CN101654678A - Analysis and application of salvia miltiorrhiza bunge isopentenylpyrophosphate isomerase (SmIPPI) gene - Google Patents

Abstract

The invention discloses a salvia miltiorrhiza bunge isopentenylpyrophosphate isomerase (IPPI) gene, a protease coded by the IPPI genes and an application thereof. The gene is obtained by cloning fromsalvia miltiorrhiza bunge through utilizing a cDNA chip technology for the first time, thus the invention fills the blank of separating and cloning the SmIPPI gene from the salvia miltiorrhiza bunge which is a conventional famous and precious Chinese medicinal plant. The SmIPPI gene has a nucleotide sequence represented by SEQ ID NO.1 or adds, substitutes, inserts or deletes one or more nucleotidehomologous sequences or an allele thereof and a nucleotide sequence derived from the nucleotide homologous sequence. A protein coded by the SmIPPI genes has an amino acid sequence represented by SEQID NO.2 or adds, substitutes, inserts or deletes one or more amino acid homologous sequences. The SmIPPI gene can be applied to researches and industrialization for improving the content of diterpeneactive constituents in the salvia miltiorrhiza bunge by a biotechnology method and improving the content of tanshinone substances by utilizing a transgenic technology, is helpful to the quality improvement, the selective breeding, and the like of medicinal materials of the salvia miltiorrhiza bunge and has good application prospect.

Description

The analysis and the application of a kind of red sage root isopentenylpyrophosphate isomerase (SmIPPI) gene

Technical field

The invention belongs to medicinal plant genetically engineered field, specifically, relate to and utilize the cDNA chip technology to clone a kind of new red sage root isopentenylpyrophosphate isomerase (isopentenyl diphosphate isomerase, IPPI) gene transforms this gene to improve the method for diterpenes secondary metabolite content in the red sage root.

Background technology

The formation of active components in medicinal plant (secondary metabolite) is the product of peculiar gene in the Secondary Metabolism of Plant approach.Along with plant functional genomics research extensively with deeply, show unique characteristics and have the research of the synthetic correlation function gene of medicinal plant secondary metabolism of broad prospect of application to become the focus of research gradually, the clone of these genes will crack the biosynthetic pathway and the regulatory mechanism thereof of active components in medicinal plant, for the formation of medical material quanlity is provided fundamental basis, bring wide application space for utilizing biotechnology to improve target component content or direct production effective constituent or intermediate simultaneously.

Terpene (terpene) is the class native hydrocarbon compounds that vegitabilia extensively exists, and has the basic framework that isoprene (isoprene) unit is formed, and according to the difference of institute's isoprene containing number, terpene can be divided into monoterpene, sesquiterpene, diterpene, triterpene etc.Many diterpene-kind compounds are one of secondary metabolites important in the plant, and a lot of activeconstituentss such as taxol, Tanshinone I I A, trypterygine first, second element etc. are diterpene-kind compound in the medicinal plant.Medicinal plant red sage root Salvia miltiorrhiza Bge. is conventional Chinese medicine simply, have the laudatory title of " red sage root, merit is with four things " simply, has promoting blood circulation and removing blood stasisly, and the effect of regulating QI to relieve pain is the main component of numerous compounds, healthcare products.Mainly contain two active components in the red sage root: fat-soluble diterpene quinone and water miscible phenolic acid compound.

The terpenoid biosynthetic pathway also is called isoprenoid biosynthetic pathway (isoprenoid biosynthesispathway), is made up of mevalonate pathway (MVA) and pyruvic acid, phosphoglyceraldehyde approach (MEP).The MVA approach is present in tenuigenin and plastosome, is mainly sterol, specific sesquiterpene and ubiquinone etc. precursor substance is provided; The MEP approach is positioned at plastid, is mainly hemiterpene, monoterpene, diterpene and polyterpene etc. precursor substance is provided.IPPI is in the position that crosses of MVA and MEP approach just, and its function is the isomerization between catalysis isopentenyl pyrophosphate (IPP) and the methyl propenyl pyrophosphate (DMAPP).Subsequently, between IPP and the DMAPP, and between the intermediate product of IPP and DMAPP condensation generation, repeatedly polyreaction can take place, finally synthesize various isoprenoid class materials.

The metabolism stream that the expression level of isopentenylpyrophosphate isomerase gene directly influences the synthetic five carbon precursor storehouses of terpene flows to, and is the master switch (2000) of downstream pathways metabolism.Kajiwara thinks (1997), the intravital isopentenylpyrophosphate isomerase of plant may be a critical rate-limiting enzyme, and yield of lycopene increased 3.6-4.5 doubly after they changed isolating IPPI cDNA in yeast (pharfi arhosozyma) and the Haematocoocus Pluvialls over to coli strain JM101.Sun etc. (1998) import external source IPPI gene in unicell green alga, cause in the cell carotenoid to be accumulated in a large number, and content and the positive correlation of IPPI expression of gene amount.Therefore, the IPPI gene is an important regulatory factor in the terpene substances biosynthesizing, and its overexpression is beneficial to metabolism and flows to downstream flow, will promote the biosynthesizing of downstream associated products.

IPPI in the plant is Blanc in 1996 the earliest, and V.M. etc. are cloned in uncle favour mandarin coat (Clarkia breweri), is that Campbell in 1998 etc. are cloned in Arabidopis thaliana and the IPPI of function is really arranged.In a lot of species, all be cloned into the IPPI gene subsequently, as rubber tree (Hevea brasiliensis), tobacco (Nicotiana tabacum), corn (Zea mays) etc.Red sage root Sm IPPI gene fragment has been cloned in the present invention first from the medicinal plant red sage root, adopt the RACE technology to clone the full length sequence that obtains its cDNA, and it is carried out Function Identification and transgeneic procedure.Before the present invention comes forth, any disclose or reported red sage root isopentenyl transferase genes and aminoacid sequence thereof mentioned in the present patent application are not arranged as yet.

Summary of the invention

The object of the present invention is to provide a kind of making, hybridization, differential gene analysis and functional gene clone's of red sage root cDNA chip method, and provide a kind of mistake to express the IPPI gene to improve the method for ter penoids content in the red sage root.Red sage root cDNA chip clone key gene, the IPTG that the present invention relates to induces escherichia coli prokaryotic expression, vector construction, genetic transformation, Molecular Detection, tanshinone component to extract and content assaying method is used for the present invention, has established solid basis for utilizing transgenosis red sage root scale operation effective constituent.

The present invention is achieved by the following technical solutions: the present invention uses the cDNA method for gene chip and clone the IPPI gene from the red sage root, the changing conditions of SmIPPI expression of gene situation and Tanshinone I I A content after the detection methyl jasmonate treatment; Structure contains the escherichia coli prokaryotic expression carrier of described dna molecular, and IPTG induces prokaryotic expression; The plant that structure contains described dna molecular crosses expression vector, with Agrobacterium tumefaciens mediated, the IPPI gene is imported the red sage root and the plant that regenerates; PCR detects the integration situation of external source goal gene IPPI, and HPLC measures diterpenes component content in the red sage root, and screening obtains the transgenosis red sage root plant that the diterpenes component content significantly improves.

The present invention includes following concrete steps:

(1) adopt the cDNA chip method to obtain red sage root isopentenylpyrophosphate isomerase (SmIPPI) gene;

(2) cDNA of SEQID No.1 gene is cloned between the restriction enzyme HindIII and BamH I site of prokaryotic expression carrier pET32a, obtains expression vector, utilize CaCl ₂Obtain containing the coli strain of this expression vector etc. method.

(3) change E.coli BL21 (DE3) expressive host bacterium over to and adopt the IPTG abduction delivering, expression product is behind preliminary purification, and joining with IPP or DMAPP is in the external enzymatic reaction system of substrate, gets upper strata ether extract GC-MS detection reaction product.The result shows that this isomerase can also can form IPP for substrate catalysis with DMAPP with IPP for substrate catalysis forms DMAPP.From the peak area result, this isomerase utilizes the efficient difference of substrate, and being more prone to IPP is that substrate carries out to the DMAPP direction.

(4) make up the plant that contains the IPPI gene and cross expression vector, transform agrobacterium tumefaciens, obtain to be used to transform the agrobacterium tumefaciens bacterial strain that contains IPPI gene plant expression vector of the red sage root;

(5) utilize constructed agrobacterium tumefaciens bacterial strain to transform the red sage root, obtain the transgenosis red sage root plant that detects through PCR;

(6) ter penoids content in the transgenosis red sage root that obtains is carried out HPLC and measure, screening obtains the transgenosis red sage root plant that diterpenes component contents such as TANSHINONES, Cryptotanshinone, Tanshinone I I A significantly improve.

The result shows, dihydrotanshinone in crossing the transgenosis root of hair high yield strain system of expressing the SmIPPI gene, Cryptotanshinone, Tanshinone I and Tanshinone II A content improve respectively than non-transgenic control group: 1.4,3.6,2.5,3 times, prove that tentatively the SmIPPI gene has vital role in red sage root secondary metabolite generative process.This result for cultivate high-quality medicinal plant kind particularly the red sage root have important theory and practical significance.

Red sage root isopentenyl pyrophosphate isomerase provided by the present invention (SmIPPI) clone's preparation from the red sage root has first been filled up from the blank of China's medicine plant red sage root isopentenyl pyrophosphate isomerase gene.Utilize the present invention can improve the content of terpene activeconstituents tanshinone material in the plants such as the red sage root by genetic engineering technique.Transgene result shows, red sage root isopentenyl pyrophosphate isomerase gene can be used to improve the research and the industrialization of component contents such as TANSHINONES by transgenic technology, especially the quality-improving that can be used for the Chinese medicinal materials red sage root, can alleviate the weary problem of the serious plaque in tanshinone medicine source, have promoter action preferably to improving tanshinone material output, have good application prospects.

Embodiment

Below embodiments of the invention are elaborated: present embodiment is being to implement under the prerequisite with the technical solution of the present invention, provided detailed embodiment and concrete operating process, but protection scope of the present invention is not limited to following embodiment.

The making of embodiment 1, red sage root cDNA chip

1, the separation of the total RNA of the red sage root and detection

Get Shanglou, Shaanxi red sage root (Salvia Miltiorrhiza Bge) root 2g, with the quick grind into powder of liquid nitrogen, the 10mL that is transferred to 65 ℃ of preheatings fast extracts (CTAB (W/V) 2%, Tris-HCl (pH8.0) 100mmolL in the damping fluid in mortar ^-1, EDTA 25m molL ^-1, NaCl 2.0molL ^-1, PVP402%, spermidine 0.5g/L, mercaptoethanol 2%), mixing fully vibrates; With equal-volume chloroform extracting twice, centrifugal 15 minutes of 7500g.Supernatant liquor adds the 10M LiCl of 1/4 volume, places 4 ℃ of precipitations behind the mixing and spends the night; Centrifugal 20 minutes of 7500g, (SDS 0.5%, NaCl 1molL with 500 μ L SSTE for precipitation ^-1, Tris-HCl (pH8.0) 10mmolL ^-1, EDTA 1mmolL ^-1, 65 ℃ of dissolvings 5 minutes.With the extracting of equal-volume chloroform, centrifugal 5 minutes of 13000g; Supernatant liquor adds 2 times of volume dehydrated alcohols, places 2h for-70 ℃; Centrifugal 20 minutes of 4 ℃ of 13000g, the precipitation drying at room temperature is dissolved in after 10 minutes in the water that 100 μ L DEPC handle, and detects the integrity of RNA with 1.0% agarose electrophoresis, with GenQuant nucleic acid quantification instrument mensuration A260, A280 ratio and concentration.Place-80 ℃ of refrigerators standby.

2, the structure in cDNA library

Adopt mRNA purification kit (QuichprepTM Micro mRNA PurifiCation Kit, Pharmacia company) behind the separating mRNA, by add EcoR I/Not I joint at cDNA molecule two ends, phosphorylation under the effect of T4 polynucleotide kinase, with expression vector λ ZAP Express Predigested Vector (ZAP Express Predigested VectorKit, stratagene company) connects, adopt the ZAP Express Pridigested Gigapack CloningKits (EcoRI/CIAP-Treated) of stratagene company that packaging protein is connected product in external packing then, infect E.coli XL1-Blue MRF ' and be built into the cDNA library.

3, the preparation of cDNA chip

3.1PCR amplification

Picking separates good plaque and is dissolved in the 100 μ L SM damping fluids (Amresco company) behind the mixing as pcr template.The pcr amplification primer is the partial sequence of λ ZAP Express multiple clone site both sides: the M13-20 primer: 5 '-GTAAAACGACGGCCAGTG-3 ', the BK reverse primer: 5 '-GGAAACAGCTATGACCTTG-3 '.96 orifice plate PCR reaction systems are prepared following mixture: dNTP (25mmolL-1), 600 μ L; Mg2+600 μ L, 10 * damping fluid, 1000 μ L; Taq (Takara Ex Taq, 5U μ L ^-1), 40 μ L; M13-20 primer (12.5 μ molL-1), 200 μ L; BK reverse primer (12.5 μ molL-1) 200 μ L; High purity water complements to 10mL.After mixing, be filled to 96 hole PCR plates with volley of rifle fire branch.Respectively add 6 μ L dna profilings then, mix.In the reaction of the enterprising performing PCR of ABI9700 type gene-amplificative instrament, reaction conditions is 94 ℃ of pre-sex change 3 minutes, carries out 35 circulations then, is 94 ℃ of 30s, 54 ℃ of 30s, 72 ℃ 2 minutes, extended 5 minutes after 72 ℃ after the loop ends.Get 3 μ L reaction product and containing electrophoresis on 1.5% the sepharose of EB, under SYNGENE type gel imaging system, observe, take pictures.

3.2PCR product purification

Use 96 hole Multiscreen filter plates (Millipore company) purifying plates to carry out the purifying of PCR product.Sepharose detection under the 1.4.1 item is changed in the purifying plate for the PCR product of single band (100 μ L); The purifying plate is put on the vacuum unit of Millipore, in 15mmHg vacuum filtration 10 minutes, until draining; Add 100 μ L water, 15mmHg vacuum filtration 10 minutes is until draining; Take off PCR purifying plate from the vacuum filtration device, add the water of 40 μ L (about pH8.0), the purifying plate is put 20～30 minutes resuspended DNA of jog to the shaking table; With the purified product sucking-off, place and measure concentration and purity on the enzyme plate; Get 1 μ L purified product electrophoresis detection on 1.5% sepharose; With purified product vacuum-drying.

3.3cDNA chip point system

Concentration difference according to said determination adds an amount of 50%DMSO as sampling liquid, regulates concentration to about 250ng μ L-1, will prepare chip point system in sample transfer to 384 orifice plate.Point sample instrument is the OmniGrid of GeneMachine company 100.The point sample parameter is: pin: 2 * 12, and X:8000, Y:6000; Dot spacing: 300microns; Dot matrix: 13 * 14; Spacing of lattice: 500microns; Matrix pattern: 4 * 12.

The clone of embodiment 2, red sage root isopentenylpyrophosphate isomerase gene

1, the preparation of experiment material

Hairy Root Cultures of Salvia miltiorrhiza is that the mode of Agrobacterium rhizogenes 15834 direct infections is carried out Ri-plasmid conversion inductive hairly root.Get 6, the 7-V solid medium is hidden (not containing hormone) Hairy Root Cultures of Salvia miltiorrhiza of preservation, the wet root of 2g is inoculated in the 500mL triangular flask of 6-7V liquid nutrient medium that 200ml is housed does not have hormone to carry out succeeding transfer culture under aseptic condition, is cultured to behind the 18d as test materials.Culture condition is 25 ℃, 110～120rmin ^-1, dark condition is cultivated down.

2, the preparation of elicitor and processing

Yeast extract (yeast extract, YE) preparation of biotic induce: get the 25g yeast extract and be dissolved in the 125mL distilled water, add the 100mL dehydrated alcohol, place 4 ℃ of refrigerators to leave standstill 4d, supernatant liquor inclines, gelatinous precipitate is dissolved in the 125mL distilled water, add dehydrated alcohol (ethanol content reaches 80%) secondary sedimentation, centrifugal, precipitation is dissolved in the 100mL distilled water, 120 ℃ of sterilization 20min, it is standby that cooling is placed on 4 ℃ of refrigerators.

Silver ions (Ag ⁺) preparation: get AgNO35.096g and be dissolved in the 100mL distilled water, be prepared into the Ag of 3mmolL-1 ⁺

Elicitor is handled: add elicitor combination YE+Ag+ (YE 2ml, Ag in the Hairy Root Cultures of Salvia miltiorrhiza substratum of cultivating 18d respectively ⁺66.7ul) induce processing, each handles 3 repetitions, respectively at YE+Ag ⁺Handle back different times results, blot with thieving paper, each sample takes by weighing about 2g fresh weight-70 ℃ of preservations (extracting total RNA) or 40 ℃ behind liquid nitrogen flash freezer and is dried to constant weight, and the dry weight of precision weighing hairly root is used for measuring the content of hairly root Tanshinone II A.

3, elicitor is handled the content of back Tanshinone I I A

Adopt the high effective liquid chromatography for measuring elicitor to handle the content of back Tanshinone I I A.It is an amount of to get the Hairy Root Cultures of Salvia miltiorrhiza that is dried to constant weight, grinds 40 mesh sieves, mixing.The about 0.2g of material fine powder that gets it filled, precision weighing is put in the 20mL volumetric flask, adds methanol solution 4mL, and precision is weighed, and supersound process 40min takes out and puts coldly, adds methanol solution and complements to original weight, shakes up, and leaves standstill, and crosses 0.45 μ m millipore filtration promptly.Chromatographic condition is: Waters 2695 high performance liquid chromatographs, and RP-Waters C18 post (150mm * 3.9mm, 5 μ m) detects wavelength: 270nm; Column temperature: 30 ℃, flow velocity 1.0mmin ^-1, moving phase is 0.5% acetate methanol (A) and 0.5% acetic acid water (B) linear gradient elution: 0～25min, 30%～60%A; 25～30min, 60%～65%A; 30～50min, 65%～70%A; 50～60min, 70%～80%A; 60～61min, 80%～30%A.After the elicitor processing, Tanshinone II A content rises rapidly, handles back 48h, Tanshinone II A YE+Ag ⁺Treatment group is 2.1 times of control group, and processing back 6d treatment group is 5.4 times of control group, handles back 9d, and treatment group is 6.9 times of control group.The result shows Hairy Root Cultures of Salvia miltiorrhiza after elicitor is handled, and tanshinone component is run-up at short notice.

4, chip hybridization analysis

According to the changing conditions of above-mentioned elicitor processing back Tanshinone I I A, select YE+Ag for use ⁺The hairly root of 48h and control group are reference with control group (C), with YE+Ag as the chip hybridization sample after handling ⁺(YA) material is hybridized, and repeats twice, and every group is all adopted positive back mark to eliminate the error of dyestuff.

Adopt the indirect labelling method to carry out probe mark, comprise double-stranded cDNA is synthetic, T7 mediates the synthetic cRNA of RNA in-vitro transcription, random primer reverse transcription, cDNA steps such as KLENOW enzyme labelling.

(1) double-stranded cDNA is synthetic: get the total RNA of 5g, with T7-Oligo (dT) 15, (5 '-AAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGCGCTTTTTTTTTTTTTT TTV-3 ', V can be G, C and A, Shanghai Bo Ya Bioisystech Co., Ltd) be primer, with cDNA Synthesis Kit (TaKaRa company) synthetic double chain cDNA; Double-stranded synthetic later on QIAquick PCR PurifiCation Kit (Qiagen company) purifying.

(2) the synthetic cRNA of in-vitro transcription: double-stranded cDNA is carried out the synthetic cRNA of in-vitro transcription with T7RiboMAX Express Large Scale RNA Production System (Promega company); Use RNeasy test kit (Qiagen company) purifying then.

(3) random primer reverse transcription: get 2g cRNA, use the SuperscriptII ThermoScript II, 200U μ L ^-1(Invitrogen company), 9Random Primer carries out reverse transcription, reverse transcription product QIAquick PCR PurifiCation Kit (Qiagen company) purifying.

(4) cDNA KLENOW enzyme labelling: get 1g cRNA reverse transcription product, carry out the KLENOW mark with random primer, marked product is drained behind the purifying with QIAquick PCR PurifiCation Kit (Qiagen company) purifying.DATP in the labeling process, dGTP, dTTP working concentration are 120M, and the dCTP working concentration is 60M, and Cy5-dCTP, Cy3-dCTP working concentration are 40M.

Use cy3, cy5 (Amersham company) to carry out mark respectively in different samples, be dissolved in then (3 * SSC, 0.2%SDS, 5 * Denhart ' s, 25% methane amide) in the 30L hybridization solution, spend the night in 42 ℃ of hybridization.After hybridization finishes, contain 0.2%SDS earlier about 42 ℃, washed in the liquid of 2 * SSC 5 minutes, then room temperature was washed 5 minutes in 0.2 * SSC, and slide dries laggard line scanning.Use cy3, cy5 (Amersham company) to carry out mark respectively in different samples, be dissolved in then (3 * SSC, 0.2%SDS, 5 * Denhart ' s, 25% methane amide) in the 30L hybridization solution, spend the night in 42 ℃ of hybridization.After hybridization finishes, contain 0.2%SDS earlier about 42 ℃, washed in the liquid of 2 * SSC 5 minutes, then room temperature was washed 5 minutes in 0.2 * SSC, and slide dries laggard line scanning.Chip scans with LuxScan 10K/A two channels laser scanner (CapitalBio company).Adopt GenePix Pro 4.0 image analysis software (Axon Instruments company) that chip image is analyzed, picture signal is converted into numerary signal; Then the data on the chip are carried out normalization method with the Lowess method; Determine difference expression gene with the Ttest method in conjunction with the standard of twice difference at last.

5, the acquisition of differential gene and analysis

The common differential gene of twice multiple of every core assembly sheet is carried out 5 ' the unidirectional order-checking, and the est sequence of acquisition adopts Staden Pachage (gap4) (http://staden.sourceforge.net) software under the Windows system to carry out sequence pre-treatment and splicing cluster.Remove carrier, joint and inferior quality sequence and short sequence.Use BLASTX (6December 2005:BLAST2.2.13 released; Http:// www.ncbi.nih.gov/BLAST/) est sequence after will handling carries out homology relatively with NCBI nonredundancy Protein Data Bank (non-redundantproteindatabase) on protein level, result clone number showed as up-regulated gene for the gene of chip18f03 in the results of hybridization at YA/C days, the BlASTX note is (isopentenyldiphosphate isomerase, IPPI) gene, called after red sage root isopentenylpyrophosphate isomerase (SmIPPI) gene.

6, the terminal rapid amplifying of cDNA (5 '-RACE and 3 '-RACE)

Adopt SMART ^TMThe increase amplification of the terminal and 3 ' end of 5 of SmIPPI ' of RACE cDNA Amplification Kit (Clontech company) test kit is operated to specifications.Total RNA extracts with Trizol (Invitrogene company) test kit, and step sees the test kit operational manual for details.GSP1 (5`-CAATTCACAAGCTGACTTAGCC-3`) with design is 5 ' RACE special primer, carries out the terminal amplification of cDNA 5 '.The PCR condition is 94 ℃ of 5min, 94 ℃ of 30s, 68 ℃ of 30s, 72 ℃ of 2min (35 circulations), 72 ℃ of 7min.Amplification obtains being about the specificity cDNA fragment of 1000bp.3 ' RACE special primer according to the design of SmIPPI gene fragment is: GSP2 (5 '-GGATGATTACTTGTCTGCCTCCTGGG-3 '), be amplimer with GSP2, carry out the terminal amplification of SmIPPI cDNA 3 '.The PCR condition is 94 ℃ of 5min, 94 ℃ of 30s, 68 ℃ of 30s, 72 ℃ of 1.5min (35 circulations), 72 ℃ of 7min.Amplify the dna fragmentation of about 400bp.Sepharose reclaims test kit (Takara company) and reclaims the purpose fragment, press pMD19T carrier (Takara company) test kit operational manual with above-mentioned fragment cloning to the pMD19-T carrier, identify positive colony and order-checking (the biological company limited of Beijing three rich polygala roots).

The part sequencing fragment result who obtains by cDNA hybridization gained est sequence and 5 '-RACE can obtain the red sage root IPPI full length gene cDNA sequence shown in the sequence table SEQ ID NO:1, and its deduced amino acid is shown in SEQ ID NO:2.

7, Full Length cDNA Cloning and order-checking

Unigene sequence according to 5`RACE and resulting result of 3`RACE and chip hybridization acquisition designs the primer that obtains hooking up the SmIPPI full-length cDNA, IPPI-F:5`-GGGCAAGCAGTGGTATCAACGCAGAGTA-3` from two ends; IPPI-R:5`-GCGGTGAATGAAGCGGCGAAACGGAGGC-3`; Be template with 5`-RACE-Ready cDNA again, carry out LA-PCR.Agarose gel electrophoresis shows about the 1300bp place and specific fragment occurs, sepharose reclaims test kit (Takara) and reclaims the purpose fragment, be cloned into as stated above (Takara) in the pMD19-T carrier, identify positive colony and carry out two-way order-checking (the biological company limited of Beijing three rich polygala roots), be used for construction of prokaryotic expression vector.

The bioinformatic analysis of embodiment 3, SmIPPI gene

The length of the red sage root isopentenylpyrophosphate isomerase gene full-length cDNA that the present invention relates to is 1320bp, the protein sequence SEQ ID No.2 that is made up of 305 amino-acid residues in the code sequence tabulation.

Detailed sequence is seen the sequence 1 in the sequence table, and wherein opening code-reading frame is positioned at 127～1044bp.Red sage root full length cDNA sequence is carried out the nucleotide homology retrieval with blast program in Non-redundant GenBank+EMBL+DDBJ+PDB and Non-redundant GenBankCDS translation+PDB+Swissprot+Superdate+PIR database, the result shows that red sage root SmIPPI and IPPI homology are between the 70.4% (root of kudzu vine, AAQ84167) to 99.1% (tobacco, BAB40974) between, homology with height, red sage root SmIPPI and periploca spium (BAC65421), the IPPI homology of Rhizoma Picrorhizae (ABO14800) is also higher, is respectively 89.8% and 88.9%.At the IPPI gene many places aminoacid sequence conserved regions is arranged, all can be used as homology PCR clone's design of primers site.

Sm IPPI genetic expression and Tanshinone II A analysis on Content after embodiment 4, the methyl jasmonate treatment

Utilize methyl jasmonate (100mM) to handle Hairy Root Cultures of Salvia miltiorrhiza, the material of collecting different time points is used for the content of red sage root IPPI gene expression amount and Tanshinone II A.The IPPI gene expression amount adopts fluorescence real-time quantitative PCR.Total RNA extracts with Trizol (Invitrogene company) test kit, and step sees the test kit operational manual for details.Get 1 μ g RNA template and obtain cDNA by RT test kit (Takara company) specification sheets reverse transcription.The Real-time quantitative PCR adopts ABI Prism 7000SequenceDetection System (Applied Biosystems, USA) and SYBGREEN PCR Master Mix (AppliedBiosystems, UK) test kit, with red sage root actin gene (GenBank accession number DQ243702) (primer sequence actin-222:5 '-GGTGCCCTGAGGTCCTGTT-3 ', actin-488:5 '-AGGAACCACCGATCCAGACA-3 ') in contrast, the conclusive evidence different time all meets the requirements and the amount of cDNA all is more or less the same.The IPPI gene primer is: Sm IPPI forward F5 '-3 ': GCGGTGAATGAAGCGGCGAAACGGAGGC, reverse 5 '-3 ': TAGGGCAAGCAGTGGTATCAACGCAGAG.By 94 ℃ of for 5min, (94 ℃ of for 30sec, 72 ℃ of for 2min of 55 ℃ of for30sec and) 36cycles, the PCR condition of 72 ℃ of 7min increases.The result shows: after handling through MJ, Sm IPPI gene expression dose raises rapidly in 24h, is reduced to the control group level afterwards gradually.After the homogenization of actin internal control gene, compare with control group, handle back 24h, the MJ treatment group is 2.1 times of contemporaneously control group, illustrate that Hairy Root Cultures of Salvia miltiorrhiza is after methyl jasmonate treatment, raise rapidly in the Sm IPPI gene expression dose, thereby help improving Sm IPPI activity, the promotion metabolism flows to purpose product tanshinone component and flows.

Adopt HPLC to measure Tanshinone II A content, chromatographic condition is: Waters 2695 high performance liquid chromatographs, Waters 2996 diode-array detectors, Millennium 32 workstations, chromatogram methyl alcohol (Tianjin); Water is triple distillation water, chloroform (analytical pure), dehydrated alcohol (analytical pure), Tanshinone I I A (available from drug inspection office, Beijing).RP-Waters C18 (150mm * 3.9mm, 5 μ m) post detects wavelength: 270nm; Column temperature: 30 ℃, its moving phase condition is: flow velocity 1.0mL.min ^-1, moving phase is 0.5% acetate methanol (A) and 0.5% acetic acid water (B) linear gradient elution: 0～25min, 30%～60%A; 25～30min, 60%～65%A; 30～50min, 65%～70%A; 50～60min, 70%～80%A; 60～61min, 80%～30%A.Under this chromatographic condition to Hairy Root Cultures of Salvia miltiorrhiza in Tanshinone I I A carry out assay.The result shows: handle back 5d through MJ, tanshinone component content rises rapidly, handles back 5d, and the Tanshinone II A composition is 2.1 times of control group, handles back 10d, and the Tanshinone II A component content is 6.3 times of control group; Handle back 15d, the Tanshinone II A component content is 6.9 times of control group.The result shows: Hairy Root Cultures of Salvia miltiorrhiza is after methyl jasmonate treatment, and red sage root IPPI gene expression amount energy quilt is abduction delivering significantly, and follows the run-up of Tanshinone I I A.By the resulting red sage root IPPI of last supposition gene is the key gene of tanshinone component biosynthetic pathway.

Embodiment 5, SmIPPI gene prokaryotic are analyzed

1, the structure of coli expression carrier

According to the ORF of red sage root IPPI full length gene cDNA sequence (SEQ ID NO.1), the primer of the complete open reading frame of design amplification is introduced restriction enzyme site HindIII and BamHI respectively respectively on forward and reverse primer.With the full-length cDNA fragment is template, behind pcr amplification, guarantees that the reading frame of red sage root IPPI gene is entirely true, and carries out endonuclease reaction with HindIII and BamHI restriction endonuclease, reclaims the purpose fragment; Coli expression carrier pET32a carries out endonuclease reaction with HindIII and BamHI restriction endonuclease, reclaims the purpose fragment.Will be on the pET32a expression vector that purpose fragment cloning to the enzyme of the red sage root IPPI gene that enzyme is cut was cut, transformed into escherichia coli BL21 carries out the PCR evaluation and the enzyme of recon and cuts evaluation.

2, protein expression induces

Picking albumen is inoculated in the LB liquid nutrient medium (containing kantlex) of 2mL, spends the night in 37 ℃ of shaking culture.Join in 50mL LB liquid nutrient medium by dilution in 1: 100 next day, and 37 ℃ of shaking culture are to OD ₆₀₀Be 0.3-0.5, add IPTG, induce target protein to express, continue at 37 ℃ of shaking tables and cultivated 3-4 hour to final concentration 0.5mM.When microbial culture to OD ₆₀₀Be 1.0 o'clock, centrifugal collection thalline, phosphate buffered saline buffer (50mmol/L PBS, pH7.2) resuspended, ultrasonication on ice, SDS-PAGE electrophoresis detection total protein and solubilized albumen.

3, the analysis of red sage root isopentenylpyrophosphate isomerase activity

The learn from else's experience white 10ug of bacterium liquid eggs of Ni2+-agarose column purifying adds 100uL reaction system (100mmol/L potassium phosphate buffer, pH7.0 contain 5mmol/L MgCl2,20ug IPP or DMAPP, 10mmol/L mercaptoethanol), 37 ℃ of reaction 12h.In reaction system, add 100ul 100mmol/L Tris HCl (pH9.5), add alkaline phosphatase (1U) then, 37 ℃ of reaction 12h.Add the 200ul ether, fully vortex vibration back 10000r/min is centrifugal, gets upper strata ether extract GC-MS detection reaction product.The result shows that this isomerase can also can form IPP for substrate catalysis with DMAPP with IPP for substrate catalysis forms DMAPP.From the peak area result, this isomerase utilizes the efficient difference of substrate, and being more prone to IPP is that substrate carries out to the DMAPP direction.

Embodiment 6, Agrobacterium tumefaciens mediated IPPI gene genetic transform the red sage root and obtain transgenosis red sage root plant

1.Gateway cross the structure of expression vector:

Primer (the SmIPPI-B1:TAGGGCAAGCAGTGGTATCAACGCAGAG of SmIPPI full length gene is expanded in design; SmIPPI-B2:GCGGTGAATGAAGCGGCGAAACGGAGGC).Use the high-fidelity enzyme and carry out PCR, product is cut glue reclaim.

The BP reaction

The PCR product	??50-100ng(3.5uL)
		??PDONR221	??50-100ng(0.5uL)
BP Clonase enzyme	(1.0uL mixing down gently) with preceding

A. reaction system is put 25 degree incubations 12 hours (PCR instrument),

B. add 0.5uL Proteinase K solution 37 degree incubations 10 minutes, and stopped the BP reaction.

C. the BP reaction product is cloned through DH5 α

D. contain on 40ug/ml kan (kantlex) the LB culture plate and spend the night, PCR checking, sequence verification, upgrading grain.

The LR reaction

BP reacts plasmid	??50-150ng(3.5uL)
		The PH7WG2D carrier	??150ng(0.5uL)
LR Clonase enzyme	(1.0uL mixing down gently) with preceding

A. reaction system is put 25 degree incubations 12 hours (PCR instrument),

B. add 0.5uL Proteinase K solution 37 degree incubations 10 minutes, and stopped the BP reaction.

C. the BP reaction product is cloned through DH5 α

D. contain on 50ug/ml Spe (spectinomycin) the LB culture plate and spend the night, PCR checking, sequence verification.

Upgrading grain and the method that transforms by electric shock change in the Agrobacterium.

2, agrobacterium tumefaciens ACCC10060 mediated gene transforms the red sage root

2.1 explant is cultivated in advance

Choose the red sage root aseptic seedling of 10d, blade is cut into 0.5 * 0.5cm ²Fritter, with cutter leaf surface is scratched, in the back side mode that makes progress blade is placed on the MS solid medium, in 25 ℃ of illumination 16h, the pre-2d that cultivates under the dark 8h condition.

2.2 Agrobacterium activation amplification

Picking list bacterium colony is on the new YEB substratum that contains 50mg/L Rif and 80mg/L Spe on the flat board of 4 ℃ of preservations, line, picking list colony inoculation contains in the YEB liquid nutrient medium of 50mg/L Rif and 80mg/L Spe in 15ml, in 28 shaking culture to OD ₂₆₀0.5 about (250rpm, 23h), the guarantor bacterium is poured bacterium liquid in the aseptic centrifuge tube into, and the centrifugal 10min of 4000rpm abandons supernatant, with the resuspended precipitation thalline of isopyknic MS liquid nutrient medium, is used to infect.

2.3 infect and cultivation altogether

Pre-cultivated material is put into the resuspended liquid of MS, infect 10min, take out explant, inhale with aseptic filter paper and remove bacterium liquid, put on the new MS solid medium, secretly cultivate 48-72h.

2.4 select to cultivate

The explant that to cultivate altogether is with sterile water wash 3 times, and about 400mg/L cef water logging bubble 5min, sterile water wash 1 time moves into behind the suck dry moisture and contains on the MS solid medium of 2mg/L Hyg and 400mg/L cef, and carries out screening and culturing in the dark.Changed a subculture in per 7 days, select growth rapidly to the resistance hairly root of 2-3cm, it is downcut, label changes on the MS substratum of 2mg/LHyg and 400mg/L cef separately, the electropositive radical after the degerming is changed over to the MS substratum subculture of 2mg/L Hyg.

2.5 further screening is determined

Whether hairly root inserts Plant Genome through special primer PCR testing goal gene again through green fluorescence microscopic examination (GFP), and selecting positive strain is to carry out amplification culture (6, the 7-V substratum).

The PCR of embodiment 7, transgenosis red sage root plant detects

Two-way primer according to SEQ ID No.1 gene ORF sequences Design SmIPPI gene detects goal gene.The result shows, changes the strain of the IPPI red sage root and ties up to and locates to amplify specific DNA fragment about 910bp, and when being template with non-conversion red sage root genomic dna, do not amplify any fragment.

Present embodiment transforms agrobacterium tumefaciens with described plant expression vector, acquisition is used to transform the agrobacterium tumefaciens bacterial strain that contains IPPI gene plant expression vector of the red sage root, utilize constructed agrobacterium tumefaciens bacterial strain to transform the red sage root, obtain the transgenosis red sage root plant that detects through PCR.

The tanshinone component component content is measured in embodiment 8, the transgenosis red sage root

37 ℃ of dryings of Hairy Root Cultures of Salvia miltiorrhiza of growth 45d are pulverized, and 100mg adds 4ml methyl alcohol, 4 ℃ of soaked overnight, and ultrasonic 30min, it is centrifugal that (3000rpm, 3min), supernatant takes out liquid nitrogen and dries up, and adds 1ml methyl alcohol and redissolves, and crosses the 0.22um filter membrane.Adopt HPLC to measure dihydrotanshinone, Cryptotanshinone, Tanshinone I and Tanshinone II A content, chromatographic condition is: Waters 2695 high performance liquid chromatographs, Waters 2996 diode-array detectors, Millennium 32 workstations, chromatogram methyl alcohol (Tianjin); Water is triple distillation water, chloroform (analytical pure), dehydrated alcohol (analytical pure), dihydrotanshinone, Cryptotanshinone, Tanshinone I and Tanshinone II A (available from drug inspection office, Beijing).RP-Waters C18 (150mm * 3.9mm, 5 μ m) post detects wavelength: 270nm; Column temperature: 30 ℃, its moving phase condition is: flow velocity 1.0mL.min ^-1, moving phase is 0.5% acetate methanol (A) and 0.5% acetic acid water (B) linear gradient elution: 0～25min, 30%～60%A; 25～30min, 60%～65%A; 30～50min, 65%～70%A; 50～60min, 70%～80%A; 60～61min, 80%～30%A.

The result shows, dihydrotanshinone in crossing the transgenosis root of hair high yield strain system of expressing the SmIPPI gene, and Cryptotanshinone, Tanshinone I and Tanshinone II A content improve respectively than non-transgenic control group: 1.4,3.6,2.5,3 times.The result proves that red sage root SmIPPI gene pairs promotes the raising of tanshinone content that obvious effect is arranged, and the SmIPPI gene can be used for utilizing transgenic technology to improve in TANSHINONES Study on content and the industrialization, has good application prospects.

Sequence table

＜110〉Institute Of Chinese Materia Medica Of China Academy of Chinese Medical Sciences

＜120〉analysis and the application of a kind of red sage root isopentenylpyrophosphate isomerase gene (SmIPPI) gene

<160>2

<170>PatentIn?version?3.4

<210>1

<211>1320

<212>DNA

＜213〉red sage root (Salvia Miltiorrhiza Bge.)

<220>

<221>CDS

<222>(127)..(1044)

<400>1

atcctctaga?gattctaata?cgactcacta?tagggcaagc?agtggtatca?acgcagagta??????60

cgcggggacc?taaaaagagc?ccagtattaa?aaatgccata?aatttccatt?aaataagaaa?????120

agaaaaatgt?cgtccttgac?cagcatcccg?tttcaaaaat?tgttggctgc?atccgctgca?????180

gctgcttctt?cttcttcttc?atcgatttct?ccgctcaaat?ctctcctttt?aaagcccact?????240

tcttgtagag?cccttttcca?tcccaaaccc?aacgccgccg?ctaccccttt?tggcctccgt?????300

ttcgccgctt?cattcaccgc?cgctacctca?accatgggtg?acgtcgccgc?cgccgattcc?????360

gccatggacg?ccgttcagag?gcgcctcatg?tttgaagacg?aatgcatatt?ggttgatgag?????420

aatgatcacg?ttgttggcca?tgaatccaag?tacaattgtc?atctgatgga?aaagattgag?????480

gctctaaatc?tgttgcacgg?agctttcagt?gtcttcctgt?ttaactcaaa?atacgagtta?????540

ttgcttcagc?aacgatccac?aactaaggtt?acttttccgt?tggtgtggac?aaacacttgc?????600

tgcagtcatc?cactataccg?agattctgag?cttattgaag?agaatgctct?tggtgtgagg?????660

aatgctgctc?agaggaagct?gttggatgaa?ctcggcatcc?ctgctgaaga?tgtcccagtc?????720

gatcagtttg?ttcctttggg?gcgtatgctg?tacaaggccc?cgtcagatgg?aaaatgggga?????780

gagcatgaat?tggattatct?cctattcatt?gtccgggatg?tgagcgtgca?tccaaatcca?????840

gacgaagtgc?acgatgtgaa?atatgtgaac?cgggaggagc?tgaaagagct?tctacggaag?????900

gcagatgccg?gtgagggggg?cttgaagcta?tcgccgtggt?tcagattagt?ggtggacaac?????960

ttcttgttca?agtggtggga?ccacgtcgag?aaagggacga?taaaggaagc?tgttgacatg????1020

aagacaattc?acaagctgac?ttagaaatga?agtagtaatg?tctgatttca?tttcaacttg????1080

tgtcatttta?tcatattcag?ttgtttgaaa?ctgatcaaac?ttggttgcca?aataggggtg????1140

ttgttgacgc?cggtaagttt?gaatcgtgtt?gcaaattcaa?tttgctcttg?gtggtgaatt????1200

ttggcaggcc?ttctaagttt?aggtatatct?ccttgtcttt?gtttgatgtg?gtcagttttt????1260

gttgtggctt?tgaaataaaa?tttattgtta?cctgtcgaaa?aagcggccgc?gaattcaaaa????1320

<210>2

<211>305

<212>PRT

＜213〉red sage root (Salvia Miltiorrhiza Bge.)

<400>2

Met?Ser?Ser?Leu?Thr?Ser?Ile?Pro?Phe?Gln?Lys?Leu?Leu?Ala?Ala?Ser

1???????????????5???????????????????10??????????????????15

Ala?Ala?Ala?Ala?Ser?Ser?Ser?Ser?Ser?Ser?Ile?Ser?Pro?Leu?Lys?Ser

20??????????????????25??????????????????30

Leu?Leu?Leu?Lys?Pro?Thr?Ser?Cys?Arg?Ala?Leu?Phe?His?Pro?Lys?Pro

35??????????????????40??????????????????45

Asn?Ala?Ala?Ala?Thr?Pro?Phe?Gly?Leu?Arg?Phe?Ala?Ala?Ser?Phe?Thr

50??????????????????55??????????????????60

Ala?Ala?Thr?Ser?Thr?Met?Gly?Asp?Val?Ala?Ala?Ala?Asp?Ser?Ala?Met

65??????????????????70??????????????????75??????????????????80

Asp?Ala?Val?Gln?Arg?Arg?Leu?Met?Phe?Glu?Asp?Glu?Cys?Ile?Leu?Val

85??????????????????90??????????????????95

Asp?Glu?Asn?Asp?His?Val?Val?Gly?His?Glu?Ser?Lys?Tyr?Asn?Cys?His

100?????????????????105?????????????????110

Leu?Met?Glu?Lys?Ile?Glu?Ala?Leu?Asn?Leu?Leu?His?Gly?Ala?Phe?Ser

115?????????????????120?????????????????125

Val?Phe?Leu?Phe?Asn?Ser?Lys?Tyr?Glu?Leu?Leu?Leu?Gln?Gln?Arg?Ser

130?????????????????135?????????????????140

Thr?Thr?Lys?Val?Thr?Phe?Pro?Leu?Val?Trp?Thr?Asn?Thr?Cys?Cys?Ser

145?????????????????150?????????????????155?????????????????160

His?Pro?Leu?Tyr?Arg?Asp?Ser?Glu?Leu?Ile?Glu?Glu?Asn?Ala?Leu?Gly

165?????????????????170?????????????????175

Val?Arg?Asn?Ala?Ala?Gln?Arg?Lys?Leu?Leu?Asp?Glu?Leu?Gly?Ile?Pro

180?????????????????185?????????????????190

Ala?Glu?Asp?Val?Pro?Val?Asp?Gln?Phe?Val?Pro?Leu?Gly?Arg?Met?Leu

195?????????????????200?????????????????205

Tyr?Lys?Ala?Pro?Ser?Asp?Gly?Lys?Trp?Gly?Glu?His?Glu?Leu?Asp?Tyr

210?????????????????215?????????????????220

Leu?Leu?Phe?Ile?Val?Arg?Asp?Val?Ser?Val?His?Pro?Asn?Pro?Asp?Glu

225?????????????????230?????????????????235?????????????????240

Val?His?Asp?Val?Lys?Tyr?Val?Asn?Arg?Glu?Glu?Leu?Lys?Glu?Leu?Leu

245?????????????????250?????????????????255

Arg?Lys?Ala?Asp?Ala?Gly?Glu?Gly?Gly?Leu?Lys?Leu?Ser?Pro?Trp?Phe

260?????????????????265?????????????????270

Arg?Leu?Val?Val?Asp?Asn?Phe?Leu?Phe?Lys?Trp?Trp?Asp?His?Val?Glu

275?????????????????280?????????????????285

Lys?Gly?Thr?Ile?Lys?Glu?Ala?Val?Asp?Met?Lys?Thr?Ile?His?Lys?Leu

290?????????????????295?????????????????300

Thr

305

Claims (6)

1, red sage root isopentenyl pyrophosphate isomerase gene provided by the present invention (SmIPPI) is one of following nucleotide sequences: the dna sequence dna of SEQ ID No.1 in the sequence table.

It is characterized in that: the reading frame of this gene is positioned at 127-1044 position Nucleotide; The dna sequence dna that limits with SEQ ID No.1 in the sequence table has one or several base mutation, and coding identical function protein DNA sequence.

2, the protein of this coded by said gene is red sage root isopentenyl pyrophosphate isomerase (SmIPPI), is one of following nucleotide sequence: the amino acid residue sequence with SEQ ID No.2 in the sequence table.

It is characterized in that: the amino acid residue sequence of SEQ ID No.2 is through the replacement of one or several amino-acid residue and to have an amino acid residue sequence of sequence 2 identical active by sequence 2 deutero-protein in the sequence table.

3, contain described gene complete sequence of claim 1 or the segmental recombinant vectors of part.

4, contain described gene complete sequence of claim 1 or the segmental host cell of part.

5, the transgenic cell line that contains the described gene of claim 1.

6, the application of the described gene of claim 1 in red rooted salvia evaluation and breeding.