7.5. 1mM of Ag+、Cd2+、Zn2+And the surfactant SDS, 2.0mM methamidophos, 0.5mM serine protease inhibitor PMSF, histidine denaturant DEPC, sulfydryl reagent pCMB and iodoacetamide can strongly inhibit the activity of PyfE. 1.0mM Ni2+Can inhibit enzyme activity by about 40-50%. The enzyme inhibition effect of 10mM metal ion chelating agents EDTA and Tween 80 is less than 10%. HPLC-MS analysis shows that PyfE can break ester bonds of the benzene ring side chain of pyrazosulfuron-ethyl to generate corresponding acid, and the weeding activity is lost, so that the composition is harmless to the environment and has good application value.
The pyrazosulfuron-ethyl hydrolase gene pyfE has the nucleotide sequence of SEQ ID No.1 and the length of 1197 bp.
ATGGAAACCGATAAAAAAACCGGAACGTCCCGCAGATCATTTGTGAAGGCTGCTGGAACCGGCGCAATAGGAATAGCGACGCTGCCGCTTTCGACTGCAACTGCTTTCGCGGAAACTGACAACGTGGAGCTTGCCCAATCGAAGCGGAAGGTTGTCCTTGCTGAACAAGGCAGTTTCTACATCGGGGGCAGAACAGTAACCGGGCCTGGAAAATTCGATCCGTCAAAGCCGGTAATTCGTGCCTCCAACGAAGGTGCCACGTTTTATATCAATCAAATGTACGTAAACTTTCAAGCTCCTGTGCGCCCTCGTGGGCTGCCTCTAGTCTTTTGGCATGGGGGCGGACTAACCGGCCATATCTGGGAATCTACCCCAGACGGCCGCCCCGGATTTCAGACCCTCTTTGTTCAAGATCGGCATACGGTCTACACGATTGATCAGCCAGGGCGCGGAAGGGGCAATATTCCTACCTTTAATGGCCCTTTTGGGCAGTTGGAAGAAGAGTCGATTGTTAACACTGTTACCGCAAACGTTAGTAAAGAACGCGCGTGGGTTAGAGATCGACTAGGGCCCGCTCCCGGCCAGTTTTTTGAGAACAGCCAATTCCCACGTGGTTATGAAGACAACTACTTCAAGGAGATGGGGTTCAGTCCGTCGATCTCATCAGATGAGATAGTCGACGCTGTTGTTAAACTAGTAACTCACATAGGTCCTTGTGTTCTGGTGACCCATTCGGCTTCCGGAGTACTGGGCATGCGAGTCGCGACAGCGGCCAAGAACGTGAGGGGGATCGTTGCTTATGAGCCTGCGACAAGTATCTTTCCCAAAGGAAAAGTGCCTGAGATACCGCCTCTCGCCGATAAAAAGTCGCAAATTTTCCCGCCGTTCGAGATCCAGGAGTCTTACTTTAAGAAGCTCGCGAAGATACCCATTCAGTTTGTCTTCGGAGATAATATCCCCAAGAACCCTAAATCCGCCTATTGGTTCTTGGACTGGTGGAGAGTCACTCGCTACGCTCACAGCTTGTCACTCGAGGCTATCAATAAGCTCGGTGGTCAAGCGTCTCTTTTGGATTTGCCGACTGCGGGACTTCGCGGCAACACGCATTTTCCATTCACCGACCGGAATAACGTGCAGGTCGCTTCTCTGTTATCTGATTTCCTCGGAAAGCACGGCTTAGATCAGAACGAAAGCTGA
The amino acid sequence of the pyrazosulfuron-ethyl hydrolase PyfE is SEQ ID NO.2, and the length is 398 aa.
METDKKTGTSRRSFVKAAGTGAIGIATLPLSTATAFAETDNVELAQSKRKVVLAEQGSFYIGGRTVTGPGKFDPSKPVIRASNEGATFYINQMYVNFQAPVRPRGLPLVFWHGGGLTGHIWESTPDGRPGFQTLFVQDRHTVYTIDQPGRGRGNIPTFNGPFGQLEEESIVNTVTANVSKERAWVRDRLGPAPGQFFENSQFPRGYEDNYFKEMGFSPSISSDEIVDAVVKLVTHIGPCVLVTHSASGVLGMRVATHAKNVRGIVAYEPATSIFPKGKVPEIPPLADKKSQIFPPFEIQESYFKKLAKIPIQFVFGDNIPKNPKSAYWFLDWWRVTRYAHSLSLEAINKLGGQASLLDLPTAGLRGNTHFPFTDRNNVQVASLLSDFLGKHGLDQNES
Example 1
One, obtaining a hydrolase gene pyfE in the pyrazosulfuron-ethyl high-efficiency degradation strain BI-1
The strain used in the invention is a pyrazosulfuron-ethyl efficient degradation strain Chenggangzhanggellla sp.BI-1 separated by the inventor, continuous streak passage is carried out on an R2A solid plate without selective pressure to obtain a mutant strain, as shown in figure 1, the strain can not degrade pyrazosulfuron-ethyl, the strain is named as delta BI-1, the genomes of a wild strain BI-1 and the mutant strain delta BI-1 are sequenced, genomics shows that an Open Reading Frame (ORF) is arranged in a deleted fragment in the genome of the strain delta BI-1, the length of the ORF is 1197bp, and in the comparison result of an NCBI database, the homology of the strain delta BI-1 with a hydrolase gene sulE presumed in Hansschlegelelia zhihuaae S113 at the nucleic acid level and the amino acid level is 99%, and the gene is named as pyfE. The nucleotide sequence of the gene is SEQ ID NO.1, and the amino acid sequence is SEQ ID NO. 2.
Example 2
Secondly, a method for constructing a pET29a-pyfE recombinant vector and a method for purifying a hydrolase PyfE are provided
A pair of specific primers is designed by taking the total DNA of the strain BI-1 as a PCR template according to a nucleic acid sequence of a pyrazosulfuron-ethyl hydrolase gene pyfE:
the forward primer is
5'-CTGATTGCATATGGAAACTGACAACGTGGAGCT-3' (NdeI restriction site is introduced);
the reverse primer is
S-R: 5'-TACAAGCTTGCTTTCGTTCTGATCTAAGC-3' (HindIII site introduced).
The pyfE gene containing the cleavage site (not containing the stop codon TGA) was amplified by PCR to form a cohesive end by cleavage and ligated to expression vector pET29a having the same cohesive end to express PyfE fusion protein containing a 6 XHis tail at the C-terminus.
The PCR product of pyrazosulfuron-ethyl hydrolase gene pyfE was digested simultaneously with restriction endonucleases Nde I and Hind III and purified with a gel recovery kit, and then ligated with pET29a vector subjected to the same double digestion treatment by T4 DNA ligase, thereby obtaining recombinant expression vector pET29 a-pyfE.
Since the transformation efficiency of E.coli BL21(DE3) competent cells was much lower than that of E.coli DH 5. alpha., pET29a-pyfE was first transformed into E.coli DH 5. alpha. cells and applied to cells containing 50 mg. L-1Kanamycin (Km) on LB solid plate, culturing for 16-20h at 37 ℃, then picking positive clone and extracting plasmid to send to biology company for sequencing.
E.coli BL21(DE3) competent cells were transformed by selecting the recombinant expression plasmid pET29a-pyfE with the correct sequence to construct an expression strain. Applying to LB (50 mg. L)-1Km) plate, cultured at 37 ℃ for about 16 hours, picked single colonies were inoculated into 50mL of LB liquid medium, and cultured overnight at 37 ℃ with shaking at 180 rpm. Inoculating to fresh LB liquid medium at 1% inoculum size, culturing at 37 deg.C for about 3.5h, and determining OD600Increasing to about 0.5, adding IPTG to a final concentration of 0.1mM, culturing at 37 deg.C for 12h, centrifuging to collect thallus, washing the thallus twice with pre-cooled double distilled water, and suspending the thallus cells with appropriate amount of pre-cooled phosphate buffer PBS (20mM, pH 7.5). Sonicating for 5min, centrifuging at 12000rpm at 4 ℃ for 10min, and leaving the supernatant.
Before NTA resin regeneration, all solution is required to flow out from the lower end of the chromatographic column, the resin volume of NTA is estimated, regeneration reagent is added into the chromatographic column according to the following steps, and the next regeneration solution is added after the last regeneration solution flows out. The sequence of steps is as follows:
adding 2 times of volume of nickel stripping buffer solution; adding 2 times of deionized water by volume; adding 2 times of volume of nickel stripping buffer solution; adding 1 volume of 25% ethanol; adding 1 volume of 50% ethanol; adding 1 volume of 75% ethanol; adding 5 times of 100% ethanol by volume; adding 1 volume of 75% ethanol; adding 1 volume of 50% ethanol; adding 1 volume of 25% ethanol; adding 1 time volume of deionized water; adding 5 times of volume of nickel stripping buffer solution; adding 3 times of deionized water for washing; adding 5 times of volume of charged buffer solution; add 10 volumes of binding buffer and equilibrate the resin.
10mL of the supernatant (resuspended in binding buffer, imidazole concentration 5mM in binding buffer) was added to the column in two portions, and the flow rate was adjusted to approximately 0.3-0.4 mL. multidot.min-1After loading has begun, the permeate (which is present if the protein of interest is not bound to the column) is collected.
The bed was washed with 10-20 bed volumes of wash buffer (imidazole concentration 10 mM).
The flow valve was closed, 20 bed volumes of elution buffer (imidazole concentration 100mM) were added, the bed was gently agitated and soaked for 30 min.
The flow valve was opened and elution was started and the flow through was collected with a 5mL centrifuge tube, one tube per 2.5-3.0 mL.
Collected samples with pyrazosulfuron-ethyl hydrolase activity were combined into one tube and the protein concentration was determined using the Bradford method. Bovine serum albumin was used as a standard protein. Since nickel ions may have a certain inhibiting effect on the activity of pyrazosulfuron-ethyl hydrolase, the purified protein needs to be dialyzed to remove nickel ions.
Since the pyrazosulfuron-ethyl hydrolase PyfE expressed by escherichia coli fuses 6 His tails, the protein can be purified by a Ni-NTA affinity chromatography column. The purified protein can obtain a clear target band through SDS-PAGE electrophoresis as shown in figure 2, and the molecular weight of the hydrolase monomer is about 41KDa which is basically consistent with the presumed protein size according to judgment of a combined protein Marker.
Example 3
Thirdly, determining the effect of temperature on PyfE hydrolase
Pyrazosulfuron-ethyl with a final concentration of 20 μ M was used as a substrate, and the purified PyfE was added to a final concentration of 0.02 μ g/mL-1The method comprises the steps of respectively using 50mM PBS with pH7.5 as buffer solution to form a reaction system (10mL), carrying out water bath for 10min at different temperature ranges (15 ℃, 20 ℃, 25 ℃, 30 ℃, 35 ℃, 40 ℃, 50 ℃, 60 ℃ and 70 ℃), measuring the reduction amount of the substrate pyrazosulfuron-ethyl, wherein the treatment with the largest reduction amount of the pyrazosulfuron-ethyl is the optimal temperature, and setting blank controls without enzyme solution at each temperature gradient to determine the spontaneous degradation condition of the substrate at different temperatures. The enzyme thermal stability was measured by first subjecting purified protein samples to water bath for 1h at the above different temperatures, adding the treated enzyme solution to 50mM PBS buffer pH7.5, and adding 20. mu.M pyrazosulfuron-ethyl and PyfE hydrolase to a final concentration of 0.02. mu.g/mL-1The reaction was carried out at 40 ℃ for 10 min. And (4) quantitatively detecting the concentration of the pyrazosulfuron-ethyl by HPLC.
Determination of pyrazosulfuron-ethyl concentration (HPLC method): adding 25% HCl into a reaction system to adjust the pH value to 2.0-3.0, adding dichloromethane with the same volume, fully shaking, standing for layering, removing an upper water phase, adding excessive anhydrous sodium sulfate into an organic phase to remove excessive water, putting 5mL of the organic phase into a 1.5mL centrifuge tube, placing the centrifuge tube in a fume hood until the solvent is completely volatilized, then concentrating and re-suspending with 0.2mL of methanol, filtering with a 0.22 mu m nylon filter membrane, and performing HPLC analysis. Liquid chromatography conditions: the liquid chromatograph is Shimadzu RID-10A; the liquid chromatographic column is a C18 reversed phase column with the specification of 250mm multiplied by 4.6mm multiplied by 5 mu m; the mobile phase is acetonitrile, water and acetic acid (60: 40: 0.5); the column temperature was 40 ℃; flow rate 1.0 mL/min-1(ii) a The detection wavelength was 250 nm.
As shown in FIG. 3, the pyrazosulfuron-ethyl hydrolase PyfE has thermal stability and optimum temperature. The results show that PyfE is stable below 40 ℃, and the enzyme activity is kept above 70% of the original enzyme activity. The enzyme activity is sharply reduced from 40 ℃, and completely loses activity at 70 ℃. The optimum temperature experiment shows that the enzyme activity of PyfE is lower below 15 ℃, and the enzyme activity gradually increases along with the increase of the temperature. The activity is strong between 35 ℃ and 50 ℃, and the optimal temperature is 40 ℃.
Example 4
Thirdly, determining the influence of pH value on PyfE hydrolase
According to the adjustable range of the common buffer solution: citric acid-sodium hydroxide buffer system (pH 4.0-5.5), phosphate buffer system (pH 5.0-8.0), Tris-HCl (pH 7.5-9.0), glycine-sodium hydroxide buffer system (pH 8.5-10.0), adjusting the ratio of different components in the buffer solution, adjusting the pH values to 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0 respectively, uniformly adjusting the final concentrations to 50mM, pyrazosulfuron-ethyl as a substrate with a final concentration of 20 μ M, adding purified PyfE to a final concentration of 0.02 μ g/mL-1And after the reaction is carried out in water bath at 40 ℃ for 10min, the concentration of pyrazosulfuron-ethyl is measured by HPLC, and a blank control without enzyme liquid is set for each pH gradient so as to determine the spontaneous degradation condition of the substrate under different pH values. The acid-base stability determination requires that the purified protein sample is treated for 1h under different pH gradients in advance, and then the treated enzyme solution is added into a 50mM PBS reaction system containing 20 mu M pyrazosulfuron-ethyl and pH7.5 to ensure that the final concentration of the enzyme is 0.02 mu g/mL-1Reacting at 40 ℃ for 10min, and quantitatively detecting pyrazosulfuron-ethyl by HPLC.
As shown in fig. 4, pyrazosulfuron-ethyl hydrolase PyfE has an acid-base stability and an optimal pH. From the acid-base stability test results, the PyfE is relatively stable within the pH range of 6.0-9.0, and after the purified PyfE is incubated for 1h within the pH range, the relative enzyme activity is still more than 80%, and the PyfE is most stable at the pH of 7.5-8.0. And after the PyfE is treated in a buffer solution with the pH value of more than 9.0 or less than 5.0 for 1 hour, the relative enzyme activity of PyfE is sharply reduced, and the enzyme activity is basically lost when the pH value is 4.0. The PyfE enzyme activity is strong within the pH range of 7.0-8.0, and the optimum pH is 7.5.
Example 5
Fifthly, determining the influence of metal ions and chemical reagents on PyfE hydrolase
Respectively adding metal ions with different concentrations, a surfactant, an enzyme inhibitor and a substrate pyrazosulfuron-ethyl in a standard enzyme activity reaction system, carrying out water bath reaction at 40 ℃ for 10min, and carrying out HPLC quantitative detection on the pyrazosulfuron-ethyl. The experiment was carried out while setting a treatment without adding any metal ion, surfactant, enzyme inhibitor as a negative control.
As shown in FIG. 5, 1mM Ag+、Cd2+、Zn2+And the surfactant SDS, 2.0mM methamidophos, 0.5mM serine protease inhibitor PMSF, histidine denaturant DEPC, sulfydryl reagent pCMB and iodoacetamide can strongly inhibit the activity of PyfE. 1.0mM Ni2+Can inhibit enzyme activity by about 40-50%. The enzyme inhibition effect of 10mM metal ion chelating agents EDTA and Tween 80 is less than 10%.
Example 6
The PyfE protein thus purified was added to a 10mL pyrazosulfuron-ethyl reaction system (50mM PBS buffer solution pH 7.5) to a final concentration of 0.02. mu.g/mL-1The concentration of the pyrazosulfuron-ethyl is 20 mu M, the reaction is carried out for 1h at 40 ℃, the sample is concentrated and collected, the metabolic products are detected by HPLC, and the appropriate sample is analyzed by adopting the mass spectrum technology.
As shown in figure 6, PyfE degrades the metabolic pathway of pyrazosulfuron-ethyl, PyfE can break ester bonds of the side chain of the benzene ring of pyrazosulfuron-ethyl to generate corresponding acid, thereby achieving the purpose of degrading pyrazosulfuron-ethyl.
Example 7
Taking 450g (without pyrazosulfuron-ethyl) of natural air-dried vegetable field soil sieved by a 20-mesh sieve into pots, simultaneously collecting reaction liquid after enzyme reaction under the optimal condition, concentrating, taking the reaction liquid without adding PyfE protein as a negative control, taking the reaction liquid without adding PyfE protein and pyrazosulfuron-ethyl as a blank control, adding the reaction liquid into the pots, uniformly stirring, spraying water to ensure that the water content of the reaction liquid reaches 40% of the saturated water content, transplanting corn seedlings into the pots for different treatments, and setting 4 parallel treatments for each treatment. Placing in artificial climate incubator (GXZ type intelligent illumination incubator, Ningbo Jiangnan Instrument factory, GXZ-500D), and culturing for 10D with 30 deg.C, 12h illumination and 20 deg.C, 12h dark as one period. And (4) measuring the stem and leaf length, the root length, the fresh weight of the stem and leaf and the fresh weight of the root system of the corn.
TABLE 1 toxicity test of PyfE-degrading pyrazosulfuron-ethyl metabolites on corn
Note: different letters represent significant differences at P <0.05 level (Duncan test)
The results are shown in table 1, the stem and leaf length, the root length, the fresh weight of the stem and leaf and the fresh weight of the root of the corn are obviously reduced due to the pyrazosulfuron-ethyl, and the inhibition rates are 71.5%, 87.9%, 73.2% and 82.3% respectively, which shows that the pyrazosulfuron-ethyl has obvious influence on the growth of the corn. When the reaction solution treated by PyfE hydrolase is added, the indexes of the corn growth are not obviously different from the control, and the reaction product has no influence on the corn growth, so that the enzyme has a very good application prospect, and the metabolite has no toxicity to the corn and can be prepared into an enzyme preparation for in-situ repair.
In conclusion, on one hand, the pyrazosulfuron-ethyl hydrolase gene pyfE is the first pyrazosulfuron-ethyl degrading gene, and the nucleotide sequence of the pyrazosulfuron-ethyl degrading gene can be used for constructing pyrazosulfuron-ethyl resistant transgenic crops to effectively remove phytotoxicity; on the other hand, the method for purifying the hydrolase PyfE is provided, the hydrolase PyfE is thrown into the polluted soil, the pyrazosulfuron-ethyl residue can be effectively degraded, the normal growth of crops is ensured, and an enzyme preparation can be prepared for in-situ remediation subsequently.
Thus, it should be appreciated by those skilled in the art that while a number of exemplary embodiments of the invention have been illustrated and described in detail herein, many other variations or modifications consistent with the principles of the invention may be directly determined or derived from the disclosure of the present invention without departing from the spirit and scope of the invention. Accordingly, the scope of the invention should be understood and interpreted to cover all such other variations or modifications.
Sequence listing
<110> south Yang college of learning
<120> pyrazosulfuron-ethyl hydrolase gene pyfE, protein coded by same and application of pyrazosulfuron-ethyl hydrolase gene pyfE
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1197
<212> DNA
<213> pyrazosulfuron-ethyl hydrolase gene pyfE, protein coded by same and application thereof (pyfE)
<400> 1
atggaaaccg ataaaaaaac cggaacgtcc cgcagatcat ttgtgaaggc tgctggaacc 60
ggcgcaatag gaatagcgac gctgccgctt tcgactgcaa ctgctttcgc ggaaactgac 120
aacgtggagc ttgcccaatc gaagcggaag gttgtccttg ctgaacaagg cagtttctac 180
atcgggggca gaacagtaac cgggcctgga aaattcgatc cgtcaaagcc ggtaattcgt 240
gcctccaacg aaggtgccac gttttatatc aatcaaatgt acgtaaactt tcaagctcct 300
gtgcgccctc gtgggctgcc tctagtcttt tggcatgggg gcggactaac cggccatatc 360
tgggaatcta ccccagacgg ccgccccgga tttcagaccc tctttgttca agatcggcat 420
acggtctaca cgattgatca gccagggcgc ggaaggggca atattcctac ctttaatggc 480
ccttttgggc agttggaaga agagtcgatt gttaacactg ttaccgcaaa cgttagtaaa 540
gaacgcgcgt gggttagaga tcgactaggg cccgctcccg gccagttttt tgagaacagc 600
caattcccac gtggttatga agacaactac ttcaaggaga tggggttcag tccgtcgatc 660
tcatcagatg agatagtcga cgctgttgtt aaactagtaa ctcacatagg tccttgtgtt 720
ctggtgaccc attcggcttc cggagtactg ggcatgcgag tcgcgacagc ggccaagaac 780
gtgaggggga tcgttgctta tgagcctgcg acaagtatct ttcccaaagg aaaagtgcct 840
gagataccgc ctctcgccga taaaaagtcg caaattttcc cgccgttcga gatccaggag 900
tcttacttta agaagctcgc gaagataccc attcagtttg tcttcggaga taatatcccc 960
aagaacccta aatccgccta ttggttcttg gactggtgga gagtcactcg ctacgctcac 1020
agcttgtcac tcgaggctat caataagctc ggtggtcaag cgtctctttt ggatttgccg 1080
actgcgggac ttcgcggcaa cacgcatttt ccattcaccg accggaataa cgtgcaggtc 1140
gcttctctgt tatctgattt cctcggaaag cacggcttag atcagaacga aagctga 1197
<210> 2
<211> 398
<212> PRT
<213> pyrazosulfuron-ethyl hydrolase gene pyfE, protein coded by same and application thereof (pyfE)
<400> 2
Met Glu Thr Asp Lys Lys Thr Gly Thr Ser Arg Arg Ser Phe Val Lys
1 5 10 15
Ala Ala Gly Thr Gly Ala Ile Gly Ile Ala Thr Leu Pro Leu Ser Thr
20 25 30
Ala Thr Ala Phe Ala Glu Thr Asp Asn Val Glu Leu Ala Gln Ser Lys
35 40 45
Arg Lys Val Val Leu Ala Glu Gln Gly Ser Phe Tyr Ile Gly Gly Arg
50 55 60
Thr Val Thr Gly Pro Gly Lys Phe Asp Pro Ser Lys Pro Val Ile Arg
65 70 75 80
Ala Ser Asn Glu Gly Ala Thr Phe Tyr Ile Asn Gln Met Tyr Val Asn
85 90 95
Phe Gln Ala Pro Val Arg Pro Arg Gly Leu Pro Leu Val Phe Trp His
100 105 110
Gly Gly Gly Leu Thr Gly His Ile Trp Glu Ser Thr Pro Asp Gly Arg
115 120 125
Pro Gly Phe Gln Thr Leu Phe Val Gln Asp Arg His Thr Val Tyr Thr
130 135 140
Ile Asp Gln Pro Gly Arg Gly Arg Gly Asn Ile Pro Thr Phe Asn Gly
145 150 155 160
Pro Phe Gly Gln Leu Glu Glu Glu Ser Ile Val Asn Thr Val Thr Ala
165 170 175
Asn Val Ser Lys Glu Arg Ala Trp Val Arg Asp Arg Leu Gly Pro Ala
180 185 190
Pro Gly Gln Phe Phe Glu Asn Ser Gln Phe Pro Arg Gly Tyr Glu Asp
195 200 205
Asn Tyr Phe Lys Glu Met Gly Phe Ser Pro Ser Ile Ser Ser Asp Glu
210 215 220
Ile Val Asp Ala Val Val Lys Leu Val Thr His Ile Gly Pro Cys Val
225 230 235 240
Leu Val Thr His Ser Ala Ser Gly Val Leu Gly Met Arg Val Ala Thr
245 250 255
His Ala Lys Asn Val Arg Gly Ile Val Ala Tyr Glu Pro Ala Thr Ser
260 265 270
Ile Phe Pro Lys Gly Lys Val Pro Glu Ile Pro Pro Leu Ala Asp Lys
275 280 285
Lys Ser Gln Ile Phe Pro Pro Phe Glu Ile Gln Glu Ser Tyr Phe Lys
290 295 300
Lys Leu Ala Lys Ile Pro Ile Gln Phe Val Phe Gly Asp Asn Ile Pro
305 310 315 320
Lys Asn Pro Lys Ser Ala Tyr Trp Phe Leu Asp Trp Trp Arg Val Thr
325 330 335
Arg Tyr Ala His Ser Leu Ser Leu Glu Ala Ile Asn Lys Leu Gly Gly
340 345 350
Gln Ala Ser Leu Leu Asp Leu Pro Thr Ala Gly Leu Arg Gly Asn Thr
355 360 365
His Phe Pro Phe Thr Asp Arg Asn Asn Val Gln Val Ala Ser Leu Leu
370 375 380
Ser Asp Phe Leu Gly Lys His Gly Leu Asp Gln Asn Glu Ser
385 390 395
Claims (7)
1. A pyrazosulfuron-ethyl hydrolase gene pyfE is characterized in that the pyrazosulfuron-ethyl hydrolase gene pyfE is used for encoding pyrazosulfuron-ethyl hydrolase protein, and the nucleotide sequence of the pyrazosulfuron-ethyl hydrolase gene pyfE is SEQ ID No.1 in a sequence table.
2. A pyrazosulfuron-ethyl hydrolase protein PyfE is characterized in that the amino acid sequence of the pyrazosulfuron-ethyl hydrolase protein is SEQ ID No.2 in a sequence table.
3. The construction of the expression vector pET29a-pyfE of pyrazosulfuron-ethyl hydrolase gene pyfE of claim 1, characterized by the following steps:
s1: designing a pair of specific primers for a hydrolase gene pyfE nucleic acid sequence, introducing NdeI enzyme cutting sites into a forward primer, and introducing HindIII enzyme cutting sites into a reverse primer;
s2: amplifying by PCR a pyfE gene containing an enzyme cleavage site, said pyfE gene not containing a stop codon;
s3: the PCR product of S2 was digested simultaneously with restriction endonucleases Nde I and Hind III and purified using a gel recovery kit;
s4: the product of S3 was ligated with pET29a vector, which had been subjected to the same double-restriction enzyme digestion, by T4 DNA ligase, thereby obtaining recombinant expression vector pET29 a-pyfE.
4. The method of claim 3, wherein the specific primer is,
a forward primer:
S-F:5’-CTGATTGCATATGGAAACTGACAACGTGGAGCT-3’；
reverse primer:
S-R:5’-TACAAGCTTGCTTTCGTTCTGATCTAAGC-3’。
5. the genetically engineered bacterium containing pyrazosulfuron-ethyl degrading gene pyfE as claimed in claim 1, characterized in that the expression vector pET29a-pyfE is introduced into expression strain Escherichia coli BL21(DE 3).
6. The use of the pyrazosulfuron-ethyl hydrolase PyfE of claim 2 for degrading pyrazosulfuron-ethyl.
7. The use of the pyrazosulfuron-ethyl hydrolase PyfE of claim 2 for the removal of pyrazosulfuron-ethyl from soil.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911225158 | 2019-12-04 | ||
| CN2019112251588 | 2019-12-04 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112980855A true CN112980855A (en) | 2021-06-18 |
Family
ID=76344248
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010737689.1A Pending CN112980855A (en) | 2019-12-04 | 2020-07-28 | Pyrazosulfuron-ethyl hydrolase gene pyfE and protein coded by same and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112980855A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111440754A (en) * | 2020-03-19 | 2020-07-24 | 南京农业大学 | Method for eliminating organic pollutant residues in soil by using genetically engineered methane-oxidizing bacteria |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102286501A (en) * | 2011-07-25 | 2011-12-21 | 南京农业大学 | Thifensulfuron methyl hydrolase tsmE gene and use thereof |
| CN108330116A (en) * | 2018-02-07 | 2018-07-27 | 北京大北农生物技术有限公司 | Herbicide tolerant protein, its encoding gene and purposes |
-
2020
- 2020-07-28 CN CN202010737689.1A patent/CN112980855A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102286501A (en) * | 2011-07-25 | 2011-12-21 | 南京农业大学 | Thifensulfuron methyl hydrolase tsmE gene and use thereof |
| CN108330116A (en) * | 2018-02-07 | 2018-07-27 | 北京大北农生物技术有限公司 | Herbicide tolerant protein, its encoding gene and purposes |
Non-Patent Citations (2)
| Title |
|---|
| XIANG-WEN LUO ET AL.: "Adaptation mechanism and tolerance of Rhodopseudomonas palustris PBS-S under pyrazosulfuron-ethyl stress", 《BMC MICROBIOL》, pages 1 - 11 * |
| 刘琛等: "吡嘧磺隆和苯噻酰草胺在水稻中的残留分析", 《环境化学》, pages 1653 - 1659 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111440754A (en) * | 2020-03-19 | 2020-07-24 | 南京农业大学 | Method for eliminating organic pollutant residues in soil by using genetically engineered methane-oxidizing bacteria |
| CN111440754B (en) * | 2020-03-19 | 2022-05-27 | 南京农业大学 | Method for eliminating organic pollutant residue in soil by using genetically engineered methane-oxidizing bacteria |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107502647B (en) | Method for preparing L-glufosinate-ammonium by racemization removal with biological enzyme method | |
| Puckett et al. | Differential expression of genes encoding phosphate transporters contributes to arsenic tolerance and accumulation in shrub willow (Salix spp.) | |
| CN113481126B (en) | Herbicide propanil specific degrading strain, degrading amidase gene and application | |
| CN107794271B (en) | Gentisic acid dioxygenase and coding gene and application thereof | |
| CN110791484A (en) | Glufosinate-ammonium dehydrogenase mutant and application thereof in production of L-glufosinate-ammonium | |
| CN109504645B (en) | Isoleucine dioxygenase, mutant and application in synthesis of 4-hydroxyisoleucine | |
| CN109971773B (en) | Gene dsmI for coding gentisic acid dioxygenase DsmI capable of degrading 3-chlorogentisic acid and application thereof | |
| CN110714002B (en) | Plant nitrilase mutant, coding gene and application thereof | |
| CN110205332B (en) | Encoding gene for enhancing tolerance of plant to cadmium poison and reducing cadmium content of plant and application | |
| Macek et al. | Accumulation of cadmium ions by hairy root cultures | |
| CN112980855A (en) | Pyrazosulfuron-ethyl hydrolase gene pyfE and protein coded by same and application | |
| CN109762800B (en) | Acetamiprid amidase gene aceAB and coding protein and application thereof | |
| CN108129556B (en) | Rice-derived cadmium metal binding protein and coding gene and application thereof | |
| CN112322648A (en) | ABC transporter gene MRP1S and preparation method and application thereof | |
| CN111321092B (en) | (R, S) -2, 4-dichlorprop degrading strain and dioxygenase gene for specifically degrading (S) -type isomer thereof | |
| CN110055268B (en) | Hydrolase gene ameH and protein coded by same and application of hydrolase gene ameH | |
| CN107022555B (en) | Glutamine synthetase gene with glufosinate-ammonium resistance and application thereof | |
| CN113735282B (en) | Old yellow enzyme OYE2 protein and application thereof in chromium pollution | |
| CN109439573B (en) | Bacterial strain with specific conversion function on S-napropamide, amidohydrolase, coding gene and application thereof | |
| CN113088504B (en) | Modified acid phosphatase and application thereof | |
| CN111088180B (en) | Pyrazosulfuron-ethyl degradation strain BI-1 and application thereof | |
| CN111607573A (en) | Aminophosphine oxidoreductase with glyphosate degradation activity and application thereof | |
| CN108998429A (en) | The albumen and application of nitroreductase gene lnr and its coding | |
| CN111139255B (en) | Propanil amidase gene pamD and coding protein and application thereof | |
| CN109943571B (en) | Metallothionein gene MT20, metallothionein obtained by encoding metallothionein gene MT20, expression and application of metallothionein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |