CN116790542A - Glycosyltransferase PpUGT3 for biosynthesis of rhizoma paridis saponin - Google Patents

Glycosyltransferase PpUGT3 for biosynthesis of rhizoma paridis saponin Download PDF

Info

Publication number
CN116790542A
CN116790542A CN202310751650.9A CN202310751650A CN116790542A CN 116790542 A CN116790542 A CN 116790542A CN 202310751650 A CN202310751650 A CN 202310751650A CN 116790542 A CN116790542 A CN 116790542A
Authority
CN
China
Prior art keywords
saponin
seq
glycosyltransferase
beta
ppugt3
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310751650.9A
Other languages
Chinese (zh)
Inventor
黎胜红
刘燕
陈月桂
刘艳春
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Kunming Institute of Botany of CAS
Original Assignee
Kunming Institute of Botany of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Kunming Institute of Botany of CAS filed Critical Kunming Institute of Botany of CAS
Priority to CN202310751650.9A priority Critical patent/CN116790542A/en
Publication of CN116790542A publication Critical patent/CN116790542A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P33/00—Preparation of steroids
    • C12P33/20—Preparation of steroids containing heterocyclic rings
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P20/00—Technologies relating to chemical industry
    • Y02P20/50—Improvements relating to the production of bulk chemicals
    • Y02P20/55—Design of synthesis routes, e.g. reducing the use of auxiliary or protecting groups

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Nutrition Science (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Saccharide Compounds (AREA)

Abstract

The invention belongs to the technical field of natural product biosynthesis, and particularly relates to glycosyltransferase for biosynthesis of paris polyphylla saponin, and a coding gene and application thereof. The glycosyltransferase PpUGT3 of the invention provides a high-efficiency biosynthesis method for rhizoma paridis saponin.

Description

Glycosyltransferase PpUGT3 for biosynthesis of rhizoma paridis saponin
Technical Field
The invention belongs to the technical field of natural product biosynthesis, and particularly relates to glycosyltransferase for biosynthesis of paris polyphylla saponin, and a coding gene and application thereof.
Background
The Paris polyphylla is a generic name of Paris plants of Paris of Melothiaceae (Melothiaceae), 27 species are distributed worldwide, 21 species are distributed in China, 18 species are special species in China, and the distribution from cloud noble elevation to Sichuan zone is most concentrated. The paris polyphylla has important medicinal value and has long utilization history in China. Wherein dried rhizome of paris polyphylla (Yunnan paris polyphylla, p.polyphela Smith var. Yunnanensis (frank.) hand-Mazz.) and paris polyphylla (p.polyphela Smith var.) Chinensis (frank.) Hara) are collected in the pharmacopoeia of the people's republic of China, and have the functions of clearing heat and detoxicating, detumescence and relieving pain, cooling liver and arresting convulsion, and mainly treat furuncle and carbuncle swelling, sore throat, snake bite, traumatic injury and convulsion. Modern pharmacological researches have shown that rhizoma paridis has hemostatic, antitumor, antibacterial, analgesic, and antiprogestic activities.
The paris polyphylla saponin is the main active component of paris polyphylla, wherein the total content of paris polyphylla saponin I, II and VII is the standard for evaluating the quality of paris polyphylla specified in Chinese pharmacopoeia. The paris polyphylla saponin has wide pharmacological activity, including hemostasis, uterine contraction, anti-tumor, bacteriostasis, anti-myocardial ischemia, immunoregulation and the like. The rhizoma paridis saponin has complex structure, is difficult to realize by chemical synthesis, has high difficulty in direct separation and purification from rhizoma paridis, is limited by the shortage of rhizoma paridis resources, and severely restricts the development and application of the natural products.
Glycosylation modification is a key step of biosynthesis of rhizoma paridis saponin, and depends on glycosyltransferase catalysis to complete, and has important effects on bioactivity, bioavailability, water solubility and the like of rhizoma paridis saponin. Chinese patent application 202110109409.7 discloses a diosgenin/pennogenin-3-O-beta-D-glucosyltransferase PpUGT73E5 and application thereof in the synthesis of paris polyphylla saponin, the enzyme belongs to UGT73 family, km values of substrates diosgenin and pennogenin are 53.69+/-9.37 and 73.43+/-8.16 mu M respectively, and the affinity of the enzyme to the substrates is not high.
Disclosure of Invention
In view of the above, an object of the present invention is to provide a glycosyltransferase for biosynthesis of rhizoma paridis saponin, and a gene encoding the same and use thereof, wherein the glycosyltransferase for biosynthesis of rhizoma paridis saponin has a high affinity for a substrate.
The invention provides glycosyltransferases for biosynthesis of rhizoma paridis saponin, comprising one or more of glycosyltransferases in 1) to 6):
1) PpUGT1 with the amino acid sequence shown as SEQ ID NO. 1;
2) PpUGT2 with the amino acid sequence shown as SEQ ID NO. 2;
3) PpUGT3 with the amino acid sequence shown as SEQ ID NO. 3;
4) PpUGT4 with the amino acid sequence shown as SEQ ID NO. 4;
5) PpUGT5 with the amino acid sequence shown as SEQ ID NO. 5;
6) The amino acid sequences shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4 and SEQ ID No.5 are substituted and/or deleted and/or added with one or more amino acid residues and function-identical derivative proteins.
The invention also provides the coding genes of the glycosyltransferase, which comprise one or more of the coding genes in 1) to 6):
1) A coding gene of PpUGT1 with a nucleotide sequence shown as SEQ ID NO. 6;
2) A coding gene of PpUGT2 with a nucleotide sequence shown as SEQ ID NO. 7;
3) A coding gene of PpUGT3 with a nucleotide sequence shown as SEQ ID NO. 8;
4) A coding gene of PpUGT4 with a nucleotide sequence shown as SEQ ID NO. 9;
5) A coding gene of PpUGT5 with a nucleotide sequence shown as SEQ ID NO. 10;
6) The nucleotide sequences shown in SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.9 and SEQ ID No.10 are substituted and/or deleted and/or added with one or more nucleotides and express the nucleotide sequences of the same functional protein.
The invention also provides a recombinant vector, an expression cassette or recombinant bacteria containing the coding gene of the scheme.
The invention also provides the glycosyltransferase or the coding gene or the application of the recombinant vector, the expression cassette or the recombinant bacterium in preparing transgenic plants containing the glycosyltransferase.
The invention also provides the glycosyltransferase or the coding gene or the application of the recombinant vector, the expression cassette or the recombinant bacteria in the synthesis of the paris polyphylla saponin.
Preferably, the paris polyphylla saponin comprises one or more of dioscin, pennogenin-3-O-beta-D-glucopyranoside, paris polyphylla saponin V, paris polyphylla saponin VI, diosgenin-3-O-alpha-L-rhamnopyranose- (1-2) - [ beta-D-glucopyranose- (1-6) ] -beta-D-glucopyranoside and trikamsteroside B, the chemical structural formulas of which are shown in the formulas I-VI respectively;
preferably, when the glycosyltransferase is PpUGT1 and/or PpUGT2, the paris saponin is geosmin and pennogenin-3-O-beta-D-glucopyranoside.
Preferably, when the glycosyltransferase is ppagt 3, the paris saponin is paris saponin V and/or paris saponin VI.
Preferably, when the glycosyltransferase is PpUGT4 and/or PpUGT5, the paris saponin is diosgenin-3-O-alpha-L-rhamnopyranose- (1-2) - [ beta-D-glucopyranose- (1-6) ] -beta-D-glucopyranoside and/or trikamsteroside B.
Preferably, the ppagt 1 and ppagt 2 synthesize the dioscin using the diosgenin as a substrate, respectively; the PpUGT1 and the PpUGT2 respectively take pennogenin as a substrate to synthesize pennogenin-3-O-beta-D-glucopyranoside;
the PpUGT3 takes the geosmin as a substrate to synthesize paris polyphylla saponin V; the PpUGT3 takes pennogenin-3-O-beta-D-glucopyranoside as a substrate to synthesize paris polyphylla saponin VI;
the PpUGT4 and the PpUGT5 respectively take paris polyphylla saponin V as a substrate to synthesize diosgenin-3-O-alpha-L-rhamnopyranose- (1-2) - [ beta-D-glucopyranose- (1-6) ] -beta-D-glucopyranoside; the PpUGT4 and PpUGT5 are synthesized trikamsteroside B by taking paris polyphylla saponin VI as a substrate respectively.
The invention provides glycosyltransferases for biosynthesis of rhizoma paridis saponin, comprising one or more of glycosyltransferases in 1) to 6): 1) PpUGT1 with the amino acid sequence shown as SEQ ID NO. 1; 2) PpUGT2 with the amino acid sequence shown as SEQ ID NO. 2; 3) PpUGT3 with the amino acid sequence shown as SEQ ID NO. 3; 4) PpUGT4 with the amino acid sequence shown as SEQ ID NO. 4; 5) PpUGT5 with the amino acid sequence shown as SEQ ID NO. 5; 6) The amino acid sequences shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4 and SEQ ID No.5 are substituted and/or deleted and/or added with one or more amino acid residues and function-identical derivative proteins. The glycosyltransferase PpUGT1 and PpUGT2 respectively take diosgenin as a substrate to synthesize the dioscin; the PpUGT1 and the PpUGT2 respectively take pennogenin as a substrate to synthesize pennogenin-3-O-beta-D-glucopyranoside; the PpUGT3 takes the geosmin as a substrate to synthesize paris polyphylla saponin V; the PpUGT3 takes pennogenin-3-O-beta-D-glucopyranoside as a substrate to synthesize paris polyphylla saponin VI; the PpUGT4 and the PpUGT5 respectively take paris polyphylla saponin V as a substrate to synthesize diosgenin-3-O-alpha-L-rhamnopyranose- (1-2) - [ beta-D-glucopyranose- (1-6) ] -beta-D-glucopyranoside; the PpUGT4 and PpUGT5 are synthesized trikamsteroside B by taking paris polyphylla saponin VI as a substrate respectively. The glycosyltransferase has good affinity to a substrate, and Km values of the PpUGT1 and the PpUGT2 when the diosgenin is used as the substrate are respectively 20.1 and 16.1 mu M; the Km values of PpUGT4 and PpUGT5 using paris polyphylla saponin VI as substrate were 32.5 and 22.1. Mu.M, respectively. The glycosyltransferase provides a high-efficiency biosynthesis method for the paris polyphylla saponin, and lays a foundation for the artificial synthesis of the paris polyphylla saponin and the construction of new paris polyphylla saponin derivatives.
Drawings
FIG. 1 is a schematic diagram of PCR agarose gel electrophoresis of glycosyltransferases PpUGT1 and PpUGT2 for synthesizing dioscin and pennogenin-3-O-beta-D-glucopyranoside, ppUGT3 for synthesizing parioside V and parioside VI, and PpUGT4 and PpUGT5 for synthesizing diosgenin-3-O-alpha-L-rhamnopyranose- (1-2) - [ beta-D-glucopyranose- (1-6) ] -beta-D-glucopyranoside and trikamsteroside B, wherein lane M is DL2000DNA Marker, lanes 1, 2, 3, 4 and 5 are bands of interest (1668, 1773, 1455, 1398, 1404 bp);
FIG. 2 is a schematic diagram showing the structure of E.coli expression plasmid for expressing glycosyltransferase PpUGT1 for synthesizing didanoside and pennogenin-3-O-beta-D-glucopyranoside in example 2;
FIG. 3 is a schematic diagram showing the structure of E.coli expression plasmid for expressing glycosyltransferase PpUGT2 for synthesizing didanoside and pennogenin-3-O-beta-D-glucopyranoside in example 2;
FIG. 4 is a schematic diagram showing the structure of E.coli expression plasmid for expressing glycosyltransferase PpUGT3 for synthesizing paris saponin V and paris saponin VI in example 2;
FIG. 5 is a schematic diagram showing the structure of E.coli expression plasmid expressing the glycosyltransferases PpUGT4 for synthesizing diosgenin-3-O-alpha-L-rhamnopyranose- (1-2) - [ beta-D-glucopyranose- (1-6) ] -beta-D-glucopyranoside and trikamsteroside B in example 2;
FIG. 6 is a schematic diagram showing the structure of E.coli expression plasmid expressing the glycosyltransferases PpUGT5 for synthesizing diosgenin-3-O-alpha-L-rhamnopyranose- (1-2) - [ beta-D-glucopyranose- (1-6) ] -beta-D-glucopyranoside and trikamsteroside B in example 2;
FIG. 7 is an HPLC analysis chart of the enzymatic reaction product of example 4; wherein A is HPLC analysis spectrum of enzyme activity product of which PpUGT1 and PpUGT2 respectively take diosgenin (1) and pennoggenin (2) as substrates and UDP-glucose is sugar donor; b is the catalytic reaction of PpUGT1 and PpUGT2; c is an HPLC analysis map of an enzyme activity product of which the PpUGT3 takes the geosmin (3) and the pennogenin-3-O-beta-D-glucopyranoside (4) as substrates and UDP-rhamnose as a sugar donor respectively; d is the catalytic reaction of PpUGT3; e is HPLC analysis map of enzyme activity product of which PpUGT4 and PpUGT5 respectively take paris saponin V (5) and paris saponin VI (6) as substrates and UDP-glucose as sugar donor; f is the catalytic reaction of PpUGT4 and PpUGT5;
FIG. 8 is a function for calculating Km value obtained by Lineweaver-Burk plot in example 5; a and B are functions obtained by Lineweaver-Burk plot when PpUGT1 and PpUGT2 take diosgenin as a substrate respectively; c and D are functions obtained by Lineweaver-Burk plot when PpUGT4 and PpUGT5 use paris polyphylla saponin VI as substrate.
Detailed Description
The invention provides glycosyltransferases for biosynthesis of rhizoma paridis saponin, comprising one or more of glycosyltransferases in 1) to 6):
1) PpUGT1 with the amino acid sequence shown as SEQ ID NO. 1;
2) PpUGT2 with the amino acid sequence shown as SEQ ID NO. 2;
3) PpUGT3 with the amino acid sequence shown as SEQ ID NO. 3;
4) PpUGT4 with the amino acid sequence shown as SEQ ID NO. 4;
5) PpUGT5 with the amino acid sequence shown as SEQ ID NO. 5;
6) The amino acid sequences shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4 and SEQ ID No.5 are substituted and/or deleted and/or added with one or more amino acid residues and function-identical derivative proteins.
In the present invention, ppUGT1 to PpUGT5 are composed of 555, 590, 484, 465 and 467 amino acids, respectively, the molecular weights are predicted to be 61.5, 64.8, 52.1, 52.7 and 52.5kDa, respectively, and the PpUGT1 to PpUGT5 are placed in NCBI for BLASTX analysis and alignment, respectively, which shows that PpUGT1 has an amino acid level of 84.44% homology with the sterol 3-beta-glucose transferase UGT80A2-like isofam X1 (XP_ 038974355.1), 82.9% with the PpUGT2 amino acid sequence, 73.05% with the scopoletin glucose transferase (XM_ 039127341.1), that PpUGT4 and PpUGT5 have an amino acid level of 73.05% with the UDP-glucose transferase of Musa cluster subsp.lacsystem, and that PpUGT2 has an amino acid sequence of 82.9% with the PpUGT_ 038974355.1, and that PpUGT3 has an amino acid sequence of 35.38% with the PpU 3, ppUGT3 has a different amino acid sequence from that of PpU 3, and PpU 3 contains the PpU 3-5 protein, which is predicted to have a different amino acid sequence from PpU 3.
The glycosyltransferase PpUGT1 and PpUGT2 provided by the invention can efficiently catalyze diosgenin and pennogenin to respectively generate dioscin and pennogenin-3-O-beta-D-glucopyranoside; ppUGT3 high-efficiency catalysis is used for synthesizing paris saponin V and VI respectively from diosgenin-3-O-beta-D-glucopyranoside; glycosyltransferases PpUGT4 and PpUGT5 catalyze paris saponin V and VI to synthesize diosgenin-3-O-alpha-L-rhamnopyranose- (1-2) - [ beta-D-glucopyranose- (1-6) ] -beta-D-glucopyranoside and trikamsteroside B respectively. Dioxonol and pennogenin-3-O-beta-D-glucopyranoside are key intermediate compounds of the paris polyphylla saponin biosynthesis pathway; paris polyphylla saponin V and paris polyphylla saponin VI are important paris polyphylla saponins and are key intermediate compounds for biosynthesis of paris polyphylla saponins I, II, III or VII and H; diosgenin-3-O-alpha-L-rhamnopyranose- (1-2) - [ beta-D-glucopyranose- (1-6) ] -beta-D-glucopyranoside and trikamsteroside B are minor components of Paris plants. The invention provides a high-efficiency biosynthesis method for the dioscin, the pennogenin-3-O-beta-D-glucopyranoside, the paris saponin V, the paris saponin VI, the diosgenin-3-O-alpha-L-rhamnopyranose- (1-2) - [ beta-D-glucopyranose- (1-6) ] -beta-D-glucopyranoside and trikamsteroside B, and lays a foundation for the artificial synthesis of the paris saponin and the construction of new paris saponin derivatives.
The invention also provides the coding genes of the glycosyltransferase, which comprise one or more of the coding genes in 1) to 6):
1) A coding gene of PpUGT1 with a nucleotide sequence shown as SEQ ID NO. 6;
2) A coding gene of PpUGT2 with a nucleotide sequence shown as SEQ ID NO. 7;
3) A coding gene of PpUGT3 with a nucleotide sequence shown as SEQ ID NO. 8;
4) A coding gene of PpUGT4 with a nucleotide sequence shown as SEQ ID NO. 9;
5) A coding gene of PpUGT5 with a nucleotide sequence shown as SEQ ID NO. 10;
6) The nucleotide sequences shown in SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.9 and SEQ ID No.10 are substituted and/or deleted and/or added with one or more nucleotides and express the nucleotide sequences of the same functional protein.
In the invention, the open reading frames of the coding genes shown in SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10 are 1668, 1773, 1455, 1398 and 1404bp respectively. The discovery of genes encoding PpUGT1, ppUGT2, ppUGT3, ppUGT4 and PpUGT5 enriches the diversity of glycosyltransferase encoding genes.
The method for obtaining cDNA sequences of the coding genes of PpUGT1, ppUGT2, ppUGT3, ppUGT4 and PpUGT5 is not particularly limited, and a conventional cDNA obtaining method in the art may be adopted.
The invention starts from paris polyphylla (Pairs polyphylla Smith var. Yunnanensis (Franch.) hand-Mazz.) of Paris polyphylla, and clones and functionally identifies coding genes of 5 glycosyltransferases PpUGT 1-PpUGT 5 in a paris polyphylla saponin biosynthesis pathway.
The invention also provides a recombinant vector, an expression cassette or recombinant bacteria containing the coding gene of the scheme.
The basic vector of the recombinant vector is not particularly limited in the present invention, and the basic vector of the recombinant vector in the embodiment of the present invention is preferably pCold TF.
In the present invention, the original strain of the recombinant strain is preferably E.coli, saccharomyces cerevisiae or Agrobacterium. The invention is not particularly limited in the kind of the escherichia coli, the saccharomyces cerevisiae or the agrobacterium; in the present invention, the E.coli is preferably the strain Rosetta (DE 3) or E.coli BL21 (DE 3) strain. The method for constructing the recombinant vector and transforming the recombinant vector is not particularly limited, and conventional methods in the art can be adopted. In the specific implementation process of the invention, the coding gene is connected with a prokaryotic expression vector to construct a recombinant plasmid capable of being expressed in escherichia coli, and then the recombinant plasmid is transformed into the escherichia coli to construct recombinant bacteria.
In the invention, when the recombinant bacterium is recombinant escherichia coli or recombinant saccharomyces cerevisiae, the recombinant escherichia coli or the recombinant saccharomyces cerevisiae is subjected to fermentation culture to obtain fermentation liquor of the recombinant bacterium containing glycosyltransferase.
The invention also provides the glycosyltransferase or the coding gene or the application of the recombinant vector, the expression cassette or the recombinant bacterium in preparing transgenic plants containing the glycosyltransferase.
In the present invention, the transgenic plant preferably comprises transgenic tobacco.
In the invention, when the recombinant bacterium is recombinant agrobacterium, the recombinant agrobacterium is transfected into the Nicotiana benthamiana for transient expression to obtain fresh tobacco leaves containing glycosyltransferase.
The invention also provides the glycosyltransferase or the coding gene or the application of the recombinant vector, the expression cassette or the recombinant bacteria in the synthesis of the paris polyphylla saponin.
In the invention, the paris saponin comprises one or more of dioscin, pennogenin-3-O-beta-D-glucopyranoside, paris saponin V, paris saponin VI, diosgenin-3-O-alpha-L-glucopyranose- (1-2) - [ beta-D-glucopyranose- (1-6) ] -beta-D-glucopyranoside and trikamsteroside B, the chemical structural formulas of which are shown in formulas I-VI respectively;
in the present invention, when the glycosyltransferase is PpUGT1 and/or PpUGT2, the paris saponin is geosmin and/or pennogenin-3-O-beta-D-glucopyranoside.
In the present invention, when the glycosyltransferase is ppagt 3, the paris saponin is paris saponin V and/or paris saponin VI.
In the present invention, when the glycosyltransferase is PpUGT4 and/or PpUGT5, the paris saponin is diosgenin-3-O-alpha-L-rhamnopyranose- (1-2) - [ beta-D-glucopyranose- (1-6) ] -beta-D-glucopyranoside and/or trikamsteroside B.
In the invention, the PpUGT1 and the PpUGT2 independently take diosgenin and pennogenin as substrates to respectively synthesize the dioscin and the pennogenin-3-O-beta-D-glucopyranoside; the PpUGT3 takes the geosmin and the pennogenin-3-O-beta-D-glucopyranoside as substrates to respectively synthesize paridis saponin V and paridis saponin VI; the PpUGT4 and the PpUGT5 independently take paris polyphylla saponin V and paris polyphylla saponin VI as substrates to respectively synthesize diosgenin-3-O-alpha-L-rhamnopyranose- (1-2) - [ beta-D-glucopyranose- (1-6) ] -beta-D-glucopyranoside and trikamsteroside B.
In the invention, the glycosyltransferases PpUGT1 and PpUGT2 for synthesizing the dioscin and the pennogenin-3-O-beta-D-glucopyranoside and the coding genes thereof catalyze the diosgenin and the pennogenin to synthesize the dioscin and the pennogenin-3-O-beta-D-glucopyranoside, the glycosyltransferases PpUGT3 for synthesizing the heavy saponin V and the parigenin VI and the coding genes thereof catalyze the diosgenin-3-O-beta-D-glucopyranoside to synthesize the parigenin V and the parigenin VI respectively, and the glycosyltransferases PpUGT5 for synthesizing the diosgenin-3-O-alpha-L-glucopyranose- (1-2) - [ beta-D-glucopyranose- (1-6) ] -beta-D-glucopyranoside and trikamsteroside B and the coding genes thereof catalyze the diosgenin V and the parigenin VI to synthesize the diosgenin-3-O-alpha-beta-D-glucopyranose- (1-6) - [ beta-D-glucopyranose- (1-6) ] -beta-D-glucopyranoside and the coding genes thereof.
The technical solutions of the present invention will be clearly and completely described in the following in connection with the embodiments of the present invention.
In the following examples, conventional methods are used unless otherwise specified.
Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.
Example 1
Glycosyltransferases PpUGT1 and PpUGT2 for synthesizing diosgenin and pennogenin-3-O-beta-D-glucopyranoside, glycosyltransferases PpUGT3 for synthesizing parigenin V and parigenin VI, and obtaining and bioinformatics analysis of cDNA sequences of glycosyltransferases PpUGT4 and PpUGT5 encoding genes for synthesizing diosgenin-3-O-alpha-L-glucopyranose- (1-2) - [ beta-D-glucopyranose- (1-6) ] -beta-D-glucopyranoside and trikamsteroside B:
RNA was obtained from Paris polyphylla according to molecular cloning Manual using SMART TM cDNA is synthesized by reverse transcription of primer 5' -CDS primer and SMART IITM A oligonucleotide in RACE cDNA Amplification Kit kit, and PCR amplification is performed by using gene specific primer to obtain full-length cDNA sequences of PpUGT1, ppUGT2, ppUGT3, ppUGT4 and PpUGT5 coding genes.
Primer(s) Sequence(s) Numbering device
PpUGT1 F atgcctgaagaggtgaata SEQ ID NO.11
PpUGT1 R tcacgaacaaccaaagcatctccgt SEQ ID NO.12
PpUGT2 F atggcggagagcggcagtggag SEQ ID NO.13
PpUGT2 R tcaggagcagcccatgtacttc SEQ ID NO.14
PpUGT3 F atgggctccgacgatcgtcaacctc SEQ ID NO.15
PpUGT3 R tcagtctttcgattcctttctggat SEQ ID NO.16
PpUGT4 F atgggagaagacaatggaagccttcatgt SEQ ID NO.17
PpUGT4 R ttacattttcaaaggctgaggtttctgc SEQ ID NO.18
PpUGT5 F atggaagaaggcaatgaaagccttc SEQ ID NO.19
PpUGT5 R ttacagcttcagaggttgtggcgtc SEQ ID NO.20
The Open Reading Frames (ORFs) of the genes encoding PpUGT1, ppUGT2, ppUGT3, ppUGT4 and PpUGT5 were analyzed to be 1668bp (SEQ ID NO. 6), 1773bp (SEQ ID NO. 7), 1455bp (SEQ ID NO. 8), 1398bp (SEQ ID NO. 9) and 1404bp (SEQ ID NO. 10), respectively encoding 555 amino acids (SEQ ID NO. 1), 590 amino acids (SEQ ID NO. 2), 484 amino acids (SEQ ID NO. 3), 465 amino acids (SEQ ID NO. 4) and 467 amino acids (SEQ ID NO. 5), respectively, with molecular weights predicted to be 61.5, 64.8, 52.1, 52.7 and 52.5kDa, respectively. PpUGT3, ppUGT4 and PpUGT5 contain a Plant Secondary Product Glycosyltransferases (PSPG) cassette of 44 amino acids, 16 amino acids are inserted into the PSPG cassette of PpUGT1 and PpUGT2, the genes encoding PpUGT1, ppUGT2, ppUGT3, ppUGT4 and PpUGT5 are placed in NCBI for homology search by BLASTX, the homology of PpUGT1 and PpUGT2 amino acid sequences with sterol 3-beta-glucosyltransferase UGT80A2-like isodomain X1 (XP_ 038974355.1) of date is 84.44% and 82.9%, the homology of PpUGT3 amino acid sequence with MXM_ 039127341.1 is 73.05%, the homology of PpUGT4 and PpUGT5 amino acid sequences with UDP-glucosyltransferase 91-C1-like domain of Musa map subsp, ppUGT 1-like domain X3 (XP_ 038974355.1) of date is 73.05%, and the homology of PpUGT3 amino acid sequence with PpUGT5 protein is not predicted by PpUGT 3.53 and PpUGT 4.53% of peptide is contained in addition.
Example 2
Glycosyltransferases PpUGT1 and PpUGT2 for synthesizing dioscin and pennogenin-3-O-beta-D-glucopyranoside, glycosyltransferases PpUGT3 for synthesizing parioside V and parioside VI, and glycosyltransferases PpUGT4 and PpUGT5 for synthesizing diosgenin-3-O-alpha-L-rhamnopyranose- (1-2) - [ beta-D-glucopyranose- (1-6) ] -beta-D-glucopyranoside and trikamsteroside B are constructed by the expression vectors of genes encoded by the glycosyltransferases PpUGT4 and PpUGT 5:
using the PpUGT1, ppUGT2, ppUGT3, ppUGT4 and PpUGT5 gene cDNAs synthesized in example 1 as templates, ppUGT1F 5'-aaggtaggcatatggagctcatgcctgaagaggtgaataattct-3' (SEQ ID NO. 21) and PpUGT1R 5'-tatctagactgcaggtcgactcacgaacaaccaaagcatctccgt-3' (SEQ ID NO. 22), ppUGT2F 5'-aaggtaggcatatggagctcatggcggagagcggcagtggagcag-3' (SEQ ID NO. 23) and PpUGT2R 5'-tatctagactgcaggtcgactcaggagcagcccatgtacttc-3' (SEQ ID NO. 24), ppUGT3F 5'-aaggtaggcatatggagctcatgggctccgacgatcgtcaacctc-3' (SEQ ID NO. 25) and PpUGT3R 5'-tatctagactgcaggtcgactcagtctttcgattcctttctggat-3' (SEQ ID NO. 26), ppUGT4F 5'-aaggtaggcatatggagctcatgggagaagacaatggaagccttc-3' (SEQ ID NO. 27) and PpUGT4R 5'-tatctagactgcaggtcgacttacattttcaaaggctgaggtttc-3' (SEQ ID NO. 28), ppUGT5F 5'-aaggtaggcatatggagctcatggaagaaggcaatgaaagccttc-3' (SEQ ID NO. 29) and PpUGT5R 5'-tatctagactgcaggtcgacttacagcttcagaggttgtggcgtc-3' (SEQ ID NO. 30) as primer pairs, PCR amplification was performed with high-fidelity enzyme PrimeSTAR HS DNA Polymerase, and the PCR system was 50. Mu.L.
The PCR amplification reaction system is as follows:
5×PrimeSTAR HS Buffer 10μL
dNTP Mixture(2.5mM each) 4μL
Primer F 1μL
Primer R 1μL
Template cDNA 0.5μL
PrimeSTAR HS DNA Polymerase 0.5μL
deionized water 33μL
The reaction procedure for PCR amplification was: 98℃10sec,60℃15sec,72℃2min,35 cycles. And (5) after the program is finished, recovering and purifying the product.
The pCold TF vector was digested with restriction enzymes KpnI and SalI, reacted at 37℃for 3 hours, and band size was detected by 1% agarose gel electrophoresis, and the product was recovered and purified. The purified PCR products were ligated with vector pCold TF by cloning cDNA encoding genes for PpUGT1, ppUGT2, ppUGT3, ppUGT4 and PpUGT5 into pCold TF expression vectors containing HIS tag at N-terminal, and recombinant vectors pCold TF/PpUGT1, pCold TF/PpUGT2, pCold TF/PpUGT3, pCold TF/PpUGT4 and pCold TF/PpUGT5 were constructed, and the schematic structures thereof are shown in FIGS. 2 to 6. Recombinant vectors pCold TF/PpUGT1, pCold TF/PpUGT2, pCold TF/PpUGT3, pCold TF/PpUGT4 and pCold TF/PpUGT5 were transformed into E.coli DH 5. Alpha. And the E.coli DH 5. Alpha. Were screened by coating on LB solid plates to which ampicillin (Amp: 100. Mu.g/mL) was added, and the cells were cultured overnight in a 37℃incubator until single colonies were grown, and the single colonies were picked for PCR and cleavage verification, and positive clones were selected for DNA sequencing verification.
Example 3
Inducible expression and solubility analysis of glycosyltransferases PpUGT1, ppUGT2, ppUGT3, ppUGT4 and PpUGT5 recombinant proteins:
the recombinant strains with correct sequence were picked up to extract plasmids pCold TF/PpUGT1, pCold TF/PpUGT2, pCold TF/PpUGT3, pCold TF/PpUGT4 and pCold TF/PpUGT5, the plasmids were transformed into E.coli expression strain BL21 (DE 3), screened by LB solid plates with ampicillin (Amp: 100. Mu.g/mL) added, randomly picked up and monoclonal used for colony PCR verification, verified correct monoclonal was inoculated in 6mL of LB liquid medium with ampicillin resistance, and shake-cultured overnight at 37 ℃. Inoculating the activated bacteria into 50mL of LB liquid medium according to the ratio of 1:100, and shake culturing at 37 ℃ until OD 600 The value was about 0.5. As a control, 5mL of the bacterial liquid was used, and 45. Mu.L of 0.3mM IPTG was added thereto and the mixture was induced at 16℃overnight. Preparing a related protein purification buffer solution, centrifuging the low-temperature induced bacterial solution at 4 ℃ and 12000rpm for 10min, discarding the supernatant, adding 7mL of buffer solution 1 (20 mM Tris-HCl pH8.0, 500mM NaCl,5mM DTT,10mM imidazole) into the precipitate, and re-suspending the bacterial cells; ultrasonically crushing thalli on ice for 20min; 100. Mu.L of the remaining sample was left as a control, the remaining sample was centrifuged at 12000rpm at 4℃for 10min, the supernatant was transferred, and 500. Mu.L of Ni-NTA Agarose (from Qiagen) was added and incubated at 4℃for 1h; the protein solution containing Ni-NTA-Agarose was applied to a polytropylen column (available from Qiagen) and run with 6mL buffer 1, 6mL buffer 2 (20 mM Tris-HCl pH8.0, 500mM NaCl,5mM DTT,20mM imidazole) and 3mL buffer3 (20 mM Tris-HCl pH8.0, 500mM NaCl,5mM DTT,250mM imidazole), respectivelySequentially eluting, collecting the eluent at the same time, adding equal volume of glycerol into the eluent of the buffer3, uniformly mixing, preserving at-80 ℃, and carrying out protein solubility and size analysis according to related operation steps by 10% SDS-PAGE, wherein the result shows that the solubility of the recombinant proteins of PpUGT1, ppUGT2, ppUGT3, ppUGT4 and PpUGT5 is better, and the protein size is between 95KDa and 140 KDa.
Example 4
In vitro enzyme activity assays and product analysis of glycosyltransferases ppagt 1, ppagt 2, ppagt 3, ppagt 4 and ppagt 5:
the reaction solution: 50mM Tris-HCl (pH 8.0), 100. Mu.m sugar donor, substrate 100. Mu.m, 300. Mu.L crude enzyme, deionized water was made up to 400. Mu.L. The reaction mixture was mixed well, allowed to stand at 30℃for reaction for 6 hours, quenched by the addition of an equal volume of methanol, dried under reduced pressure, dissolved in 100. Mu.L of methanol, and centrifuged at 12000rpm for 20 minutes, and the reaction mixture was analyzed by HPLC to give FIG. 7.
Substrates of ppagt 1 and ppagt 2 are diosgenin and pennogenin, and the sugar donor is UDP-glucose; the substrates of PpUGT3 are descoside and pennogenin-3-O-beta-D-glucopyranoside, and the sugar donor is UDP-rhamnose; substrates for PpUGT4 and PpUGT5 are paridis saponin V and paridis saponin VI, and the sugar donor is UDP-glucose. UDP-glucose and UDP-rhamnose were purchased from Guangzhou Freon Biotechnology Co., ltd; diosgenin (CAS 512-04-9) was purchased from Shanghai Seiyaku Biotechnology Co., ltd; dioxonol (CAS 14144-06-0) and paris polyphylla saponin V (CAS 19057-67-1) were purchased from Chengdoman Biotechnology Co., ltd; paris polyphylla saponin VI (CAS 55916-51-3) is purchased from Chengdu plant standard pure biotechnology Co., ltd; pennogenin (CAS 507-89-1) and pennogenin-3-O-beta-D-glucopyranoside (CAS 37341-36-9) were from the laboratory.
HPLC chromatographic condition 1: aglient 1260 System, aglient SDB-C18 column (4 μm, 4.6X1250 mm), CH 3 CN-H 2 O mobile phase (0-18 min:44% -86%,18-22min:86% -100%,22-32min:100%, v/v), column temperature of 37 ℃, sample injection volume of 20 μl, flow rate of 1mL/min, detection wavelength of 195 nm.
As can be seen from A and B in FIG. 7, when the PpUGT1 and the PpUGT2 are compared with the control group, and diosgenin and pennogenin are used as substrates, 1 specific products are synthesized, and are respectively compared with the standard substances of the disoside and the pennogenin-3-O-beta-D-glucopyranoside, the retention time of the specific product peaks is consistent with that of the standard substances, so that the products are the disoside and the pennogenin-3-O-beta-D-glucopyranoside; as can be seen from C and D in fig. 7, when ppagt 3 uses geosmin and pennogenin-3-O- β -D-glucopyranoside as substrates, 1 specific product is synthesized, and compared with standard paris saponin V and paris saponin VI, respectively, the retention time of the peak of the specific product is consistent with that of the standard, indicating that the products are paris saponin V and paris saponin VI, respectively; as can be seen from E and F in FIG. 7, when the comparison of the comparison groups is made, the PpUGT4 and the PpUGT5 are respectively synthesized into 1 specific products when the paris polyphylla saponin V and the paris polyphylla saponin VI are used as substrates, and the specific products are respectively compared with the standard substances of diosgenin-3-O-alpha-L-glucopyranose- (1-2) - [ beta-D-glucopyranose- (1-6) ] -beta-D-glucopyranose and trikamsteroside B, and the retention time of the specific product peaks are consistent with that of the standard substances, so that the products are respectively diosgenin-3-O-alpha-L-glucopyranose- (1-2) - [ beta-D-glucopyranose- (1-6) ] -beta-D-glucopyranose and trikamsteroside B.
Example 5
Enzymatic kinetic parameter analysis of glycosyltransferases ppagt 1, ppagt 2, ppagt 4 and ppagt 5:
coli expression strains BL21 (DE 3) of pCold TF/PpUGT1, pCold TF/PpUGT2, pCold TF/PpUGT4 and pCold TF/PpUGT5 were shake-cultured in 6mL of LB liquid medium supplemented with ampicillin (Amp: 100. Mu.g/mL) at 37℃overnight. Inoculating the activated bacteria into 50mL of LB liquid medium according to the ratio of 1:100, and shake culturing at 37 ℃ until OD 600 The value was about 0.5. 50. Mu.L of 0.3M IPTG was added and induced overnight at 16 ℃. Preparing a related protein purification buffer solution, centrifuging the low-temperature induced bacterial solution at 4 ℃ and 12000rpm for 10min, discarding the supernatant, adding 7mL of buffer solution 1 (20 mM Tris-HCl pH8.0, 500mM NaCl,5mM DTT,10mM imidazole) into the precipitate, and re-suspending the bacterial cells; ultrasonically crushing thalli on ice for 10min; 100. Mu.L of control was left, the remaining samples were centrifuged at 12000rpm at 4℃for 10min, the supernatant was transferred, and 500. Mu.L of Ni-NTA Agarose (purchased)From Qiagen Inc.), incubation at 4℃for 1h; the protein solution containing Ni-NTA-Agarose was loaded onto a polytropyle column (purchased from Qiagen Co.) and sequentially eluted with 6mL buffer 1, 6L buffer 2 (20 mM Tris-HCl pH8.0, 500mM NaCl,20mM imidazole) and 3mL buffer3 (320 mM Tris-HCl pH8.0, 500mM NaCl,250mM imidazole), respectively, and the eluate was collected simultaneously, and buffer3 eluate, i.e., purified protein, was added with an equal volume of glycerol, and mixed well and stored at-20 ℃.
Determination of the enzymatic kinetic parameters of PpUGT1 and PpUGT 2:
the reaction solution: 50mM Tris-HCl (pH 8.0), 100. Mu.m UDP-glucose, 100. Mu.g of purified protein, 0 concentration gradient of diosgenin, 20, 40, 60, 80, 100. Mu.M, deionized water was made up to 300. Mu.L. The reaction mixture was mixed well, allowed to stand at 37℃for 45min, quenched by the addition of an equal volume of methanol, dried under reduced pressure, dissolved in 100. Mu.L of methanol, and centrifuged at 12000rpm for 20min, and the resulting sample was used for HPLC detection.
HPLC chromatography condition 2: aglient 1260 System, aglient SDB-C18 column (4 μm, 4.6X1250 mm), CH 3 CN-H 2 O mobile phase (0-15 min:55% -100%,15-27min:100%,22-32min:100%, v/v), column temperature of 37 ℃, sample volume of 20 μl, flow rate of 1mL/min, detection wavelength of 195 nm.
Determination of the enzymatic kinetic parameters of PpUGT4 and PpUGT 5:
the reaction solution: 50mM Tris-HCl (pH 8.0), 100. Mu.m UDP-glucose, 100. Mu.g of purified protein, concentration gradient of paris polyphylla saponin VI 0, 20, 40, 60, 80, 100. Mu.M, deionized water make up to 300. Mu.L. The reaction mixture was mixed well, allowed to stand at 37℃for 25min, quenched by the addition of an equal volume of methanol, dried under reduced pressure, dissolved in 100. Mu.L of methanol, and centrifuged at 12000rpm for 20min, and the resulting sample was used for HPLC analysis.
HPLC chromatographic condition 3: aglient 1260 System, aglient SDB-C18 column (4 μm, 4.6X1250 mm), CH 3 CN-H 2 O mobile phase (0-15 min:30% -75%,15-16min:75% -95%,16-21min:95%, v/v), column temperature of 37 ℃, sample volume of 20 μl, flow rate of 1mL/min, detection wavelength of 195 nm.
Preparation of standard koji from rhizoma paridis saponin VI according to HPLC chromatographic condition 3The concentration gradient of the linear, parietal saponin VI was 0,5, 10, 15, 20, 25nmol, yielding a peak area versus concentration function y=538.12x+38.989 (R 2 =0.9999), the content of the reaction product was calculated according to the function. FIG. 8 is obtained from the Lineweaver-Burk plot, and the Km value is calculated from the intercept of the function in the x and y axes in FIG. 8.
From A and B in FIG. 8, km values of 20.1 and 16.1. Mu.M were calculated for PpUGT1 and PpUGT2 with diosgenin as substrate, respectively; the Km values of PpUGT4 and PpUGT5 using paris polyphylla VI as substrate were calculated from C and D to be 32.5 and 22.1. Mu.M, respectively.
Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, according to which one can obtain other embodiments without inventiveness, these embodiments are all within the scope of the invention.
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>

Claims (7)

1. The glycosyltransferase for biosynthesis of rhizoma paridis saponin is PpUGT3 glycosyltransferase with an amino acid sequence shown in SEQ ID NO. 3.
2. The glycosyltransferase of claim 1, wherein the glycosyltransferase is a PpUGT3 encoding gene with a nucleotide sequence shown in SEQ ID NO. 8.
3. A recombinant vector, expression cassette or recombinant bacterium comprising the coding gene of claim 2.
4. Use of a glycosyltransferase of claim 1 or a coding gene of claim 2 or a recombinant vector, expression cassette or recombinant bacterium of claim 3 for the preparation of a transgenic plant comprising a glycosyltransferase.
5. Use of the glycosyltransferase of claim 1 or the encoding gene of claim 2 or the recombinant vector, expression cassette or recombinant bacterium of claim 3 in the synthesis of paris polyphylla saponin.
6. The application of claim 5, wherein the paris polyphylla saponin is paris polyphylla saponin V and paris polyphylla saponin VI shown in chemical structural formulas III and IV,
7. the use according to claim 6, wherein ppagt 3 synthesizes paris polyphylla saponin V with geosmin as substrate; the PpUGT3 takes pennogenin-3-O-beta-D-glucopyranoside as a substrate to synthesize paris polyphylla saponin VI.
CN202310751650.9A 2022-03-15 2022-03-15 Glycosyltransferase PpUGT3 for biosynthesis of rhizoma paridis saponin Pending CN116790542A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310751650.9A CN116790542A (en) 2022-03-15 2022-03-15 Glycosyltransferase PpUGT3 for biosynthesis of rhizoma paridis saponin

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202210252104.6A CN114561369B (en) 2022-03-15 2022-03-15 Glycosyltransferase for biosynthesis of paris polyphylla saponin, encoding gene and application thereof
CN202310751650.9A CN116790542A (en) 2022-03-15 2022-03-15 Glycosyltransferase PpUGT3 for biosynthesis of rhizoma paridis saponin

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN202210252104.6A Division CN114561369B (en) 2022-03-15 2022-03-15 Glycosyltransferase for biosynthesis of paris polyphylla saponin, encoding gene and application thereof

Publications (1)

Publication Number Publication Date
CN116790542A true CN116790542A (en) 2023-09-22

Family

ID=81719003

Family Applications (5)

Application Number Title Priority Date Filing Date
CN202310751654.7A Pending CN116790545A (en) 2022-03-15 2022-03-15 Glycosyltransferase PpUGT2 for biosynthesis of rhizoma paridis saponin
CN202310751653.2A Pending CN116790544A (en) 2022-03-15 2022-03-15 Glycosyltransferase PpUGT5 for biosynthesis of rhizoma paridis saponin
CN202310751650.9A Pending CN116790542A (en) 2022-03-15 2022-03-15 Glycosyltransferase PpUGT3 for biosynthesis of rhizoma paridis saponin
CN202310751651.3A Pending CN116790543A (en) 2022-03-15 2022-03-15 Glycosyltransferase PpUGT4 for biosynthesis of rhizoma paridis saponin
CN202210252104.6A Active CN114561369B (en) 2022-03-15 2022-03-15 Glycosyltransferase for biosynthesis of paris polyphylla saponin, encoding gene and application thereof

Family Applications Before (2)

Application Number Title Priority Date Filing Date
CN202310751654.7A Pending CN116790545A (en) 2022-03-15 2022-03-15 Glycosyltransferase PpUGT2 for biosynthesis of rhizoma paridis saponin
CN202310751653.2A Pending CN116790544A (en) 2022-03-15 2022-03-15 Glycosyltransferase PpUGT5 for biosynthesis of rhizoma paridis saponin

Family Applications After (2)

Application Number Title Priority Date Filing Date
CN202310751651.3A Pending CN116790543A (en) 2022-03-15 2022-03-15 Glycosyltransferase PpUGT4 for biosynthesis of rhizoma paridis saponin
CN202210252104.6A Active CN114561369B (en) 2022-03-15 2022-03-15 Glycosyltransferase for biosynthesis of paris polyphylla saponin, encoding gene and application thereof

Country Status (1)

Country Link
CN (5) CN116790545A (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116656727B (en) * 2023-06-12 2024-04-16 昆明理工大学 Preparation method of panax japonicus saponin IVa

Also Published As

Publication number Publication date
CN116790543A (en) 2023-09-22
CN116790545A (en) 2023-09-22
CN116790544A (en) 2023-09-22
CN114561369B (en) 2023-08-29
CN114561369A (en) 2022-05-31

Similar Documents

Publication Publication Date Title
CN111712570B (en) Engineering strain for producing psicose and derivatives thereof, construction method and application thereof
CN107058446B (en) Group of glycosyltransferases and application thereof
CN113186183B (en) Difunctional sesterterpene/diterpene synthase LcTPS2, coding gene, product and application thereof
CN107502599B (en) Method for synthesizing 3-O-glucosyl glycyrrhetinic acid by enzyme method
CN114634939B (en) PgJMT1 gene for regulating synthesis of methyl jasmonate in ginseng and application thereof
CN114561369B (en) Glycosyltransferase for biosynthesis of paris polyphylla saponin, encoding gene and application thereof
CN106754989B (en) Flavanone-2-hydroxylase of microcos paniculata, and coding gene and application thereof
CN108823178B (en) Emodin glycosyltransferase protein FtUGT73BE5, and coding gene and application thereof
CN109295027B (en) Glycosyltransferase mutant
CN115992109A (en) Gelidine glycosyltransferase protein, and coding gene and application thereof
CN112195129B (en) Violacein biosynthesis gene cluster and application thereof
CN113373168B (en) Bacterial-derived alpha-L-rhamnosidase gene, gene expression and application thereof
CN109810965B (en) Beta-glucosidase from rhizoma anemarrhenae, coding gene, expression vector and application thereof
CN110055232B (en) Two glycyrrhetinic acid sucrose synthases and application thereof in synthesis of glycyrrhetinic acid glycosylated derivatives
CN108707590B (en) Pictet-Spengler enzyme, and coding gene and application thereof
CN109609522B (en) Macleaya cordata dihydrobenzophenanthridine oxidase gene optimization sequence and application thereof
CN113480664A (en) High-activity bifunctional enzyme for synthesizing kaempferol and synthesis method and application thereof
CN114891840B (en) Lotus leaf O-methyltransferase and application of encoding gene thereof in synthesis of benzyl isoquinoline alkaloid and phenylpropionic acid compounds
CN112322564B (en) Escherichia coli engineering bacterium and construction method and application thereof
CN114350634B (en) Glucoside glycosyl transferase for synthesizing epimedin and coding gene and application thereof
CN117106819B (en) Phaeodactylum tricornutum CHLC gene and application of encoded protein in chlorophyll c synthesis
CN115838699A (en) Stenoloma chusanum C-glycosyltransferase and coding gene and application thereof
CN118272401A (en) Dipsacus asperoides rhamnosyl transferase DaUGT gene and application thereof
CN117467678A (en) Method for producing tanshinol
CN115838701A (en) Preparation method of class A soyasaponin acetyltransferase GmSSAcT1 and used microorganism

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination