CN112410236B - Geranyl-like geraniine synthetase C mutant and construction method and application thereof - Google Patents
Geranyl-like geraniine synthetase C mutant and construction method and application thereof Download PDFInfo
- Publication number
- CN112410236B CN112410236B CN202011322518.9A CN202011322518A CN112410236B CN 112410236 B CN112410236 B CN 112410236B CN 202011322518 A CN202011322518 A CN 202011322518A CN 112410236 B CN112410236 B CN 112410236B
- Authority
- CN
- China
- Prior art keywords
- synthetase
- geranylgeranyl
- mutant
- recombinant
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y402/00—Carbon-oxygen lyases (4.2)
- C12Y402/03—Carbon-oxygen lyases (4.2) acting on phosphates (4.2.3)
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Mycology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a geranylgeranyl-like synthetase C mutant and a construction method and application thereof, belonging to the technical field of biological catalysis. The invention adopts a recombinant DNA technology to clone a geranyl-like synthetase C coding gene into an expression vector and transform a host to obtain a recombinant strain with high geranyl-like synthetase C yield. And carrying out directed evolution on amino acid residues on a loop structure around an active site E474 of the geranyl-like synthetase C, and screening to obtain the high-activity geranyl-like synthetase C mutant. The invention also provides the application of the method in preparing products containing thujaplicin. The high-activity geranylgeranyl-like synthetase C mutant and the method obtained by the invention can efficiently catalyze and produce thujaplicin and can promote the application of the thujaplicin in the fields of agriculture, tobacco and the like.
Description
Technical Field
The invention relates to a geranylgeranyl-like synthetase C mutant and a construction method and application thereof, belonging to the technical field of biological catalysis.
Background
In the context of the global insecticide market, chemically synthesized active compounds such as pyrethrum derivatives and most notably neonicotinoids (such as imidacloprid, thiamethoxam and clothianidin; worth 18.9 billion dollars) can act rapidly against pests but not targeted discrimination products. Neonicotinoids are the main class of insecticides that mediate all insect neurotoxic effects by irreversible binding to nicotinic acetylcholine receptors. Chemical pesticides have a number of disadvantages, for example: easily causes environmental pollution, gradually breeds the drug resistance of target population, has negative effect on non-target population and the like. Thus, these compounds can affect pests and beneficial insects such as bees and bumblebees, thereby negatively affecting crop and biodiversity pollination in rural areas. Chemical pesticides even endanger the sustainability of industrial agricultural activities and the still growing population. In addition, these chemicals are poorly biodegradable, leading to environmental accumulation, which negatively impacts the biodiversity of terrestrial and aquatic ecosystems. The wide environmental impact of neonicotinoids has recently triggered the european commission to severely limit the applicability of these compounds in agricultural activities.
Biological pesticide is also called natural pesticide, is derived from natural chemical substances or living bodies, and has the functions of sterilization pesticide and insecticidal pesticide. In contrast, biopesticides have many advantages: the selected natural insecticidal compound is nontoxic to off-target insects, ensures that only positive influence is generated on agricultural activities and crop yield, is safe to human and livestock, has small influence on ecological environment, induces pests to be ill, can be processed and produced by using agricultural and sideline products, is easily and rapidly degraded by terrestrial microorganisms or light, cannot be accumulated, and the like. The biological agriculture types in China mainly comprise six types, namely microbial pesticides, botanical pesticides, agricultural antibiotics, natural enemy insect pesticides, biochemical pesticides, plant growth regulator pesticides and the like. The thuja occidentalis trienol is an important diterpenoid compound, is a secretion component of plants, represents a main component of the plants for defending insects, pathogenic microorganisms and herbivores, and has important function and significance in the aspect of biological control. Cypress trienol can only be detected in trace amounts in plants, but it has significant insecticidal activity and does not accumulate in ecosphere during natural degradation.
Meanwhile, the thujaplicin is also one of flavor substances in the tobacco, and has important influence and effect significance on the quality of the tobacco. Although the thujaplicin has received a certain attention in recent years, the related reports and data are few. The thujaplicin can be extracted from plants, but is only detected in trace amount in plants, and is low in content. Therefore, the method for extracting the thujaplicin from the plants has certain challenges and is too high in production cost to be applied to agricultural production. The geranylgeranyl-like synthetase C from tobacco can catalyze the production of a substrate GGPP to obtain thujaplicin, and the structure of the enzyme contains DDXXD and (N, D) DXX (S, T) XXXE sequences with more aspartic acid, and also contains a magnesium cluster structure. However, the activity of the existing geranylgeranyl synthetase C is low, the biological catalysis efficiency is low, and the application of industrial production is not facilitated.
Disclosure of Invention
In order to solve the technical problems, the geranylgeranyl synthetase C mutant is provided, which can efficiently catalyze and produce thujaplicin and promote the application of the thujaplicin in the fields of agriculture, tobacco and the like.
The first purpose of the invention is to provide a recombinant bacterium for expressing a geranylgeranyl synthetase C, wherein the recombinant bacterium is used for expressing the geranylgeranyl synthetase C with an amino acid sequence shown as SEQ ID NO.1 in a host bacterium, or a geranylgeranyl synthetase C mutant which has more than 95% of homology with the amino acid sequence shown as SEQ ID NO.1 and has the activity of the geranylgeranyl synthetase C.
Further, the host bacteria are saccharomyces cerevisiae, pichia pastoris, escherichia coli or bacillus subtilis.
Furthermore, the mutant of the geranylgeranyl synthetase C is the 474 th site of the parent with the amino acid sequence shown as SEQ ID NO.1
The amino acid residues on the loop structure in the range are mutated.
Furthermore, the geranylgeranyl synthetase C mutant is obtained by mutating histidine at position 471 of a parent with an amino acid sequence shown as SEQ ID NO.1 into glycine, alanine or lysine, or mutating glutamic acid at position 472 into glycine, alanine or aspartic acid, or mutating valine at position 473 into glycine, alanine or isoleucine, or mutating glutamine at position 475 into asparagine, or mutating glutamine at position 476 into asparagine, glycine or serine, or mutating arginine at position 477 into lysine or glycine, or mutating glycine at position 478 into proline, or mutating histidine at position 479 into glycine, alanine, lysine or arginine. Namely H471G, H471A, H471K, E472G, E472A, E472D, V473G, V473A, V473I, Q475N, Q476N, Q476G, Q476S, R477K, R477G, G686478 8, H479G, H479A, H479K, H479R.
The second purpose of the invention is to provide a geranylgeranyl synthetase C mutant, which is 474 th position of a parent with an amino acid sequence shown as SEQ ID NO.1
The amino acid residues on the loop structure in the range are mutated.
Furthermore, the mutant is obtained by mutating histidine at position 471 of a parent with an amino acid sequence shown as SEQ ID NO.1 into glycine, alanine or lysine, or mutating glutamic acid at position 472 into glycine, alanine or aspartic acid, or mutating valine at position 473 into glycine, alanine or isoleucine, or mutating glutamine at position 475 into asparagine, or mutating glutamine at position 476 into asparagine, glycine or serine, or mutating arginine at position 477 into lysine or glycine, or mutating glycine at position 478 into proline, or mutating histidine at position 479 into glycine, alanine, lysine or arginine.
The third purpose of the invention is to provide a gene for coding the geranylgeranyl synthetase C mutant.
The third purpose of the invention is to provide the construction method of the recombinant bacterium, which comprises the following steps: cloning coding genes of geranylgeranyl synthetase C or geranylgeranyl synthetase C mutant to an expression vector to obtain a recombinant plasmid; and (3) transforming the recombinant plasmid into host bacteria, and screening to obtain the recombinant bacteria expressing the geranylgeranyl synthetase C.
The fourth purpose of the invention is to provide the application of the recombinant bacterium or the geranylgeranyl synthetase C mutant in the catalytic production of thujaplicin.
Further, the recombinant bacterium fermentation enzyme liquid or the geranylgeranyl synthetase C mutant is adopted to catalyze a substrate geranylgeranyl pyrophosphate to produce the thujaplicin trienol.
Further, the recombinant bacterium fermentation enzyme liquid is prepared by inoculating the recombinant bacterium into a fermentation culture medium, and fermenting at the temperature of 28-32 ℃ and the rotation speed of 150-; wherein the fermentation medium comprises 0.5-6% of glucose, 0.5-3% of yeast powder and 0.5-6% of peptone by mass.
Further, the catalysis condition is that 10-60 mL of normal hexane is covered on the reaction liquid surface, and the temperature is kept at 20-35 ℃ for 0.5-10 h.
The invention has the beneficial effects that:
biocatalysis has important role and significance in the production process of important chemicals and the like. The invention adopts a recombinant DNA technology to clone a geranyl-like synthetase C coding gene to an expression vector and transform a host to obtain a recombinant strain with high yield of geranyl-like synthetase C. And carrying out directed evolution on amino acid residues on a loop structure around an active site E474 of the geranyl-like synthetase C, and screening to obtain the high-activity geranyl-like synthetase C mutant. The invention also provides the application of the method in preparing products containing thujaplicin. The high-activity geranylgeranyl-like synthetase C mutant and the method obtained by the invention can efficiently catalyze and produce thujaplicin and can promote the application of the thujaplicin in the fields of agriculture, tobacco and the like.
Drawings
FIG. 1 is a colony diagram of recombinant bacteria transformed from recombinant plasmid containing geranylgeranyl synthetase C gene;
FIG. 2 is a GC-MS detection diagram of the production of thujaplicin by a geranylgeranyl synthetase C catalytic substrate;
FIG. 3 is a diagram showing the structure of the tertiary structure of geranylgeranyl synthase C and the loop around E474;
FIG. 4 is a diagram of the catalytic production of thuja trienol by a C site H471 mutant of geranylgeranyl synthetase;
FIG. 5 is a diagram of the catalytic production of cetostearyl alcohol by a geranylgeranyl synthetase C site Q476 mutant.
Detailed Description
The present invention is further described below in conjunction with the following figures and specific examples so that those skilled in the art may better understand the present invention and practice it, but the examples are not intended to limit the present invention.
Example 1:
in this example, the amino acid sequence of geranylgeranyl-like synthetase C was codon optimized to synthesize the complete sequence of gene nsc. By designing primers: nsc _ FW (SEQ ID No.2) GGAATTATGTGGTACGAACTAGGCAGCAC and nsc _ RS (SEQ ID No.3) TCCCCCGGGAATGTCTACGCTGTCTACAA, both ends of which add cleavage sites: EcoR I and Sma I. After being digested by EcoR I and Sma I, the fragments were ligated to a Saccharomyces cerevisiae (Saccharomyces cerevisiae) expression vector pYX212 to obtain a recombinant plasmid. Through double enzyme digestion verification of the recombinant plasmid by adopting EcoR I and Sma I, a target geranylgeranyl synthetase C fragment is successfully inserted into the recombinant plasmid. Further carrying out gene sequencing on the target fragment, wherein the result of the gene sequencing shows that the target fragment is correct. And (3) transforming the constructed recombinant plasmid containing the geranylgeranyl synthetase C gene into an S.cerevisiae W303 host by adopting an electrotransformation mode, and coating an auxotrophic plate to obtain a large number of single colonies containing the recombinant plasmid. Screening and identifying to obtain a recombinant strain with high yield of geranylgeranyl synthetase C, and naming the recombinant strain as S.
Example 2:
in the embodiment, a culture medium (0.5-6% of glucose, 0.5-3% of yeast powder and 0.5-6% of peptone) is adopted to carry out fermentation culture on a production strain S.cerevisiae W303-pYX212-nsc which is constructed and screened to produce the geranylgeranyl synthetase C with high yield, so as to express and produce the geranylgeranyl synthetase C. The culture conditions were: the inoculation amount is 2%, the culture temperature is 30 ℃, the rotating speed of a shaking table is 200rpm, and the fermentation time is 48 h. The S.cerevisiae W303-pYX212-nsc whole cell obtained after fermentation is subjected to SDS-PAGE electrophoresis, and compared with a control strain (containing a pYX212 empty plasmid), a protein band is formed near 64kDa and is consistent with the theoretical molecular weight of the geranylgeranyl synthetase C, which indicates that the geranylgeranyl synthetase C realizes successful heterologous expression in S.cerevisiae. Meanwhile, growth conditions of a production strain S.cerevisiae W303-pYX212-nsc of the geranylgeranyl synthetase C and a control strain (containing a pYX212 empty plasmid) are analyzed, and compared with the control strain, the growth of the recombinant strain S.cerevisiae pYX212-nsc is slightly slow, which is probably caused by that the expression of the recombinant geranylgeranyl synthetase C protein has a certain inhibiting effect on the cell growth.
Example 3:
in the embodiment, geranylgeranyl pyrophosphate (GGPP) serving as a catalytic substrate is used for efficiently producing a product of thujatriprenol by using geranylgeranyl synthetase C enzyme liquid obtained by fermentation production. Buffer solution: 150mL of 20mM phosphate buffer (pH 7.5), 25mL of 1M MgCl 2 25mL of glycerol. The reaction system is as follows: 2mL of geranylgeranyl synthetase C enzyme solution, 10% of GGPP and 4.4mL of buffer solution. The specific reaction conditions are as follows: in the reaction system, 20mL of n-hexane was added to cover the reaction liquid surface, and the temperature was maintained at 30 ℃ for 18 hours. Mixing the reaction solution, centrifuging at 10,000 Xg, and detecting the content of thuja trienol by GC-MS. The efficient production of the thujaplicin is realized by the biocatalysis of the geranylgeranyl synthetase C enzyme solution, and the product concentration can reach 51 mg/L.
Example 4:
this example determines the E474 surroundings by analysis based on the C tertiary structure of geranylgeranyl synthetase
8 amino acid residues in the loop structure within the range (H471, E472, V473, Q475, Q476, R477, G478, H479). Designing degenerate primer (H471-FW (SEQ ID NO.4): GACCACGAANNKGAACAACAA; H471-RS (SEQ ID NO.5): TTGTTGTTCMNNTTCGTGGTC) aiming at one amino acid residue H471, carrying out saturation mutation on the amino acid residue position, transforming the amino acid residue position into an S.cerevisiae W303 host, coating an auxotrophic plate, and obtaining a large number of single bacteria containing recombinant plasmidsAnd (6) dropping. Obtaining a mutant with high activity by high-throughput screening, wherein the sequencing result shows that the mutants are respectively as follows: H471G, H471A, H471K (fig. 4). When the method of embodiment 3 is adopted to carry out catalytic reaction on a substrate GGPP, the catalytic production of thuja trienol by the mutant is obviously improved, and the yield can reach 1.5, 1.2 and 1.1g/L respectively.
Example 5:
this example is directed to the E474 surroundings which are determined analytically on the basis of the C tertiary structure of the geranylgeranyl synthetase
One of 8 amino acid residues in the loop structure within the range of Q476, degenerate primers (Q476-FW (SEQ ID NO.6): CAACAACGCNNKCACGTAGCC; Q476-RS (SEQ ID NO.7): GGCTACGTGMNNGCGTTGTTG) were designed to carry out saturation mutagenesis on the amino acid residue site, transformed into S.cerevisiae W303 host, and plates for auxotrophy were coated to obtain a large number of single colonies containing recombinant plasmids. Obtaining mutants with high activity by high-throughput screening, and displaying the mutants as follows by a sequencing result: Q476N, Q476G, Q476S (fig. 5). When the method of embodiment 3 is adopted to carry out catalytic reaction on the substrate GGPP, the mutant is used for catalyzing and producing the cedrenol, the yield is obviously improved, and the yield can reach 1.0, 1.1 and 0.9g/L respectively.
The above-mentioned embodiments are merely preferred embodiments for fully illustrating the present invention, and the scope of the present invention is not limited thereto. The equivalent substitutions or changes made by the person skilled in the art on the basis of the present invention are all within the protection scope of the present invention. The protection scope of the invention is subject to the claims.
Sequence listing
<110> geranylgeranyl synthetase C mutant and construction method and application thereof
<120> university of south of the Yangtze river
<160> 7
<170> PatentIn version 3.3
<210> 1
<211> 569
<212> PRT
<213> (Artificial sequence)
<400> 1
Trp Tyr Glu Leu Gly Ser Thr Ser Asn Gly Arg Gln Cys Ala Gly Ile
1 5 10 15
Ala Leu Met Asn Arg Ala Met Asp Leu Ser Ser Ser Ser Arg Pro Val
20 25 30
Ala Asp Phe Pro Ser Thr Ile Trp Gly Asp His Phe Leu Ser Tyr Asn
35 40 45
Ser Glu Ile Thr Glu Ile Thr Thr Gln Glu Lys Asn Glu Ile Glu Ala
50 55 60
Leu Lys Glu Gln Thr Arg Lys Met Leu Val Leu Ala Thr Pro Asp Asn
65 70 75 80
Ser Thr Gln Lys Leu Asn Leu Ile Asp Thr Ile Gln Arg Leu Gly Leu
85 90 95
Ala Tyr His Phe Asn Asp Glu Ile Asp Asp Ile Leu Asp Gln Ile Phe
100 105 110
Asn Leu Ser Gln Asn Ser Glu Asp Asp Asp Glu His Asn Leu Tyr Val
115 120 125
Ala Ala Leu Gln Phe Arg Leu Ala Arg Gln Gln Gly Tyr Tyr Met Ser
130 135 140
Pro Glu Ile Phe Lys Gln Phe Thr Asn His Asp Gly Lys Phe Lys Glu
145 150 155 160
Asn His Thr Asn Asp Val Gln Gly Leu Leu Ser Leu Tyr Glu Ala Ala
165 170 175
His Met Arg Val His Ala Asp Asp Ile Leu Glu Glu Ala Leu Ile Phe
180 185 190
Thr Thr Thr His Leu Glu Ser Ala Ala Pro Asn Leu Ser Asn Ser Leu
195 200 205
Lys Val Gln Val Thr His Ala Leu Ser His Pro Ile Arg Lys Gly Val
210 215 220
Pro Arg Val Gly Ala Arg Lys Tyr Ile His Ile Tyr Glu Asn Ile Gly
225 230 235 240
Thr His Asn Asn Val Leu Leu Lys Phe Ala Lys Leu Asp Phe Asn Leu
245 250 255
Leu Gln Lys Leu His Arg Lys Glu Leu Asn Glu Leu Thr Ser Trp Trp
260 265 270
Lys Asp Leu Asp Phe Val Thr Thr Leu Pro Tyr Ala Lys Asp Arg Leu
275 280 285
Val Glu Ala Tyr Phe Trp Thr Val Gly Ile Tyr Phe Glu Pro Gln Tyr
290 295 300
Ser Gln Ala Arg Ser Leu Val Thr Lys Val Val Lys Met Asn Ser Ile
305 310 315 320
Val Asp Asp Thr Tyr Asp Ala Tyr Ala Thr Phe Asp Glu Leu Glu Ala
325 330 335
Tyr Thr Asp Ala Ile Gln Arg Trp Asp Glu Gly Ala Met Asp Arg Leu
340 345 350
Pro Thr Tyr Leu Arg Pro Ile Tyr Gln Gly Leu Leu Asp Val Phe Asn
355 360 365
Glu Met Glu Glu Val Leu Ala Lys Glu Gly Lys Ala Asp His Ile Tyr
370 375 380
Tyr Ala Ile Glu Arg Met Lys Lys Val Ala Glu Val Tyr Phe Lys Glu
385 390 395 400
Ala Glu Trp Leu Asn Ala Asn Tyr Thr Pro Lys Cys Glu Glu Tyr Met
405 410 415
Lys Asn Gly Leu Val Ser Ser Thr Gly Pro Met Tyr Gly Ile Ile Ser
420 425 430
Leu Val Val Met Glu Glu Ile Ile Thr Lys Glu Ala Phe Glu Trp Leu
435 440 445
Ser Lys Asn Pro Leu Ile Leu Arg Ala Ala Ser Thr Ile Cys Arg Leu
450 455 460
Met Asp Asp Met Ala Asp His Glu Val Glu Gln Gln Arg Gly His Val
465 470 475 480
Ala Ser Phe Val Glu Cys Tyr Met Lys Glu Tyr Gly Val Ser Lys Gln
485 490 495
Glu Ala Tyr Val Glu Met Arg Lys Lys Ile Thr Asn Ala Trp Lys Asp
500 505 510
Ile Asn Glu Gly Leu Leu Arg Pro Thr Ala Val Pro Met Phe Ile Leu
515 520 525
Glu Arg Ser Leu Asn Phe Ser Arg Ile Val Glu Thr Phe Leu Lys Asp
530 535 540
Asp Asp Gly Tyr Thr His Pro Lys Ser Lys Val Lys Asp Leu Ile Ile
545 550 555 560
Asn Leu Phe Val Asp Ser Val Asp Ile
565
<210> 2
<211> 29
<212> DNA
<213> (Artificial sequence)
<400> 2
ggaattatgt ggtacgaact aggcagcac 29
<210> 3
<211> 29
<212> DNA
<213> (Artificial sequence)
<400> 3
tcccccggga atgtctacgc tgtctacaa 29
<210> 4
<211> 21
<212> DNA
<213> (Artificial sequence)
<220>
<221> misc_feature
<222> (10)..(11)
<223> n is a, c, g, or t
<400> 4
gaccacgaan nkgaacaaca a 21
<210> 5
<211> 21
<212> DNA
<213> (Artificial sequence)
<220>
<221> misc_feature
<222> (11)..(12)
<223> n is a, c, g, or t
<400> 5
ttgttgttcm nnttcgtggt c 21
<210> 6
<211> 21
<212> DNA
<213> (Artificial sequence)
<220>
<221> misc_feature
<222> (10)..(11)
<223> n is a, c, g, or t
<400> 6
caacaacgcn nkcacgtagc c 21
<210> 7
<211> 21
<212> DNA
<213> (Artificial sequence)
<220>
<221> misc_feature
<222> (11)..(12)
<223> n is a, c, g, or t
<400> 7
ggctacgtgm nngcgttgtt g 21
Claims (8)
1. A recombinant bacterium for expressing a geranylgeranyl synthetase C is characterized in that the recombinant bacterium expresses a geranylgeranyl synthetase C mutant in a host bacterium, and the geranylgeranyl synthetase C mutant is obtained by mutating histidine at position 471 of a parent shown as SEQ ID NO.1 in amino acid sequence into glycine, alanine or lysine, or mutating glutamine at position 476 into asparagine, glycine or serine.
2. The recombinant strain of claim 1, wherein the host strain is Saccharomyces cerevisiae, Pichia pastoris, Escherichia coli, or Bacillus subtilis.
3. A geranylgeranyl synthetase C mutant is characterized in that histidine at the 471 th position of a parent shown as SEQ ID NO.1 in an amino acid sequence is mutated into glycine, alanine or lysine, or glutamine at the 476 th position is mutated into asparagine, glycine or serine.
4. A gene encoding a geranylgeranyl synthase C mutant according to claim 3.
5. A method for constructing a recombinant bacterium according to any one of claims 1 to 2, comprising the steps of: cloning the coding gene of the geranylgeranyl synthetase C mutant to an expression vector to obtain a recombinant plasmid; and (3) transforming the recombinant plasmid into host bacteria, and screening to obtain the recombinant bacteria expressing the geranylgeranyl synthetase C.
6. The use of the recombinant bacterium of any one of claims 1-2 in catalytic production of thuja trienol, wherein the recombinant bacterium is used for producing thuja trienol by catalyzing a substrate, namely geranylgeranyl pyrophosphate, with an enzyme solution prepared by fermentation of the recombinant bacterium.
7. The use as claimed in claim 6, wherein the enzyme solution is prepared by inoculating the recombinant bacteria into the fermentation medium, fermenting at 150-250rpm for 40-60h at 28-32 ℃; the fermentation medium comprises, by mass, 0.5-6% of glucose, 0.5-3% of yeast powder and 0.5-6% of peptone.
8. The application of claim 6, wherein the catalysis condition is that 10-60 mL of n-hexane is covered on the reaction liquid surface, and the temperature is kept at 20-35 ℃ for 0.5-10 h.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011322518.9A CN112410236B (en) | 2020-11-23 | 2020-11-23 | Geranyl-like geraniine synthetase C mutant and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011322518.9A CN112410236B (en) | 2020-11-23 | 2020-11-23 | Geranyl-like geraniine synthetase C mutant and construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112410236A CN112410236A (en) | 2021-02-26 |
| CN112410236B true CN112410236B (en) | 2022-08-30 |
Family
ID=74777383
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011322518.9A Active CN112410236B (en) | 2020-11-23 | 2020-11-23 | Geranyl-like geraniine synthetase C mutant and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112410236B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1252838A (en) * | 1997-12-16 | 2000-05-10 | 丰田自动车株式会社 | Geranyl diphosphate synthase genes |
| CN104694557A (en) * | 2015-02-10 | 2015-06-10 | 江苏省海洋水产研究所 | Geranylgeranyl pyrophosphate synthase gene and coding protein and application thereof |
| CN110894503A (en) * | 2019-11-06 | 2020-03-20 | 三明学院 | Geraniyl pyrophosphate synthase gene derived from Anoectochilus formosanus and application thereof |
-
2020
- 2020-11-23 CN CN202011322518.9A patent/CN112410236B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1252838A (en) * | 1997-12-16 | 2000-05-10 | 丰田自动车株式会社 | Geranyl diphosphate synthase genes |
| CN104694557A (en) * | 2015-02-10 | 2015-06-10 | 江苏省海洋水产研究所 | Geranylgeranyl pyrophosphate synthase gene and coding protein and application thereof |
| CN110894503A (en) * | 2019-11-06 | 2020-03-20 | 三明学院 | Geraniyl pyrophosphate synthase gene derived from Anoectochilus formosanus and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112410236A (en) | 2021-02-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2016258912A1 (en) | Isolated complex endophyte compositions and methods for improved plant traits | |
| CA2984509A1 (en) | Designed complex endophyte compositions and methods for improved plant traits | |
| CN111100805B (en) | Rice sheath blight disease bactericide prepared by using boron-resistant lysine bacillus as chassis cells | |
| CN108949584A (en) | A kind of Aspergillus terreus bacterial strain that salt resistance is alkaline-resisting, its ITS sequence and application | |
| CN107760621B (en) | Iprodione degrading bacterium, degrading enzyme IpaH, encoding gene ipaH and application thereof | |
| CN101985627B (en) | Novel esterase and application thereof | |
| CN111100818A (en) | Geobacillus altitudinis SWY137 and application thereof | |
| CN112852699A (en) | Recombinant bacterium for producing cembretriene monoalcohol and application thereof | |
| KR20220008867A (en) | Targeting Sequences for Paenibacillus-Based Endospore Display Platform | |
| CN110452911A (en) | Corn ATP binding cassette transporter body protein raq gene ZmABCE2 and application | |
| CN113388536A (en) | Construction method and application of saccharomyces cerevisiae for producing cembretriene monoalcohol | |
| CN112410236B (en) | Geranyl-like geraniine synthetase C mutant and construction method and application thereof | |
| CN112899208B (en) | Method for increasing yield of recombinant bacterium cembratriene-alcohol | |
| US20220304313A1 (en) | Methods for degrading ahl signaling molecules or preventing plant disease caused thereby | |
| CN110055268A (en) | The albumen and application of hydrolase gene ameH and its coding | |
| CN113416662B (en) | Saccharomyces cerevisiae for producing cembratriene monoalcohol and application thereof | |
| CN115850413A (en) | Polypeptide CYS3 influencing seed germination | |
| Laktionov et al. | Determination of toxicity of various preparative forms of pesticidal fungicides for nodule bacteria inoculants | |
| CN110352961B (en) | Genetically engineered escherichia coli strain and application thereof | |
| CN111154675B (en) | Bacillus acidocaldarius SYY15 and application thereof | |
| CN109517814B (en) | Mutant of organophosphorus degrading enzyme and application thereof | |
| CN102417899A (en) | Metallic cadmium resistance associated protein KdpD and coding gene and application thereof | |
| Adedayo et al. | Unraveling the functional genes present in rhizosphere microbiomes of Solanum lycopersicum | |
| Bustamante-Torres et al. | Application of microbes in biotechnology, industry, and medical field | |
| CN112314631B (en) | Biological source pesticide and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |