CN112961869A - Jasmonic acid amino acid synthetase JAR1 gene from red sage root and its coded protein and application - Google Patents

Abstract

The invention relates to the technical field of biology, in particular to a jasmonic acid amino acid synthetase JAR1 gene from salvia miltiorrhiza and a protein coded by the gene. The protein coded by the gene has JAR1 enzyme activity, and can catalyze jasmonic acid and L-isoleucine to generate conjugate jasmonic acid isoleucine, namely jasmonic acid active hormone. Therefore, the invention provides conditions for improving the active substances of phenolic acids and tanshinone in the salvia miltiorrhiza bunge by the genetic engineering technology; meanwhile, the method has potential application values in the aspects of improving the disease resistance of the salvia miltiorrhiza, regulating the growth and development of the salvia miltiorrhiza and the like.

Description

Jasmonic acid amino acid synthetase JAR1 gene from red sage root and its coded protein and application

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a jasmonic acid amino acid synthetase JAR1 gene derived from salvia miltiorrhiza, and a protein coded by the gene and application of the gene.

Background

Salvia miltiorrhiza (Salvia miliiorrhiza Bge.) is a plant of Salvia of Labiatae, and the root of Salvia miltiorrhiza is used as a medicine, has the effects of activating blood circulation to dissipate blood stasis, stimulating menstrual flow to relieve pain, clearing heart fire to relieve restlessness, cooling blood and eliminating carbuncle, and is one of bulk drugs. The effective components of Saviae Miltiorrhizae radix are mainly lipid soluble tanshinone and water soluble phenolic compounds, wherein the lipid soluble tanshinone is tanshinone I, tanshinone IIA, tanshinone IIB, cryptotanshinone, and dihydrotanshinone I; the water-soluble phenolic compounds include salvianolic acid A, salvianolic acid B, lithospermic acid, tanshinol, and rosmarinic acid.

Jasmonic Acid (JA) is an important plant hormone, JA is a signal substance and has a regulating effect on a plurality of processes in the plant growth process, mainly comprising three aspects, namely regulating the plant growth and development processes, such as germination, senescence, fruit ripening and root growth; secondly, regulating a plant defense system, including injury response, resistance to pathogenic bacteria attack and the like; and the third is that the product has obvious inducing and synthesizing effect on plant secondary metabolite, such as taxol, vinblastine, scopolamine, etc. Research shows that jasmonic acid and its derivatives in plant body are plant hormone with fast response to external stimulation and signal molecule transported in long distance in signal transduction path. In plants, conjugate isoleucine jasmonate (JA-L-isoleucine) is the active form of JA, which is formed by JA 1 catalyzing JA and L-ILE, and JAR1 is the key enzyme for producing the active hormone. JAR1 enzymes belong to the GH3 enzyme family, which combine amino acids with different acyl acids necessary for the activation of the jasmonic acid reaction. Therefore, JAR1 has potential value in the aspects of regulating plant growth and development and the like as one of key enzymes in the JAs biosynthetic pathway.

Research shows that exogenous JA treatment can induce the significant accumulation of salvianolic acid and tanshinone compounds. Therefore, the invention obtains the JAR1 gene from the salvia miltiorrhiza, evaluates the function of the gene, obtains the protein coded by the JAR1 gene of the salvia miltiorrhiza, has the activity of jasmonic acid amino acid synthetase, and provides conditions for improving phenolic acid and tanshinone active substances in the salvia miltiorrhiza through the genetic engineering technology; meanwhile, the method has potential application values in the aspects of improving the disease resistance of the salvia miltiorrhiza, regulating the growth and development of the salvia miltiorrhiza and the like.

Disclosure of Invention

The invention aims to provide a jasmonic acid amino acid synthetase JAR1 gene derived from salvia miltiorrhiza and a coding protein thereof.

The invention also provides the application of the gene and the protein.

The technical scheme is that a jasmonic acid amino acid synthetase JAR1 gene derived from salvia miltiorrhiza encodes an amino acid sequence shown as SEQ ID No. 2.

A jasmonic acid amino acid synthetase JAR1 gene derived from Saviae Miltiorrhizae radix comprises nucleotide sequence shown in SEQ ID No. 1.

Preferably, the nucleotide sequence of a jasmonic acid amino acid synthetase JAR1 gene derived from salvia miltiorrhiza is shown as SEQ ID No. 1.

A jasmonic acid amino acid synthetase JAR1 comprises an amino acid sequence shown as SEQ ID No. 2. Preferably, the amino acid sequence is shown in SEQ ID No. 2.

The jasmonic acid amino acid synthetase JAR1 is encoded by jasmonic acid amino acid synthetase JAR1 gene derived from Salvia miltiorrhiza.

A transformation vector contains the jasmonic acid amino acid synthetase JAR1 gene derived from Saviae Miltiorrhizae radix.

A host cell containing the jasmonic acid amino acid synthetase JAR1 gene derived from Salvia miltiorrhiza.

A host cell containing the above-mentioned transformation vector. Preferably, the host cell is Escherichia coli.

The jasmonic acid amino acid synthetase JAR1 gene and the jasmonic acid amino acid synthetase JAR1 gene are used for catalyzing the reaction of jasmonic acid and amino acid.

Preferably, the jasmonic acid amino acid synthetase JAR1 gene and the salvia miltiorrhiza-derived jasmonic acid amino acid synthetase JAR1 are used for catalyzing the reaction of jasmonic acid and L-isoleucine to generate jasmonic acid isoleucine.

A synthesis method of jasmonic acid isoleucine comprises using jasmonic acid and L-isoleucine as raw materials, and using jasmonic acid amino acid synthetase JAR1 from Saviae Miltiorrhizae radix as catalyst.

The jasmonic acid amino acid synthetase JAR1 gene is obtained from red sage and used for expressing protein, and the protein coded by the gene has activity and can catalyze jasmonic acid and L-isoleucine to generate conjugate jasmonic acid isoleucine, namely jasmonic acid active hormone. Therefore, the invention provides conditions for improving the active substances of phenolic acids and tanshinone in the salvia miltiorrhiza bunge by the genetic engineering technology; meanwhile, the method has potential application values in the aspects of improving the disease resistance of the salvia miltiorrhiza, regulating the growth and development of the salvia miltiorrhiza and the like.

Drawings

For a better understanding of the nature of the present invention, reference will now be made to the following descriptions taken in conjunction with the accompanying drawings.

FIG. 1 shows the result of electrophoresis of the PCR product in example 1 on a 0.8% agarose gel.

FIG. 2 shows the result of 0.8% agarose gel electrophoresis of the PCR product of the positive single clone in example 1.

FIG. 3 shows the result of electrophoresis of the PCR product of the prokaryotic expression vector on 0.8% agarose gel in example 2.

FIG. 4 is an electrophoretogram of crude protein after induced expression of the protein in example 3.

FIG. 5 is the electrophoresis chart of the protein after induction expression and concentration purification of the protein in example 3.

FIG. 6 is a linear regression equation of concentration versus absorbance for the standard protein solution in example 3.

FIG. 7 is a liquid mass spectrum of the results of the in vitro recombinant enzyme activity reaction system and the control group in example 4 and JA-L-ILE standard.

Detailed Description

The present invention is further illustrated by the following examples. It should be understood that the detailed description and specific examples, while indicating the invention, are intended for purposes of illustration only and are not intended to limit the scope of the invention.

Example 1 obtaining the JAR1 Gene of Salvia miltiorrhiza

1. RNA extraction of salvia miltiorrhiza leaves

a. Collecting samples: fresh leaves of Salvia miltiorrhiza were taken and put into a 2ml RNase-free centrifuge tube containing two steel balls and quickly put into liquid nitrogen.

b. And (3) RNA extraction: sample cracking, extraction and layering, hanging column recovery, washing and centrifugation, and RNA elution (the experimental step refers to a Kit TransZol Up Plus RNA Kit full-scale gold ER 501).

The results of the RNA concentration and purity measurements are shown in Table 1:

TABLE 1 Total RNA concentration

Sample (I)	C(ng/mL)	A260/A280	A260/A230
				Tender leaves of Salvia miltiorrhiza	331.7	1.96	2.04

2. Construction of Salvia miltiorrhiza leaf cDNA library

Reverse transcription of total RNA of salvia miltiorrhiza leaves into cDNA: total RNA was placed on ice, using RNase-free reagents and consumables, Experimental procedure reference kit (TaKaRa PrimeScript)^TM 1st strand cDNA Synthesis Kit)。

3. Amplification primer design

Primers used for gene amplification are shown in table 2:

TABLE 2 primers for amplification of Salvia miltiorrhiza JAR1

Primer name	Sequence (5 '-3')
		JAR1-F	atgctggagaaaatggagga
JAR1-R	cacaaaggaacaataaacagca

4. Amplification of genes

Experimental procedures reference kit (TOYOBO KOD FX Cat: 9503002).

The PCR reaction solution was prepared according to Table 3, and the PCR reaction procedure was as shown in Table 4:

TABLE 3 formulation table of PCR reaction solution

Components	Sample addition amount
		Stencil (cDNA)	1μL
F(10μM)	1.5μL
		R(10μM)	1.5μL
2×KOD FX buffer	25μL
		2mM dNTPs	10μL
KOD FX	1μL
		Nuclase-free Water	Make up to 50 μ L

TABLE 4 PCR reaction procedure

PCR products 0.8% agarose gel electrophoresis: 150V, 15min, the results are shown in FIG. 1. The fragment length is more than 1000 kb.

5. Amplification product ligation of PMD19-T vector

Amplification products were prepared using Premix Taq enzyme (TaKaRa Premix LA)

) Further amplification was performed by adding a T to the end of the KOD FX enzyme amplified product sequence and loading as shown in Table 5 below.

TABLE 5 amplification product Premix Taq enzyme amplification sample application

Components	Sample addition amount
		JAR1 amplification product	40μL
Premix Taq	1μL

Reacting at 72 ℃ for 20min, connecting the amplification product with a PMD19-T carrier, loading the samples according to the following table 6, mixing lightly, reacting at room temperature for 1h, and placing on ice after the reaction (the experimental step refers to a kit TaKaRa PMD)^TM19-T Vector Cloning Kit)。

TABLE 6 Loading of linked PMD19-T vector

Components	Sample application volume
		PCR product	2.5μL
PMD19-T	0.5μL
		SolutionⅠ	2μL

6. Vector transformation of Escherichia coli

Experimental procedures reference kit (Vital organism TOP10 chemical ly component Cell)

(1) Taking out the competent cells from a refrigerator at the temperature of-80 ℃, unfreezing at room temperature, and then rapidly putting on ice;

(2) add ligation product 5. mu.L into 50. mu.L of competent cells (in clean bench);

(3) standing on ice for 30min, heat-shocking at 42 deg.C for 90s, and immediately standing on ice for 5min

(4) Adding 500 μ L of LB culture solution without antibiotics at 37 deg.C and shaking at 200rpm for about 1 hr;

(5) centrifuging at room temperature and 5000rpm for 1min, reserving 100 μ L of supernatant, and blowing and resuspending;

(6) spreading the suspension on LB solid medium containing 100mg/L cb +, placing upside down and culturing in a 37 deg.C constant temperature incubator for 12-16h

(7) 12 monoclonal colonies were picked and inoculated into 300. mu.L LB liquid medium containing 100mg/L cb + and shake-cultured at 37 ℃ and 200rpm for more than 3 hours.

7. Monoclonal positive bacteria detection

The reaction mixture preparation is shown in Table 7, and the PCR reaction procedure is shown in Table 8. The PCR products were electrophoresed on a 0.8% agarose gel: 150V, 15min, the results are shown in FIG. 2.

TABLE 7 PCR reaction solution formulation

Components	Sample addition amount
		Stencil (bacterial liquid)	1μL
M13-F(10μM)	1μL
		M13-R(10μM)	1μL
2×Flash PCR MasterMix(Dye)	10μL
		ddH2O	Adding to 20 μ L

TABLE 8 PCR reaction procedure

8. Sequencing

Three positive bacteria were selected and 100. mu.L were sent to assay (production) and aligned using SnapGene software.

The sequencing sequence is shown as SEQID No. 1. The amino acid sequence of the encoded protein is shown as SEQ ID No. 2.

EXAMPLE 2 construction of prokaryotic expression vectors

1. Extraction of plasmids

20 μ L of the correctly sequenced cell suspension JAR1-PMD19-T12 was added to 20mL of LB (cb +100mg/L) medium and cultured overnight in a 200rpm constant temperature shaker at 37 ℃. Meanwhile, 20. mu.L of the bacterial suspension pET32a + -T1 was added to 20mL of LB (cb +100mg/L) medium and cultured overnight in a shaker at 37 ℃ and 200 rpm. The cells are cracked, centrifuged to obtain supernatant, the supernatant is recovered by hanging on a column, washed and centrifuged, and eluted to obtain Plasmid solution (the Plasmid extraction step refers to a Kit Easypure Plasmid MiniPrep Kit full-scale gold EM 101).

Plasmid double digestion of pET32a +

BamHI-HF (NEB) and SacI-HF (NEB) were used to double-digest the pET32a + vector for JAR1 seamless cloning, and the reaction system is shown in Table 9 below.

TABLE 9

System composition	Volume of
		Plasmids	30μL
BamHI-HF	1μL
		SacI-HF	1μL
Cutsmart Buffer	5μL
		ddH2O	13μL

And (3) uniformly mixing the reaction solution, digesting for 2 hours at 37 ℃, detecting the digestion result by agarose gel electrophoresis, cutting the corresponding fragment, recovering the gel to obtain a linear plasmid solution, and detecting the concentration and the purity of the linear plasmid solution by using a trace ultraviolet spectrophotometer for the next calculation. The linear plasmid solution can be stored at-20 ℃ for one week.

3. Seamless cloning primer design

Primers for seamless cloning (restriction endonuclease sites underlined) are shown in table 10, and the restriction endonuclease sites for F are ggatcc: the restriction endonuclease site for R is gagctc.

TABLE 10 seamless cloning primers

4. Amplification of Gene fragments

a. Experimental procedures reference kit (TOYOBO KOD FX Cat: 9503002). The results of 0.8% agarose gel electrophoresis (150V, 15min) of the PCR products are shown in FIG. 3.

TABLE 11 formulation table of PCR reaction solution

Components	Sample addition amount
		Template (JAR1-PMD19-T12 plasmid)	1μL
F(10μM)	1.5μL
		R(10μM)	1.5μL
2×KOD FX buffer	25μL
		2mM dNTPs	10μL
KOD FX	1μL
		Nuclase-free Water	Make up to 50 μ L

TABLE 12 PCR reaction procedure

5. Seamless cloning

The reaction was prepared according to Table 13 below, mixed gently, and then incubated in a metal bath at 37 ℃ for 60min, immediately followed by cooling to 4 ℃ (Step reference Kit Cloneexpress II One Step Cloning Kit C112 Novozam).

Watch 13

Components	Sample addition amount
		Linearized vector pET32a +	104ng
Insert fragment	80ng
		5×CE II Buffer	4μL
Exnase II	2μL
		ddH2O	To 20μL

b. The recombinant product was transformed into E.coli Competent Trans1-T1 (Experimental procedures refer to kit Trans1-T1 Phage Resistant chemical company Cell Total gold CD 501).

c. Plating, selecting spots, adding 500. mu.L LB (cb +100mg/L), 37 ℃, 200rpm, shaking bacteria, overnight, checking bacteria, sending test (Jinzhi), and aligning the sequences.

6. Extracting plasmid, transforming expression strain BL21

JAR1-PET32A-Trans1-T1-3-1 and pET32a + -T1 bacterial liquid with correct sequencing are taken and 20 mu L of the bacterial liquid is put into 20mL of LB (cb +100mg/L) liquid culture medium, subjected to shaking culture at 37 ℃ and 200rpm overnight, and plasmids are extracted on the next day and are transformed into BL21 again (the method is the same as the Trans1-T1 competence). Plating, and culturing overnight in a constant temperature incubator at 37 ℃. Selecting spots, checking bacteria, and leaving positive clone strains.

Example 3 protein Induction and purification

1. Protein induced expression

a. 10. mu.L of each of cell suspension JAR1-pET32a + -BL21 and pET32a + -BL21 (as a negative control) was added to 0.5mL of LB medium (containing cb +100mg/L), cultured overnight, and activated twice.

b. mu.L of the resulting suspension was added to 5mL of LB medium (containing cb +100mg/L) and cultured at 37 ℃ at 200rpm for about 6 hours. Adding 1mL of bacterial liquid into 200mL of LB (containing amp +100mg/L) culture medium at 200rpm and 37 ℃ to culture until the OD600 value reaches 0.5-0.6;

c. adding isopropyl-beta-D-thiogalactoside (IPTG) to a final concentration of 1mmol/L, and culturing at 80rpm at 25 deg.C overnight (10-16 h);

d.45, centrifuging at 000rpm for 15min to enrich the thallus, collecting the thallus in 50mL centrifuge tubes in batches, resuspending in 20mL PBS buffer (pH 7.4), re-centrifuging, and removing the supernatant; the cells were resuspended in 20mL of PBS buffer (pH 7.4).

e.200w (grade changing rod 3, power 35%), 2s ultrasound, 4s interval, ultrasonic crushing on ice for 15min, wherein the temperature of the bacterial liquid is not more than 4 ℃;

f. the ultrasonication solution was centrifuged at 12,000rpm at 4 ℃ for 15min, and the supernatant, i.e., the crude protein solution, was collected. (in preliminary experiments, 1mL of sonicate was centrifuged at 4 ℃ for 15min at 12,000rpm, and the supernatant, i.e., crude protein solution, was collected and the pellet was resuspended in an equal volume of 1 XPBS buffer.)

SDS-PAGE electrophoretic analysis

mu.L of each of the supernatant and the precipitate obtained in the above experiment was added to 4. mu.L of protein loading buffer (6 XProtein loading buffer), mixed well, boiled in boiling water for 5min (heat denaturation at 12,000rpm, centrifugation for 2min, and the supernatant was subjected to SDS-PAGE electrophoretic analysis.

a. The formulations of 10% SDS-PAGE gels, the gel fractions and gel concentrates are shown in Table 14, in which the amounts of the two gels are indicated. Adding the separating glue into a glue making tank, coagulating for about 30min, adding the concentrated glue, and rapidly inserting into a comb. Immediately after setting, the product was used or wrapped with a wet absorbent paper and stored at 4 ℃.

TABLE 14 formulations of the gels and concentrated gels

Composition (I)	Separating glue	Composition (I)	Concentrated gels
				Mini-Q H2O	5.0mL	Mini-Q H2O	3.7mL
30％Acr-Bis(29:1)	4.3mL	30％Acr-Bis(29:1)	0.67mL
				1M Tris·HCl(pH＝8.8)	3.5mL	1M Tris·HCl(pH＝6.8)	0.5mL
10％SDS	0.1mL	10％SDS	0.04mL
				10％AP	0.1mL	10％AP	0.04mL
TEMED	0.004mL	TEMED	0.004mL

b. mu.L of the denatured sample supernatant was added to the lane of concentrated gel, using Bio-Rad electrophoresis apparatus, and the procedure was: 80V 30min 120V 60 min.

c. After the reaction is finished, taking out the gel, carefully cutting off the concentrated gel, placing the separated gel in a glass plate added with Coomassie brilliant blue fast dye solution, shaking for about 10-30min by a side shaking table, taking out the gel and placing the gel in clear water, heating the gel for 30s by a medium fire in a microwave oven, and decoloring the gel repeatedly until protein bands are obviously visible.

d. And (4) analyzing results: the molecular weight of JAR1 protein is predicted to be 136.92 kDa. The results are shown in FIG. 4, where the target protein JAR1 was present in both the supernatant and the pellet, and the supernatant and pellet of the empty pet32+ had no band at the corresponding positions.

3. Protein purification

Using Bio-Scale Mini profinity IMAC Cartridges, the solutions required for purification were prepared as described in Table 15, and ultrapure water was added to 1000mL of KOH or H₃PO₄Adjusting pH to 7.4, filtering with 0.22 μm microporous membrane, and standing at 4 deg.C. The amino acid sequence is shown in SEQ ID No. 2.

Table 15 formula of buffer solution

a. Passing the obtained supernatant crude protein solution and each buffer solution through a 0.22 mu m microporous filter membrane;

b. the column was equilibrated with wash buffer 1 at 5 column volumes (5mL), rinsed slowly at 2 mL/min;

c. sampling the crude protein liquid at 2 mL/min;

d. wash buffer 1 and wash buffer 2 rinses with 6 times of column volume are used in sequence, and the flow rate is 2 mL/min;

e. eluting the sample by using an elution buffer with 10 times of column volume, collecting the purified fraction of the target protein (pre-experiment: 1mL of eluent is respectively collected by using 1.5mL centrifuge tubes and is sequentially numbered), and slowly eluting at 2 mL/min;

f. after elution, the column was slowly washed with 2mL/min using wash buffer 1 at 5 column volumes.

Note: to avoid protein degradation, each of the above steps was performed on ice.

4. Protein concentration

In the preliminary experiment, each protein eluent collected respectively is subjected to SDS-PAGE gel electrophoresis detection, samples with larger protein concentration are combined according to the electrophoresis result (as shown in the figure, 4-12mL of components are collected, and the pure protein collection component generally does not change along with the crude protein loading amount), and a millipore molecular sieve concentration column (50kDa) is used for concentrating the protein samples, and the purpose of desalting is achieved at the same time.

Centrifuging at a.4 deg.C, less than 5000 Xg, and concentrating to less than 1 mL.

b. Then 15mL PBS buffer was added and centrifuged to less than 500. mu.L.

c. The concentrated protease was placed on ice for subsequent experiments. The electrophoretogram of each 1mL fraction of the purified protein is shown in FIG. 5.

5. Protein concentration detection

The concentration of the purified protein is detected by using a Byunnan BCA protein concentration determination kit (enhanced type), and the product number is P0010 BCA.

0.5mg/mL protein Standard solution (BCA) 0, 1, 2, 4, 8, 12, 16, 20. mu.L each was added to a 96-well plate, and PBS buffer was added to make up to 20. mu.L. Then three parts of 4 mu L purified protein solution are respectively taken and added with PBS buffer solution to make up to 20 mu L

b. 200 μ L of the BCA working solution prepared in situ is added into each well, and the mixture is kept stand for 20min at 37 DEG C

c.567nm detecting the absorbance of each well;

d. a standard curve was plotted according to the absorbance of the protein standard solution, and the protein concentration was calculated to be 2.19mg/ml, as shown in FIG. 6. The linear regression equation of the concentration and absorbance of the standard protein solution is as follows:

y＝0.2614x+0.077 R²＝0.9964。

example 4 in vitro enzyme functional validation

The reaction system is shown in Table 16 below:

TABLE 16 in vitro recombinant enzyme activity reaction systems

Components	Sample addition amount
		100mM Tris-HCL	12.5μL
5mM MgCl2	2μL
		5mM ATP	2μL
10ug/ml JA	5.5μL
		2mM L-isoleucine	12μL
ddH2O	10.5μL
		JAR1 purification of enzyme	10μL

Constant temperature mixer, 25 ℃ 300rpm 12h

Control group: pET32a + -BL21 protein induction expression; experimental groups: JAR1-pET32a + -BL21 protein induced expression. (the enzyme reaction used a PBS solution of the purified enzyme, and the control group was replaced with a PBS buffer solution of the same pH)

Substrate: jasmonic Acid (JA), L-isoleucine

b. After the reaction was completed, the reaction was quenched with 100. mu.L of absolute ethanol.

c. And (5) freeze-drying the reaction solution.

d. Redissolving with 100 μ L pure methanol (mass spectrum grade), ultrasonic treating for 30min, adding ice in water bath at temperature not higher than 20 deg.C. f.12000 Xg 4 ℃, and centrifuging for 30 min. And taking 90 mu L of the supernatant in a sample injection vial, and testing the sample.

g. Samples were qualitatively assayed using Agilent Technologies 6410 LC-MS/MS.

Chromatographic conditions are as follows: a chromatographic column: agilent ZORBAX SB-C83.5 μm 2.1X 100 μm

Mobile phase A0.05% FA (aqueous phase) B CAN (organic phase) with a sample size of 5 μ L

TABLE 17 chromatographic conditions

Time(min)	A％	B％	Flow(mL/min)
				0	93	7	0.3
3	68	32	0.3
				13	23	77	0.3

h. And (4) analyzing results: the liquid phase mass spectrum result is shown in fig. 7, the JA-L-ILE standard substance shows a peak at 10.4min, the JA-L-ILE standard substance has the same peak at 10.4min in an enzyme activity reaction system added with JAR1 enzyme, and the JA-L-ILE standard substance does not show the same peak in a control enzyme activity reaction system of pET32a + blank vector, so that the fact that the salvia miltiorrhiza JAR1 can catalyze the combination of jasmonic acid and L-isoleucine is determined.

Exogenous JA treatment can induce the remarkable accumulation of salvianolic acid and tanshinone compounds, and the research on the acquisition of the JAR1 gene of the salvia miltiorrhiza and the evaluation of the function of the JAR1 gene provides conditions for improving the phenolic acid and tanshinone active substances in the salvia miltiorrhiza through a gene engineering technology; meanwhile, the method has potential application values in the aspects of improving the disease resistance of the salvia miltiorrhiza, regulating the growth and development of the salvia miltiorrhiza and the like.

Sequence listing

<110> Shanghai medical university

<120> jasmonic acid amino acid synthetase JAR1 gene from salvia miltiorrhiza bunge, protein coded by same and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1796

<212> DNA

<213> Salvia miltiorrhiza (Salvia milirhizohia Bge.)

<400> 1

atgctggaga aaatggagga aagatttgat ccagaagcag tgatagagga attcgagacg 60

ttgtcaaggg atgcagggag ggttcagagg gaaacactgc agaaaatctt ggatgaaaat 120

ggtggaactg agtatatgca gagatgtggg cttaatggaa ggagtgatcc tgatagtttc 180

aaggcctgtg ttcccattgt ctcccacagt gacttggagc cttacattca gcgaatcgca 240

gacgggaata gcccctgcgc cctcaccgga aaaccaataa ccaccatttc cttgagttct 300

ggtacaactc aagggaagcc taagtttgtg cctttcaacg acgaattgat ggagagcacg 360

atgcagatat acaagacctc attcgcctat aggaataggg agtatccgat tgggaatggg 420

aaggcgttgc agttcatcta tagcagcaag cagttcaaga cgaaaggcgg cctagctgct 480

ggaactgcca caaccaacgt ctaccgcaat gcacagttca agaaaacgat gagggcaatg 540

cagaccccgt gctgcagccc cgatgaagtc atcttcggac cagatttcca ccagtcgttg 600

tactgccatc ttctgtgcgg actgattttc agagacgagg ttcaggttgt ctcgtccacg 660

tttgcccaca gcattgtcca cgctttccgg accttcgaac aagtctggga agagctcgtc 720

actgatatcc gtgaagggac cttgagcagc cggattacag tcccatcaat ccgagcagcc 780

atgggaaagc tgctcgagcc gaatcctgaa ctggcaaata ccatatatag caagatctcg 840

gggctaagca actggtatgg actaatccaa gagctgtttc cgagcaccaa gtacatatac 900

gggatcatga ccgggtccat ggagccgtat ctgaaaaaat tgaggcatta tgccggtgag 960

ctacctttgt taagtgcaga ttacggatct tccgagggat ggataggagc caacgtcaat 1020

cccaagctca ccccggaggt ggccacattt gctgtgctcc ctaatattgg ctatttcgaa 1080

ttcatccctc taagagagga cctgaactgc caagggcaag aggcgaaacc cgtggatctc 1140

accgatgtca agataggcga ggagtatgag atcttaatca ccaattttgc aggattgtac 1200

cgttataggt taggcgacgt agtgaaggtg aaaggtttcc acaactcgac tccggagctg 1260

cagttcatct gcaggaggaa tctcctgctc acgatcaaca tcgacaagaa caccgagaag 1320

gatctgcagc tcgcggtgga agcagcggcc cagctgctgg cgggggagaa gctcgaggtc 1380

gtggacttca ccagccgcgt ggacctgttg tccgagcccg gccactacgt ggtcttctgg 1440

gagatcagcg gggaccccca agacgagctc ctccaggagt gctgcaactg cctcgacagg 1500

tccttcgtgg atgcggggta cctgagctcg cgcaaggtcc gggccatcgg gccgctggag 1560

ctccggatcg tgaggaaggg gaccttccac aagatactgg accactacgt ggggctcggg 1620

gccgccgtca gccagttcaa gacgccgcgc tgcgtgggcc ccaccaacaa caccgtgctg 1680

cagatcctgt ctgtgaatgc tgtgaggagc tacttcagca ctgcatatta gattcttgca 1740

ggattttgat ttgtttggga aagaaaaaat ttgctgttta ttgttccttt gtgtag 1796

<210> 2

<211> 560

<212> PRT

<213> Salvia miltiorrhiza (Salvia milirhizohia Bge.)

<400> 2

Met Leu Glu Lys Met Glu Glu Arg Phe Asp Pro Glu Ala Val Ile Glu

1 5 10 15

Glu Phe Glu Thr Leu Ser Arg Asp Ala Gly Arg Val Gln Arg Glu Thr

20 25 30

Leu Gln Lys Ile Leu Asp Glu Asn Gly Gly Thr Glu Tyr Met Gln Arg

35 40 45

Cys Gly Leu Asn Gly Arg Ser Asp Pro Asp Ser Phe Lys Ala Cys Val

50 55 60

Pro Ile Val Ser His Ser Asp Leu Glu Pro Tyr Ile Gln Arg Ile Ala

65 70 75 80

Asp Gly Asn Ser Pro Cys Ala Leu Thr Gly Lys Pro Ile Thr Thr Ile

85 90 95

Ser Leu Ser Ser Gly Thr Thr Gln Gly Lys Pro Lys Phe Val Pro Phe

100 105 110

Asn Asp Glu Leu Met Glu Ser Thr Met Gln Ile Tyr Lys Thr Ser Phe

115 120 125

Ala Tyr Arg Asn Arg Glu Tyr Pro Ile Gly Asn Gly Lys Ala Leu Gln

130 135 140

Phe Ile Tyr Ser Ser Lys Gln Phe Lys Thr Lys Gly Gly Leu Ala Ala

145 150 155 160

Gly Thr Ala Thr Thr Asn Val Tyr Arg Asn Ala Gln Phe Lys Lys Thr

165 170 175

Met Arg Ala Met Gln Thr Pro Cys Cys Ser Pro Asp Glu Val Ile Phe

180 185 190

Gly Pro Asp Phe His Gln Ser Leu Tyr Cys His Leu Leu Cys Gly Leu

195 200 205

Ile Phe Arg Asp Glu Val Gln Val Val Ser Ser Thr Phe Ala His Ser

210 215 220

Ile Val His Ala Phe Arg Thr Phe Glu Gln Val Trp Glu Glu Leu Val

225 230 235 240

Thr Asp Ile Arg Glu Gly Thr Leu Ser Ser Arg Ile Thr Val Pro Ser

245 250 255

Ile Arg Ala Ala Met Gly Lys Leu Leu Glu Pro Asn Pro Glu Leu Ala

260 265 270

Asn Thr Ile Tyr Ser Lys Ile Ser Gly Leu Ser Asn Trp Tyr Gly Leu

275 280 285

Ile Gln Glu Leu Phe Pro Ser Thr Lys Tyr Ile Tyr Gly Ile Met Thr

290 295 300

Gly Ser Met Glu Pro Tyr Leu Lys Lys Leu Arg His Tyr Ala Gly Glu

305 310 315 320

Leu Pro Leu Leu Ser Ala Asp Tyr Gly Ser Ser Glu Gly Trp Ile Gly

325 330 335

Ala Asn Val Asn Pro Lys Leu Thr Pro Glu Arg Gly Pro Glu Leu Pro

340 345 350

Arg Ala Arg Gly Glu Thr Arg Gly Ser His Arg Phe Lys Ile Gly Glu

355 360 365

Glu Tyr Glu Ile Leu Ile Thr Asn Phe Ala Gly Leu Tyr Arg Tyr Ser

370 375 380

Ser Ser Ala Gly Glu Ser Pro Ala His Asp Gln His Arg Gln Glu His

385 390 395 400

Arg Glu Gly Ser Ala Ala Arg Gly Gly Ser Ser Gly Pro Ala Ala Gly

405 410 415

Gly Gly Glu Ala Arg Gly Arg Gly Leu His Gln Pro Arg Gly Pro Val

420 425 430

Val Arg Ala Arg Pro Leu Arg Gly Leu Leu Gly Asp Gln Arg Gly Pro

435 440 445

Pro Arg Arg Ala Pro Pro Gly Val Leu Gln Leu Pro Arg Gln Val Val

450 455 460

Arg Gly Arg Gly Val Pro Glu Leu Ala Gln Gly Pro Gly His Arg Ala

465 470 475 480

Ala Gly Ala Pro Asp Arg Glu Glu Gly Asp Leu Pro Gln Asp Thr Gly

485 490 495

Pro Leu Arg Gly Ala Arg Gly Arg Arg Gln Pro Val Gln Asp Ala Ala

500 505 510

Leu Arg Gly Pro His Gln Gln His Arg Ala Ala Asp Pro Val Cys Glu

515 520 525

Cys Cys Glu Glu Leu Leu Gln His Cys Ile Leu Asp Ser Cys Arg Ile

530 535 540

Leu Ile Cys Leu Gly Lys Lys Lys Phe Ala Val Tyr Cys Ser Phe Val

545 550 555 560

Claims (10)

1. A jasmonic acid amino acid synthetase JAR1 gene derived from Salvia miltiorrhiza is characterized in that the gene codes an amino acid sequence shown as SEQ ID No. 2.

2. The Salvia miltiorrhiza-derived jasmonic acid amino acid synthetase JAR1 gene as set forth in claim 1, comprising a nucleotide sequence shown as SEQ ID No. 1.

3. The jasmonic acid amino acid synthetase JAR1 gene derived from Salvia miltiorrhiza as claimed in claim 1 or 2, wherein its nucleotide sequence is shown as SEQ ID No. 1.

4. A jasmonic acid amino acid synthetase JAR1, comprising an amino acid sequence shown as SEQ ID No. 2.

5. The jasmonic acid amino acid synthetase JAR1 as claimed in claim 4, wherein the amino acid sequence is as shown in SEQ ID No. 2.

6. The jasmonic acid amino acid synthetase JAR1 of claim 4, which is encoded by the gene of any one of claims 1 to 4.

7. A transformation vector comprising the jasmonic acid amino acid synthetase JAR1 gene derived from Salvia miltiorrhiza as claimed in any one of claims 1 to 4.

8. A host cell comprising the transformation vector of claim 7 or the Salvia miltiorrhiza-derived jasmonic acid amino acid synthetase JAR1 gene of any one of claims 1 to 4.

9. The jasmonic acid amino acid synthetase JAR1 gene as described in claims 1 to 4, the jasmonic acid amino acid synthetase JAR1 as described in claims 5 or 6 as described in Salvia miltiorrhiza, the transformation vector as described in claim 7, or the host cell as described in claim 8 is used for catalyzing the reaction of jasmonic acid and amino acid.

10. A method for synthesizing isoleucine jasmonate, characterized in that jasmonate and L-isoleucine are used as raw materials, and jasmonate amino acid synthetase JAR1 derived from Salvia miltiorrhiza as claimed in claim 5 or 6 is used as a catalyst.

Images