CN113774038B

CN113774038B - Isatis tinctoria caffeic acid-O-methyltransferase protein, encoding gene and application thereof

Info

Publication number: CN113774038B
Application number: CN202111031460.7A
Authority: CN
Inventors: 肖莹; 李元玉; 陈万生
Original assignee: Shanghai University of Traditional Chinese Medicine
Current assignee: Shanghai University of Traditional Chinese Medicine
Priority date: 2021-09-03
Filing date: 2021-09-03
Publication date: 2023-10-20
Anticipated expiration: 2041-09-03
Also published as: CN113774038A

Abstract

The invention relates to the field of bioengineering and medicine, and discloses a woad caffeic acid-O-methyltransferase COMT protein and a coding gene thereof, wherein the woad caffeic acid-O-methyltransferase can catalyze methylation reaction of caffeic acid and derivatives, in particular to methylation of phenolic hydroxyl groups. Therefore, the invention can improve the biosynthesis efficiency of the antiviral active ingredient larceny in the woad by a genetic engineering technology, can be applied to ferulic acid, sinapic acid, rhamnoxin, isorhamnetin and chrysoeriol, provides conditions for the mass production of the active ingredients of the traditional Chinese medicinal materials, and has wide application prospect and market value.

Description

Isatis tinctoria caffeic acid-O-methyltransferase protein, encoding gene and application thereof

Technical Field

The invention relates to the field of bioengineering and medicine, and in particular discloses woad caffeic acid-O-methyltransferase COMT protein, and a coding gene and application thereof.

Background

Isatis tinctoria (Isatis indigotica fort.) is a plant of Isatis genus of Brassicaceae, and has effects of clearing away heat and toxic materials, cooling blood, removing speckle, relieving sore throat, and relieving pain. The isatis root and the dyers woad leaf are clinically used for influenza, epidemic encephalitis B, epidemic parotitis, acute and chronic hepatitis, herpes zoster, osteomyelitis and other diseases.

The radix isatidis has wide pharmacological actions including resisting pathogenic microorganism, resisting bacteria, resisting virus, resisting endotoxin, resisting inflammation, etc. The subject group obtains tetraploid woad fine strain with high yield, high resistance and high antiviral activity through polyploid breeding in the early stage. Chemical composition researches show that lignans components represented by larch extract are important substance basis for the isatis tinctoria to exert antiviral effect.

The biosynthetic pathway of lignans in plants has been initially ascertained, starting from the deamination of phenylalanine to cinnamic acid via the phenylalanine pathway, by a series of hydroxylations, methylation and reduction reactions, in which the lignan monomer coniferyl alcohol is first produced, which in turn produces larch-leaf pinoresinol by polymerization and reduction. It can be seen that coniferyl alcohol is an important precursor compound for the formation of larceny, and its synthesis requires the involvement of a variety of enzymes, such as Phenylalanine Ammonia Lyase (PAL), cinnamic acid-4-hydroxylase (C4H), coumaric acid-3-hydroxylase (C3H), 4-coumaroyl-coa ligase (4 CL), caffeoyl-coa oxymethyl transferase (CCoAOMT), cinnamyl Alcohol Dehydrogenase (CAD), caffeic acid-O-methyltransferase (COMT), and the like. Wherein, caffeic acid-O-methyltransferase (COMT) can catalyze caffeic acid O-methyltransgerase to directly generate coniferyl alcohol, which is an important precursor for biosynthesis of antiviral active ingredient larch resin in Isatis tinctoria. Therefore, caffeic acid-O-methyltransferase is one of key enzymes for biosynthesis of lignans, mainly takes adenosylmethionine (SAM) as methyl donor, can catalyze methylation of various substrates, and belongs to the field of non-Mg requirement ²⁺ The COMT protein has an average relative molecular mass of about 40kDa and is mainly localized in the cytoskeleton and cytoplasm.

The invention aims to obtain COMT genes and expressed proteins from Isatis tinctoria, and provides conditions for improving lignanoid active substances in Isatis tinctoria by genetic engineering technology.

Disclosure of Invention

The invention aims to provide woad caffeic acid-O-methyltransferase protein and a coding gene thereof.

The invention also provides application of the protein and the gene.

The technical scheme of the invention is as follows:

isatis tinctoria caffeic acid-O-methyltransferase, the amino acid sequence of which contains any one of the sequences of SEQ ID No. 1-4. Preferably, the amino acid sequence is any one of SEQ ID No. 1-4.

Specifically, isatis tinctoria caffeic acid-O-methyltransferase IiCOMT1, the amino acid sequence of which contains the sequence of SEQ ID No.1; preferably, the amino acid sequence of the polypeptide is shown as SEQ ID No.1;

isatis tinctoria caffeic acid-O-methyltransferase IiCOMT2, the amino acid sequence of which contains SEQ ID 2 sequence; preferably, the amino acid sequence is shown as SEQ ID No.2;

isatis tinctoria caffeic acid-O-methyltransferase IiCOMT3, the amino acid sequence of which contains SEQ ID No.3 sequence; preferably, the amino acid sequence is shown as SEQ ID No.3;

isatis tinctoria caffeic acid-O-methyltransferase IiCOMT4, the amino acid sequence of which contains SEQ ID No.4 sequence; preferably, the amino acid sequence is shown as SEQ ID No.4.

Isatis tinctoria caffeic acid-O-methyltransferase genes encoding the above-mentioned Isatis tinctoria caffeic acid-O-methyltransferase.

Preferably, said Isatis tinctoria caffeic acid-O-methyltransferase gene encodes any one of the above-mentioned SEQ ID No.1-4 sequences. Further, the nucleotide sequence thereof contains any one of SEQ ID No.5-8 sequences. Preferably, the nucleotide sequence is any one of SEQ ID No. 5-8.

Specifically, the Isatis tinctoria caffeic acid-O-methyltransferase gene encodes the protein of SEQ ID No.1 described above. Further, the nucleotide sequence thereof contains the sequence of SEQ ID No. 5; more preferably, the nucleotide sequence is shown as SEQ ID No.5.

The Isatis tinctoria caffeic acid-O-methyltransferase IiCOMT2 gene, which encodes the protein of SEQ ID No.2 as described above. Further, the nucleotide sequence thereof contains the sequence of SEQ ID No. 6; more preferably, the nucleotide sequence is shown as SEQ ID No.6.

The Isatis tinctoria caffeic acid-O-methyltransferase IiCOMT3 gene, which encodes the protein of SEQ ID No.3 as described above. Further, the nucleotide sequence thereof contains the sequence of SEQ ID No. 7; more preferably, the nucleotide sequence is shown as SEQ ID No.7.

The Isatis tinctoria caffeic acid-O-methyltransferase IiCOMT4 gene, encodes the protein of SEQ ID No.4 as described above. Further, the nucleotide sequence thereof contains the sequence of SEQ ID No. 8; more preferably, the nucleotide sequence is shown as SEQ ID No.8.

A recombinant vector comprising a gene encoding any one of the above-mentioned woad caffeic acid-O-methyltransferase; preferably, the Isatis tinctoria caffeic acid-O-methyltransferase gene is contained. More preferably, it contains any one of the nucleotide sequences of SEQ ID No. 5-8.

A host cell containing a woad caffeic acid-O-methyltransferase gene, or a host cell containing the above recombinant vector.

Preferably, the host cell is E.coli.

The above-mentioned woad caffeic acid-O-methyltransferase, woad caffeic acid-O-methyltransferase gene, transformation vector or host cell can be used for catalyzing methylation reaction of caffeic acid and derivatives, especially methylation of phenolic hydroxyl groups.

The methylation reaction comprises the following reactions: catalyzing the methylation of caffeol to coniferyl alcohol, 5-hydroxyferulic acid (5-hydroxyferulic acid) to sinapic acid, quercetin to isomouse Li Suyi, and luteolin to chrysoeriol.

Thus, woad caffeic acid-O-methyltransferase genes, transformation vectors or host cells may be used to prepare catalysts for catalyzing the methylation of caffeic acid and derivatives.

The invention also discloses a method for methylation of caffeic acid and derivatives, which takes caffeic acid and derivatives as raw materials, and woad caffeic acid-O-methyltransferase, a recombinant vector or host cell capable of expressing woad caffeic acid-O-methyltransferase as a catalyst. Specifically, the following methylation reactions are included: the methylation of caffeol to coniferyl alcohol, 5-hydroxyferulic acid (5-hydroxyferulic acid) to sinapic acid, the methylation of quercetin to isorhamnetin, and the methylation of luteolin to chrysoeriol.

The invention obtains 4 woad caffeic acid-O-methyltransferase genes from woad and uses the genes for expressing proteins to obtain the encoded proteins. The obtained protease has good catalytic activity, can catalyze the methylation reaction of caffeic acid and derivatives, for example, can catalyze the methylation of caffeol to generate coniferyl alcohol, and is one of important key enzymes for the biosynthesis of lignans.

Therefore, the invention can improve the biosynthesis efficiency of the antiviral active ingredient larceny in the woad by a genetic engineering technology, can be applied to ferulic acid, sinapic acid, rhamnoxin, isorhamnetin and chrysoeriol, provides conditions for the mass production of the active ingredients of the traditional Chinese medicinal materials, and has wide application prospect and market value.

Drawings

FIG. 1 is a diagram showing 0.8% agarose gel electrophoresis of PCR products of Isatis tinctoria caffeic acid-O-methyltransferase IiCOMT1-4 gene amplified from a Isatis tinctoria leaf cDNA library in example 1.

FIG. 2 is a diagram showing 0.8% agarose gel electrophoresis of a PCR product of a monoclonal positive bacterial Isatis tinctoria caffeic acid-O-methyltransferase IiCOMT1-4 gene in example 1.

FIG. 3 is a diagram showing the electrophoresis of PCR products of the Isatis tinctoria caffeic acid-O-methyltransferase IiCOMT1-4 gene as a prokaryotic expression vector in example 2 using 0.8% agarose gel.

FIG. 4 is a diagram showing crude protein electrophoresis of Isatis tinctoria caffeic acid-O-methyltransferase IiCOMT1-4 after protein induction in example 3.

FIG. 5 is a protein electrophoresis pattern of Isatis tinctoria caffeic acid-O-methyltransferase IiCOMT1-4 after protein-induced expression and concentration purification in example 3.

FIG. 6 is a linear regression equation for concentration and absorbance of the standard protein solution in example 3.

FIG. 7 is an HPLC chromatogram of the reaction solution of IiCOMTs catalyzed caffeic acid to ferulic acid in example 4.

FIG. 8 is a HPLC chromatogram of example 4 in which IiCOMTs catalyze the formation of coniferyl alcohol from caffeol.

FIG. 9 is a HPLC chromatogram of example 4 in which IiCOMTs catalyze 5-hydroxyferulic acid to give sinapic acid reaction.

FIG. 10 is a HPLC chromatogram of an IiCOMTs catalyzed quercetin to isorhamnetin reaction solution in example 4.

FIG. 11 is a HPLC chromatogram of the reaction solution of luteolin to chrysoeriol catalyzed by IiCOMTs in example 4.

Detailed Description

Example 1

1. Isatis tinctoria leaf RNA extraction

a. Sample collection: taking fresh Isatis tinctoria leaves, wrapping the fresh Isatis tinctoria leaves with aluminum foil, and then placing the wrapped Isatis tinctoria leaves into liquid nitrogen; quick-freezing with liquid nitrogen, taking out, knocking, transferring the sample into a 1.5ml RNase-free centrifuge tube containing two steel balls, and grinding with a ball mill.

b. Extracting RNA: sample lysis, extraction and delamination, column recovery, washing and centrifugation, and RNA elution (experimental procedure reference kit TransZol Up Plus RNA Kit full gold ER 501).

c. The concentration and purity of the obtained RNA were measured, and the results are shown in Table 1.

TABLE 1

Sample of	C(ng/mL)	A260/A280	A260/A230
				Isatis tinctoria tender leaf	848.2	2.12	2.01

2. Construction of Isatis tinctoria leaf cDNA library

Reverse transcription of Isatis tinctoria leaf Total RNAcDNA: total RNA was placed on ice, and the reagent and consumable material of RNase-free were used, and the experimental procedure was carried out with reference to the kit (TaKaRa PrimeScript) ^TM 1st strand cDNA Synthesis Kit)。

3. Amplification primer design: primer sequences for gene amplification are shown in Table 2.

TABLE 2

Primer name	Sequence (5 '-3')
		IiCOMT1-F	ATGGGATCAACGGCGGAGA
IiCOMT1-R	TCAGATCTTCTTGAGCAACTCAA
		IiCOMT2-F	ATGGACTCAACGGCGGAGA
IiCOMT2-R	TTAGATCTTCTTGTGCAGCTCAAT
		IiCOMT3-F	ATGGGCTCAGCGGCGGAGA
IiCOMT3-R	TTAGATCTTCTTGTGCAGCTCAAT
		IiCOMT4-F	ATGGGCTCAACGGTGGACC
IiCOMT4-R	TCAGAACTTCTTGAGCATCTCAATG

4. Gene amplification

The experimental procedure is carried out with reference to the instructions of the kit (TOYOBO KOD FX cat# 9503002); the preparation of the reaction solution is shown in Table 3, and the PCR procedure is shown in Table 4. The resulting PCR product was electrophoresed on a 0.8% agarose gel (150V, 15 min) and the result was shown in FIG. 1.

TABLE 3 formulation of PCR reaction solution

Component (A)	Sample addition amount
		Stencil (cDNA)	1μL
F(10μM)	1.5μL
		R(10μM)	1.5μL
2×KOD FX buffer	25μL
		2mM dNTPs	10μL
KOD FX	1μL
		Nuclase-free Water	Supplement to 50 mu L

TABLE 4PCR reaction procedure

5. Ligation of amplification products to PMD19-T vectors

The amplified product was amplified using a Premix Taq enzyme (TaKaRa Premix LA) Continuing the amplification, a T was added to the end of the KOD FX enzyme-amplified product sequence, and the sample was added as shown in Table 5.

TABLE 5

Component (A)	Sample addition amount
		IiCOMT1/2/3/4 amplification products	40μL
Premix Taq	1μL

Reacting the mixed system at 72 ℃ for 20min;

amplification product-ligation PMD19-T vector was loaded as in Table 6, gently mixed, reacted at room temperature for 1h, and placed on ice after the reaction (experimental procedure reference kit TaKaRa PMD ^TM 19-T Vector Cloning Kit)。

TABLE 6

Component (A)	Sample application volume
		PCR products	2.5μL
PMD19-T	0.5μL
		SolutionⅠ	2μL

6. Transformation of E.coli with vector

Experimental procedure reference kit (Weidi biological TOP10 Chemically Competent Cell)

(1) Taking out competent cells from a refrigerator at-80 ℃, thawing at room temperature, and rapidly placing on ice;

(2) 5. Mu.L of ligation product was added to 50. Mu.L of competent cells (performed in a super clean bench);

(3) Placing on ice for 30min, heat-shocking at 42 deg.C for 90s, and immediately placing on ice for 5min;

(4) Adding 500. Mu.L of LB culture solution without antibiotics, shaking at 37 ℃ and 200rpm for about 1 hour;

(5) Centrifuging at 5000rpm for 1min at room temperature, leaving 100 μl supernatant, and blowing for resuspension;

(6) Coating the suspension on LB solid medium containing 100mg/L Amp+, and placing the suspension in a constant temperature incubator at 37 ℃ for culturing for 12-16h;

(7) 8 monoclonal colonies were inoculated into 300. Mu.L of LB liquid medium containing 100mg/L of Amp+ and shake-cultured at 37℃for 3 hours or more at 200 rpm.

7. Monoclonal positive bacteria detection

a. The preparation of the reaction solution is shown in Table 7, and the PCR procedure is shown in Table 8. The result of 0.8% agarose gel electrophoresis (150V, 15 min) of the PCR product is shown in FIG. 2.

TABLE 7PCR reaction liquid formulation

Component (A)	Sample addition amount
		Stencil (fungus liquid)	1μL
M13-F(10μM)	1μL
		M13-R(10μM)	1μL
2×Flash PCR MasterMix(Dye)	10μL
		ddH2O	To 20. Mu.L

TABLE 8PCR reaction program Table

8. Sequencing

Positive bacteria with matched bands were selected, 100. Mu.L was taken and tested (manufactured), and sequence alignment was performed using SnapGene software. Nucleotide sequences of IiCOMT1, iiCOMT2, iiCOMT3 and IiCOMT4 are shown in SEQ ID No.5-8 respectively. The coded protein sequences are shown in SEQ ID No.1-4 respectively.

EXAMPLE 2 construction of prokaryotic expression vectors

1. Extraction of plasmids

mu.L of the bacterial liquid COMT1/2/3/4-PMD19 with correct sequencing is taken and added into 20mL of LB (amp+100 mg/L) culture medium, and the bacterial liquid is cultured overnight in a constant temperature shaking table at 37 ℃ and 200 rpm. Meanwhile, 20. Mu.L of bacterial liquid pET28a+ -T1 was added to 20mL of LB (Ka+100 mg/L) medium, and cultured overnight in a constant temperature shaker at 37℃and 200 rpm. The cells were lysed, the supernatant was collected by centrifugation, the supernatant was collected by column chromatography, washed and centrifuged, and the plasmid solution was eluted (plasmid extraction step was performed with reference to kit EasyPure Plasmid MiniPrep Kit whole gold EM 101).

pET28a+ plasmid double cleavage

The HindIII-HF (NEB) and SacI-HF (NEB) double digested pET28a+ vectors were used for COMT1/2/3/4 seamless cloning, and the reaction system is shown in the Table.

TABLE 9

System composition	Volume of
		Plasmid(s)	30μL
Hind III-HF	1μL
		SacI-HF	1μL
Cutsmart Buffer	5μL
		ddH2O	13μL

And (3) uniformly mixing the reaction solution, placing the reaction solution at 37 ℃ for digestion for 40min, detecting an enzyme digestion result by agarose gel electrophoresis, cutting off corresponding fragments, recovering gel to obtain a linear plasmid solution, and detecting the concentration and purity of the linear plasmid solution by using a micro ultraviolet spectrophotometer for further calculation. The linear plasmid solution can be stored at-20℃for one week.

3. Seamless cloning primer design

Primers used for seamless cloning (restriction endonuclease sites underlined) are shown in Table 10.

Table 10

Primer name	Sequence (5 '-3')
		PET28a-IiCOMT1-F	GGATCCGAATTCGAGCTCATGGGATCAACG
PET28a-IiCOMT1-R	GAGTGCGGCCGCAAGCTTGATCTTCTTGAG
		PET28a-IiCOMT2-F	GGATCCGAATTCGAGCTCATGGACTCAACGGC
PET28a-IiCOMT2-R	GAGTGCGGCCGCAAGCTTGATCTTCTTGT
		PET28a-IiCOMT3-F	GGATCCGAATTCGAGCTCATGGGCTCAGCG
PET28a-IiCOMT3-R	GAGTGCGGCCGCAAGCTTGATCTTCTTGT
		PET28a-IiCOMT4-F	GGATCCGAATTCGAGCTCATGGGCTCAACGG
PET28a-IiCOMT4-R	GAGTGCGGCCGCAAGCTTGAACTTCTTGAG

4. Amplification of Gene fragments

Experimental procedure reference kit (TOYOBO KOD FX cat# 9503002), PCR reaction solution formulation and PCR procedure are shown in tables 11 and 12. The result of the PCR product was shown in FIG. 3 by electrophoresis on a 0.8% agarose gel (150V, 15 min).

TABLE 11 formulation of PCR reaction solution

TABLE 12PCR reaction procedure

5. Seamless cloning

a. Preparing reaction solution according to Table 13, gently mixing, metal bath at 50deg.C for 30min, and immediately placing on ice or cooling to 4deg.C (step reference test)Agent boxplus One step PCR Cloning Kit offshore).

TABLE 13

b. Coli competent Trans1-T1 (Experimental procedures refer to kit Trans1-T1 Phage Resistant Chemically Competent Cell full gold CD 501).

c. Plating, picking spots, adding 500 mu L LB (Ka+100 mg/L), 37 ℃, shaking at 200rpm, overnight, checking, and carrying out sequence alignment.

6. Extracting plasmid and transforming expression strain BL21

Sequencing the correct COMT1/2/3/4-pET28a-Trans1-T1 and pET28a+ -T1 bacterial liquid, taking 20 mu L of the bacterial liquid in 20mL of LB (Ka+100 mg/L) liquid culture medium, shaking overnight at 37 ℃ at 200rpm, extracting the plasmid the next day, and re-transforming BL21 (the method is competent with Trans 1-T1). Plating and culturing overnight in a constant temperature incubator at 37 ℃. Spot picking, bacterial inspection and positive clone strain remaining.

EXAMPLE 3 protein Induction and purification

1. Protein-induced expression

a. mu.L of each of the bacterial solutions COMT1/2/3/4-pET28a-BL21 and pET28a+ -BL21 (as a negative control) was added to 0.5mL of LB (containing kanamycin Ka+100 mg/L) medium, cultured overnight, and activated twice.

b. mu.L of the bacterial liquid was added to 5mL of LB medium (containing kanamycin Ka+100 mg/L) and incubated at 200rpm at 37℃for about 6 hours. Then 1mL of bacterial liquid is added into 200mL of LB (containing Ka+100 mg/L) culture medium and cultured at 200rpm and 37 ℃ until the OD600 value reaches 0.5-0.6;

c. isopropyl- β -D-thiogalactoside (IPTG) was added to give a final concentration of 1mmol/L and incubated overnight (48 h) at 80rpm at 18 ℃;

centrifugation at 45,000rpm for 15min to enrich the cells, separate collection into 50mL centrifuge tubes, re-suspension with 20mL PBS buffer (ph=7.4), re-centrifugation to remove supernatant; the cells were resuspended in 20mL of PBS buffer (ph=7.4).

e.200w (variable level rod 3, power 35%), 2s ultrasonic, 4s interval ultrasonic crushing on ice for 15min, bacterial liquid temperature must not exceed 4 ℃;

f. the sonicated solution was centrifuged at 12,000rpm at 4℃for 15min, and the supernatant was collected as a crude protein solution. (in the preliminary experiment, 1mL of the sonicated solution was centrifuged at 12,000rpm at 4℃for 15min, and the supernatant, i.e., the crude protein solution, was collected and the pellet was resuspended in an equal volume of 1 XPBS buffer.)

SDS-PAGE electrophoretic analysis

20. Mu.L of each of the supernatant and the precipitate obtained in the above experiment was added to 4. Mu.L of a protein loading buffer (6X protein loading buffer), and the mixture was boiled in water for 8 minutes (heat denaturation was carried out for 2 minutes at 12,000 rpm), and SDS-PAGE analysis was carried out on the supernatant.

a. 10% SDS-PAGE gels were prepared and the separate and concentrated gel formulations are shown in Table, which shows the amounts of the two gels. Firstly, adding the separating gel into a gel preparation tank, adding the concentrated gel after solidifying for about 30min, and rapidly inserting a tooth comb. Immediately after solidification or after wrapping with soaked absorbent paper, the mixture is stored at 4 ℃.

Table 14 formulations of separator gel and concentrate gel

b. Taking 8 mu L of denatured sample supernatant, uniformly adding the sample supernatant into a lane of a concentrated gel, and using a Bio-Rad electrophoresis device, wherein the electrophoresis program is as follows: 80V 20min,120V 60min.

c. After the reaction is finished, taking out the gel, carefully cutting the gel, concentrating the gel, placing the gel in a glass plate with coomassie brilliant blue fast dye liquor, oscillating for about 10-30min by a side oscillating table, taking out the gel, placing the gel in clear water, heating for 30s by using a microwave oven with medium fire, decoloring, and repeating for a plurality of times until protein strips are obviously visible.

d. Analysis of results: the molecular weight of the IiCOMT1 protein was predicted to be 39.75kDa, the molecular weight of the IiCOMT2 protein was predicted to be 39.76kDa, the molecular weight of the IiCOMT3 protein was predicted to be 39.89kDa, and the molecular weight of the IiCOMT4 protein was predicted to be 39.83kDa. The results are shown in the figure, in which both the supernatant and the pellet are present for the proteins of interest IiCOMT1, 2, 3, 4, and in which the supernatant and pellet of empty pet28+ are free of bands at the corresponding positions.

3. Protein purification

The solutions required for purification were prepared according to Table 15 using a Bio-ScaleTM Mini ProfinityTM IMAC Cartridges purification column, and ultrapure water was added to 1000mL, KOH or H ₃ PO ₄ The pH is regulated to 7.4,0.22 mu m microporous filter membrane for filtration, and the mixture is placed at 4 ℃ for standby.

TABLE 15 buffer formulation table

a. Passing the obtained crude protein supernatant and each buffer solution through a 0.22 μm microporous filter membrane;

b. the column was equilibrated with 5 column volumes (5 mL) of wash buffer 1 and slowly rinsed at 2mL/min;

c. feeding the crude protein liquid at a concentration of 2mL/min;

d. sequentially using a wash buffer 1 and a wash buffer 2 with the volume of 6 times of the column, wherein the flow rate is 2mL/min;

e. eluting the sample by using a column volume of 10 times, collecting fractions purified by target proteins (pre-experiment: 1.5mL of eluent is respectively collected by a centrifuge tube and sequentially numbered each 1mL of eluent), and slowly eluting at 2mL/min;

f. after elution, the column was slowly rinsed with 5 column volumes of wash buffer 1 at 2 mL/min.

Note that: to avoid protein degradation, each of the above steps was performed on ice.

4. Protein concentration

In the preliminary experiment, the protein eluents collected respectively are subjected to SDS-PAGE gel electrophoresis detection, and according to the electrophoresis result, samples with larger protein concentration are combined (as shown in the figure, 4-12mL of components are collected, the pure protein collection components are not changed along with the loading amount of crude protein generally), and a millipore molecular sieve concentration column (50 kDa) is used for concentrating the protein samples, so that the purpose of desalting is achieved.

Centrifuging at a temperature of 4 ℃ to be less than 5000 Xg, and concentrating to a volume of 0.5-1mL.

b. Then, 3mL of PBS buffer was added, and the mixture was concentrated by centrifugation to a volume of less than 500. Mu.L.

c. The concentrated protease was placed on ice for subsequent experiments.

Sequencing shows that the amino acid sequence of the obtained Isatis tinctoria caffeic acid-O-methyltransferase protein IiCOMT1-4 is shown as SEQ ID No. 1-4.

5. Protein concentration detection

Purified protein concentration was measured using the bi-yun-Tian BCA protein concentration assay kit (enhanced) product number P0010 BCA.

0.4mg/mL protein Standard solution (BCA) was added to 96-well plates at 0, 1.25, 2.5, 5, 10, 15, 20. Mu.L, respectively, and PBS buffer was added to 20. Mu.L, and repeated twice. Diluting the purified protein solution for 50 times, 100 times, 200 times and 400 times, and repeating twice;

b. 200 mu L of freshly prepared BCA working solution is added into each hole, and the mixture is kept stand for 30min at 37 ℃;

detecting the absorbance of each hole at the wavelength of 630 nm;

d. the protein concentration was calculated by plotting a standard curve according to the absorbance of the protein standard solution as shown in table 16 below:

table 16

Example 4 in vitro enzyme function validation

Control group: inducible expression of pET28a+ -BL21 protein

Experimental group: the IiCMOT1/2/3/4-pET28a+ -BL21 protein induces expression. ( And (3) injection: in the preliminary experiment, crude protein liquid in the "protein induced expression" of the example 3 is used for enzyme activity verification, and purification is not needed; in the formal experiments, the enzymatic reaction used a purified enzyme in PBS and the control group was replaced with PBS buffer at the same pH. )

A substrate: caffeol, caffeic acid, 5-hydroxyferulic acid (5-hydroxyferulic acid), quercetin, luteolin.

The reaction system is shown in Table 17, and the reaction conditions are as follows: in a constant temperature mixer, 37℃at 300rpm,30min.

TABLE 17 in vitro recombinant enzyme activity reaction system

Component (A)	Sample addition amount
		1M Tris-Hcl(pH＝7.5)	20μL
20mM MgCl ₂	10μL
		5mM SAM	10μL
40mM DTT	10μL
		IiCMOT1/2/3/4 purified enzyme	4μg
Substrate(s)	1μL
		ddH ₂ O	Add to 100μL

After the completion of the reaction, the reaction was quenched with 100. Mu.L of absolute ethanol. Centrifuging at 12000 Xg and 4deg.C for 30min. 100 mu L of the supernatant was taken in a sample injection vial, and the sample was measured.

A qualitative determination of a sample of the reaction product was performed using Agilent Technologies 1260 affinity II LC.

Chromatographic conditions: the chromatographic column is Agilent ZORBAX Eclipse XDB-C18,5 μm,4.6x150mm, the flow rate is 1.0mL/min, the sample injection is 10. Mu.L, the detection wavelength is 260nm, 280nm, 320nm and 350nm, and the analysis conditions are as follows:

TABLE 18 analysis conditions for phenylpropanoid Compounds as substrates

Table 19 analysis conditions for flavonoids as substrates

Time/min	Mobile phase B (CH 3 OH)	Mobile phase D (0.1% acetic acid water)
			0	35％	65％
20	65％	35％
			25	100％	-
30	35％	65％

Analysis of results: as shown in FIG. 7, the ferulic acid standard showed a peak at 13.5min, and the caffeic acid was used as a substrate, and the same peak as the ferulic acid standard was found at 13.5min in the enzyme activity reaction system to which the IiCOMT1, 2, 3, and 4 enzymes were added, whereas the same peak as the ferulic acid standard was not found in the control enzyme activity reaction system of pET28a+ blank carrier, so IiCOMT1, 2, 3, and 4 could catalyze the methylation of caffeic acid to ferulic acid.

As shown in FIG. 2, coniferyl alcohol standard shows a peak at 11.25min, caffeol is used as a substrate, the same peak as the coniferyl alcohol standard exists at 11.25min in an enzyme activity reaction system added with IiCOMT1, 2, 3 and 4 enzymes, and the same peak as the coniferyl alcohol standard does not exist in a control enzyme activity reaction system of pET28 a+blank carrier, so that IiCOMT1, 2, 3 and 4 can catalyze caffeol methylation to generate coniferyl alcohol.

As shown in FIG. 3, the sinapic acid standard showed a peak at 13.58min, and 5-hydroxyferulic acid was used as a substrate, and the same peak as the sinapic acid standard was found at 13.58min in the enzyme activity reaction system to which IiCOMT1, 2, 3, 4 was added, whereas the same peak as the sinapic acid standard was not found in the control enzyme activity reaction system of pET28a+ blank carrier, so that IiCOMT1, 2, 3, 4 could catalyze 5-hydroxyferulic acid to produce sinapic acid.

As shown in FIG. 4, the isorhamnetin standard showed peaks at 23.48min, quercetin was used as a substrate, and the isorhamnetin standard showed peaks at 23.48min in the enzyme activity reaction system to which IiCOMT1, 2, 3, 4 was added, whereas the isorhamnetin standard showed no peaks in the control enzyme activity reaction system of pET28a+ blank vector, so IiCOMT1, 2, 3, 4 could catalyze the methylation of quercetin to isorhamnetin.

As shown in FIG. 5, the chrysoeriol standard substance shows a peak at 24.56min, luteolin is used as a substrate, the same peak as the chrysoeriol standard substance exists at 24.56min in an enzyme activity reaction system added with the enzymes IiCOMT1, 2, 3 and 4, and the same peak as the chrysoeriol standard substance does not exist in a control enzyme activity reaction system of the pET28a+ blank carrier, so that the luteolin can be catalyzed by the enzyme IiCOMT1, 2, 3 and 4 to generate the chrysoeriol through methylation.

The foregoing is a further detailed description of the invention in connection with specific embodiments, and it is not intended that the invention be limited to such description. Several equivalent substitutions or obvious modifications are made to the technical field of the present invention without departing from the concept of the present invention, and the performances or the uses are the same or similar, and all the equivalent modifications and obvious modifications are intended to fall within the protection scope of the present invention.

Sequence listing

<120> Isatis tinctoria caffeic acid-O-methyltransferase COMT protein, and encoding gene and application thereof

<130> W-21-1-02416

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 364

<212> PRT

<213> Isatis tinctoria (Isatis indigotica fort.)

<400> 1

Met Gly Ser Thr Ala Glu Thr Gln Ile Thr Pro Val Gln Val Thr Asp

1 5 10 15

Asp Glu Ala Ala Leu Phe Ala Met Gln Leu Ala Ser Ala Ser Val Leu

20 25 30

Pro Met Val Leu Lys Ser Ala Leu Asp Leu Asp Leu Leu Glu Ile Met

35 40 45

Ala Lys Asn Ser Ser Pro Met Ser Pro Ser Glu Ile Ala Ser Lys Leu

50 55 60

Gln Thr Lys Asn Pro Glu Ala Pro Val Met Leu Asp Arg Ile Leu Arg

65 70 75 80

Leu Leu Thr Ser Tyr Ser Ile Leu Thr Cys Ser Asn Arg Thr Ile Pro

85 90 95

Gly Gly Asp Gly Val Glu Arg Ile Tyr Gly Leu Gly Pro Val Cys Lys

100 105 110

Tyr Leu Thr Lys Asn Glu Asp Gly Val Ser Ile Ala Ala Leu Cys Leu

115 120 125

Met Asn Gln Asp Lys Val Leu Met Glu Ser Trp Tyr His Leu Lys Asp

130 135 140

Ala Ile Leu Asp Gly Gly Ile Pro Phe Asn Lys Ala Tyr Gly Met Ser

145 150 155 160

Ala Phe Glu Tyr His Gly Lys Asp Leu Arg Phe Asn Thr Val Phe Asn

165 170 175

Asn Gly Met Ser Asn His Ser Thr Ile Thr Met Lys Lys Ile Leu Glu

180 185 190

Thr Tyr Lys Gly Phe Glu Gly Leu Thr Ser Leu Val Asp Val Gly Gly

195 200 205

Gly Ile Gly Ala Thr Leu Lys Met Ile Val Ser Lys Tyr Pro Asn Leu

210 215 220

Lys Gly Ile Asn Phe Asp Leu Pro His Val Ile Glu Glu Ala Thr Ser

225 230 235 240

His Pro Gly Ile Glu His Val Gly Gly Asp Met Phe Val Ser Val Pro

245 250 255

Lys Gly Asp Ala Ile Phe Met Lys Trp Ile Cys His Asp Trp Ser Asp

260 265 270

Glu His Cys Val Lys Phe Leu Lys Asn Cys Tyr Glu Ser Leu Pro Glu

275 280 285

Asp Gly Lys Val Ile Leu Ala Glu Cys Ile Leu Pro Glu Thr Pro Asp

290 295 300

Ser Ser Leu Ser Thr Lys Gln Val Val His Val Asp Cys Ile Met Leu

305 310 315 320

Ala His Asn Pro Gly Gly Lys Glu Arg Thr Glu Lys Glu Phe Glu Ala

325 330 335

Leu Ala Lys Gly Ser Gly Phe Lys Gly Ile Asn Val Ala Cys Asn Ala

340 345 350

Phe Gly Val Tyr Val Ile Glu Leu Leu Lys Lys Ile

355 360

<210> 2

<211> 362

<212> PRT

<213> Isatis tinctoria (Isatis indigotica fort.)

<400> 2

Met Asp Ser Thr Ala Glu Thr Gln Leu Thr Pro Val Gln Val Thr Glu

1 5 10 15

Asp Glu Thr Ile Leu Phe Ala Thr Gln Leu Ala Ser Ala Ser Val Leu

20 25 30

Pro Met Ala Leu Lys Thr Thr Ile Glu Leu Asp Val Leu Glu Ile Met

35 40 45

Ala Lys Asn Ser Ser Pro Met Ser Ala Ser Glu Ile Val Ser His Leu

50 55 60

Pro Thr Lys Asn Pro Glu Ala Thr Val Met Leu Asp Arg Ile Leu Arg

65 70 75 80

Leu Leu Ala Ala Tyr Ser Ile Leu Thr Cys Ser Val Arg Thr Leu Pro

85 90 95

Asp Gly Val Asp Arg Leu Tyr Gly Leu Gly Pro Val Cys Lys Tyr Leu

100 105 110

Thr Lys Asn Glu Asp Gly Val Ser Ile Ala Ala Leu Cys Leu Met Asn

115 120 125

His Asp Lys Val Leu Met Glu Ser Trp Tyr His Leu Lys Asp Ala Ile

130 135 140

Leu Asp Gly Gly Ile Pro Phe Asn Lys Ala Tyr Gly Met Ser Ala Phe

145 150 155 160

Glu Tyr His Gly Thr Asp Leu Arg Phe Asn Lys Val Phe Asn Asn Gly

165 170 175

Met Ser Asn His Thr Thr Ile Ser Met Lys Lys Ile Leu Glu Thr Tyr

180 185 190

Lys Gly Phe Glu Gly Leu Thr Ser Leu Val Asp Val Gly Gly Gly Ile

195 200 205

Gly Ala Thr Leu Lys Met Ile Val Ser Lys Tyr Pro Asn Leu Lys Gly

210 215 220

Ile Asn Phe Asp Leu Pro Tyr Val Ile Ala Asp Ala Pro Pro Tyr Pro

225 230 235 240

Gly Val Glu Tyr Val Gly Gly Asp Met Phe Val Ser Val Pro Lys Gly

245 250 255

Asp Ala Ile Phe Met Lys Trp Ile Cys His Asp Trp Ser Asp Glu His

260 265 270

Cys Val Lys Ile Leu Lys Asn Cys Tyr Glu Ala Leu Pro Glu Asn Gly

275 280 285

Lys Val Ile Ile Ala Glu Ser Ile Leu Pro Glu Thr Leu Asp Ser Ser

290 295 300

Leu Leu Thr Lys Gln Val Val His Val Asp Cys Ile Met Leu Ala His

305 310 315 320

Asn Pro Gly Gly Lys Glu Arg Thr Ala Lys Glu Phe Glu Ala Leu Ala

325 330 335

Lys Gly Ser Gly Phe Lys Gly Phe Lys Val Val Cys Asn Thr Phe Gly

340 345 350

Ile Tyr Leu Ile Glu Leu His Lys Lys Ile

355 360

<210> 3

<211> 364

<212> PRT

<213> Isatis tinctoria (Isatis indigotica fort.)

<400> 3

Met Gly Ser Ala Ala Glu Thr Gln Ile Thr Pro Val Gln Val Thr Asp

1 5 10 15

Asp Glu Thr Arg Leu Phe Ala Met Gln Leu Ala Ser Ala Ser Val Leu

20 25 30

Pro Met Val Leu Lys Ser Ala Leu Asp Leu Asp Leu Leu Glu Ile Met

35 40 45

Ala Lys Asn Ser Ser Pro Met Ser Pro Ser Glu Ile Ala Ser Lys Leu

50 55 60

Gln Thr Lys Asn Pro Glu Ala Pro Val Met Leu Asp Arg Ile Leu Arg

65 70 75 80

Leu Leu Thr Ser Tyr Ser Ile Leu Thr Cys Ser Asn Arg Thr Ile Pro

85 90 95

Gly Gly Asp Gly Val Glu Arg Ile Tyr Gly Leu Gly Pro Val Cys Lys

100 105 110

Tyr Leu Thr Lys Asn Glu Asp Gly Val Ser Ile Ala Ala Leu Cys Leu

115 120 125

Met Asn Gln Asp Lys Val Leu Met Glu Ser Trp Tyr His Leu Lys Asp

130 135 140

Ala Ile Leu Asp Gly Gly Ile Pro Phe Asn Lys Ala Tyr Gly Met Ser

145 150 155 160

Ala Phe Glu Tyr His Gly Lys Asp Leu Arg Phe Asn Thr Val Phe Asn

165 170 175

Asn Gly Met Ser Asn His Ser Thr Ile Thr Met Lys Lys Ile Leu Glu

180 185 190

Thr Tyr Lys Gly Phe Glu Gly Leu Thr Ser Leu Val Asp Val Gly Gly

195 200 205

Gly Ile Gly Ala Thr Leu Lys Met Ile Val Ser Lys Tyr Pro Asn Leu

210 215 220

Lys Gly Ile Asn Phe Asp Leu Pro His Val Ile Glu Glu Ala Thr Ser

225 230 235 240

His Pro Gly Ile Glu His Val Gly Gly Asp Met Phe Val Ser Val Pro

245 250 255

Lys Gly Asp Ala Ile Phe Met Lys Trp Ile Cys His Asp Trp Ser Asp

260 265 270

Glu His Cys Val Lys Phe Leu Lys Asn Cys Tyr Glu Ser Leu Pro Glu

275 280 285

Asp Gly Lys Val Ile Leu Ala Glu Cys Ile Leu Pro Glu Thr Pro Asp

290 295 300

Ser Ser Leu Ser Thr Lys Gln Val Val His Val Asp Cys Ile Met Leu

305 310 315 320

Ala His Asn Pro Gly Gly Lys Glu Arg Thr Glu Lys Glu Phe Glu Ala

325 330 335

Leu Ala Lys Gly Ser Gly Phe Lys Gly Ile Asn Val Asp Cys Asn Ala

340 345 350

Phe Gly Val Tyr Val Ile Glu Leu His Lys Lys Ile

355 360

<210> 4

<211> 364

<212> PRT

<213> Isatis tinctoria (Isatis indigotica fort.)

<400> 4

Met Gly Ser Thr Val Glu Thr Gln Ile Thr Pro Val Gln Val Thr Asp

1 5 10 15

Asp Glu Ala Ala Leu Phe Ala Met Gln Leu Ala Ser Ala Ser Val Leu

20 25 30

Pro Met Val Leu Lys Ser Ala Leu Asp Leu Asp Leu Leu Glu Ile Met

35 40 45

Ala Lys Asn Ser Ser Pro Met Ser Pro Ser Glu Ile Ala Ser Lys Leu

50 55 60

Gln Thr Lys Asn Pro Glu Ala Pro Val Met Leu Asp Arg Ile Leu Arg

65 70 75 80

Leu Leu Thr Ser Tyr Ser Ile Leu Thr Cys Ser Asn Arg Thr Ile Pro

85 90 95

Gly Gly Asp Gly Val Glu Arg Ile Tyr Gly Leu Gly Pro Val Cys Lys

100 105 110

Tyr Leu Thr Lys Asn Glu Asp Gly Val Ser Ile Ala Ala Leu Cys Leu

115 120 125

Met Asn Gln Asp Lys Val Leu Met Glu Ser Trp Tyr His Leu Lys Asp

130 135 140

Ala Ile Leu Asp Gly Gly Ile Pro Phe Asn Lys Ala Tyr Gly Met Ser

145 150 155 160

Ala Phe Glu Tyr His Gly Lys Asp Leu Arg Phe Asn Thr Val Phe Asn

165 170 175

Asn Gly Met Ser Asn His Ser Thr Ile Thr Met Lys Lys Ile Leu Glu

180 185 190

Thr Tyr Lys Gly Phe Glu Gly Leu Thr Ser Leu Val Asp Val Gly Gly

195 200 205

Gly Ile Gly Ala Thr Leu Lys Met Ile Val Ser Lys Tyr Pro Asn Leu

210 215 220

Lys Gly Ile Asn Phe Asp Leu Pro His Val Ile Glu Glu Ala Thr Ser

225 230 235 240

His Pro Gly Ile Glu His Val Gly Gly Asp Met Phe Val Ser Val Pro

245 250 255

Lys Gly Asp Ala Ile Phe Met Lys Trp Ile Cys His Asp Trp Ser Asp

260 265 270

Glu His Cys Val Lys Phe Leu Lys Asn Cys Tyr Glu Ser Leu Pro Glu

275 280 285

Asp Gly Lys Val Ile Leu Ala Glu Cys Ile Leu Pro Glu Thr Pro Asp

290 295 300

Ser Ser Leu Ser Thr Lys Gln Val Val His Val Asp Cys Ile Met Leu

305 310 315 320

Ala His Asn Pro Gly Gly Lys Glu Arg Thr Glu Lys Glu Phe Glu Ala

325 330 335

Leu Ala Lys Gly Ser Gly Phe Lys Gly Ile Asn Val Ala Cys Asn Ala

340 345 350

Phe Gly Val Tyr Val Ile Glu Met Leu Lys Lys Phe

355 360

<210> 6

<211> 1095

<212> DNA

<213> Isatis tinctoria (Isatis indigotica fort.)

<400> 6

atgggatcaa cggcggagac acagataact ccggtacaag tcactgacga cgaagccgct 60

ctcttcgcca tgcagctagc gagtgcctcc gttcttccga tggttttaaa atcggcatta 120

gacctcgatc ttctcgagat catggccaag aactcttctc cgatgtctcc gtctgagatt 180

gcttctaaac ttcagaccaa aaaccccgaa gctccggtca tgctcgaccg tatcctccgt 240

cttcttacct cttactccat cctcacctgc tccaaccgta ctattcccgg cggcgacggc 300

gtcgagagga tttacgggct tggtccggtt tgcaagtatc tgaccaagaa cgaggatggt 360

gtctcgattg ctgctctttg tcttatgaac caagacaagg ttctcatgga aagctggtac 420

catttgaaag atgcaattct tgatggtggg atcccattca acaaggctta tggaatgagc 480

gcgttcgagt accatgggaa ggaccttagg ttcaacacgg tcttcaacaa tggaatgtct 540

aaccattcaa ccatcacaat gaagaagatt ctcgagacct ataagggttt cgagggtttg 600

acttctttgg ttgacgttgg tggtggcatt ggtgctactc tcaaaatgat tgtctccaag 660

taccctaacc tcaaaggcat caactttgat ctccctcatg tcatcgaaga agctacttct 720

caccctggta ttgaacatgt tggaggagat atgtttgtga gtgtccctaa aggtgatgcc 780

attttcatga agtggatatg ccacgattgg agcgacgaac actgcgtgaa attcttgaaa 840

aactgctacg agtcgcttcc agaggatgga aaagttatat tagcagagtg tatacttcca 900

gagacaccag actcaagcct ctcgaccaaa caagtagtcc atgtcgactg cattatgttg 960

gcccacaatc ctggaggcaa agaacggacc gagaaagagt tcgaggcatt agctaaagga 1020

tcaggcttca aaggcatcaa cgttgcctgc aacgcttttg gtgtttacgt tattgagttg 1080

ctcaagaaga tctga 1095

<210> 6

<211> 1089

<212> DNA

<213> Isatis tinctoria (Isatis indigotica fort.)

<400> 6

atggactcaa cggcggagac acagttaact ccagtgcaag tcaccgaaga cgaaactatc 60

ctcttcgcca cacagttagc cagtgcctcc gttcttccta tggctttaaa aacgactata 120

gagctcgatg ttctcgagat catggccaag aactcttcac ctatgtctgc gtctgagatc 180

gtttctcatc ttccgaccaa aaaccccgaa gcgacggtca tgctcgaccg tatcctccgt 240

cttcttgcgg cttactccat cctcacctgc tccgtccgta cacttcccga cggcgtcgac 300

cgactttacg ggcttggtcc ggtttgcaag tatttgacca agaacgaaga tggtgtctcg 360

attgctgctc tctgtctcat gaaccatgac aaggtcttaa tggaaagctg gtaccatctg 420

aaagatgcaa ttcttgatgg tgggattcca ttcaacaaag cttatggcat gagcgcgttc 480

gagtaccatg ggactgacct tagattcaac aaggtgttca ataatggaat gtctaaccat 540

accaccatct caatgaagaa gattctcgag acctataagg gtttcgaggg attgacttct 600

ttggttgatg ttggtggtgg cattggagct acactcaaaa tgatagtctc taagtaccct 660

aaccttaaag ggatcaactt tgatctccct tatgtcattg cagatgctcc tccttatccc 720

ggtgttgagt atgttggagg agatatgttt gtaagtgtcc ccaaaggtga tgccattttc 780

atgaagtgga tatgccatga ttggagtgac gaacactgtg tgaaaatctt gaagaattgc 840

tacgaggcgc ttccggagaa tggaaaagtg ataatagcag agagcatact tccagaaaca 900

ctagattcaa gcctcttgac caaacaagtt gtccacgttg attgcattat gttggctcac 960

aatcctggag gcaaagaacg gaccgcgaaa gagtttgagg cattagccaa aggatcaggc 1020

ttcaaaggct tcaaagttgt ttgcaacacc tttggtattt accttattga gctgcacaag 1080

aagatctaa 1089

<210> 7

<211> 1095

<212> DNA

<213> Isatis tinctoria (Isatis indigotica fort.)

<400> 7

atgggctcag cggcggagac acagataact ccggtacaag tcactgacga cgaaacccgc 60

ctcttcgcca tgcagctagc gagtgcctcc gttcttccga tggttttaaa atcggcatta 120

gacctcgatc ttctcgagat catggccaag aactcttctc cgatgtctcc gtctgagatt 180

gcttctaaac ttcagaccaa aaaccccgaa gctccggtca tgctcgaccg tatcctccgt 240

cttcttacgt cttactccat cctcacctgc tccaaccgta ctattcccgg cggcgacggc 300

gtcgagagga tttacgggct tggtccggtt tgcaagtatc tgaccaagaa cgaggatggt 360

gtctcgattg ctgctctttg tcttatgaac caagacaagg ttctcatgga aagctggtac 420

catttgaaag atgcaattct tgatggtggg atcccattca acaaggctta tggaatgagc 480

gcgttcgagt accacgggaa ggaccttagg ttcaacacgg tcttcaacaa tggaatgtct 540

aaccattcaa ccatcacaat gaagaagatt ctcgagacct ataagggttt cgagggtttg 600

acttctttgg ttgacgttgg tggtggcatt ggtgctactc tcaaaatgat tgtctccaag 660

taccctaacc tcaaaggcat caactttgat ctccctcatg tcatcgaaga agctacttct 720

caccctggta ttgaacatgt tggaggagat atgtttgtga gtgtccctaa aggtgatgcc 780

attttcatga agtggatatg ccacgattgg agcgacgaac actgcgtgaa attcttgaaa 840

aactgctacg agtcgcttcc agaggatgga aaagttatat tagcagagtg tatacttcca 900

gagacaccag actcaagcct ctcgaccaaa caagtagtcc atgtcgactg cattatgttg 960

gcccacaatc ctggaggcaa agaacggacc gagaaagagt ttgaggcatt agctaaagga 1020

tcaggcttca aaggcatcaa cgttgactgc aacgcttttg gtgtttacgt tattgagctg 1080

cacaagaaga tctaa 1095

<210> 8

<211> 1095

<212> DNA

<213> Isatis tinctoria (Isatis indigotica fort.)

<400> 8

atgggctcaa cggtggagac acagataact ccggtacaag tcactgacga cgaagccgct 60

ctcttcgcca tgcagctagc gagtgcctcc gttcttccga tggttttaaa atcggcatta 120

gacctcgatc ttctcgagat catggccaag aactcttctc cgatgtctcc gtctgagatt 180

gcttctaaac ttcagaccaa aaaccccgaa gctccggtca tgctcgaccg tatcctccgt 240

cttcttacgt cttactccat cctcacctgc tccaaccgta ctattcccgg cggcgacggc 300

gtcgagagga tttacgggct tggtccggtt tgcaagtatc tgaccaagaa cgaggatggt 360

gtctcgattg ctgctctttg tcttatgaac caagacaagg ttctcatgga aagctggtac 420

catttgaaag atgcaattct tgatggtggg atcccattca acaaggctta tggaatgagc 480

gcgttcgagt accacgggaa ggaccttagg ttcaacacgg tcttcaacaa tggaatgtct 540

aaccattcaa ccatcacaat gaagaagatt ctcgagacct ataagggttt cgagggtttg 600

acttctttgg ttgacgttgg tggtggcatt ggtgctactc tcaaaatgat tgtctccaag 660

taccctaacc tcaaaggcat caactttgat ctccctcatg tcatcgaaga agctacttct 720

caccctggta ttgaacatgt tggaggagat atgtttgtga gtgtccctaa aggtgatgcc 780

attttcatga agtggatatg ccacgattgg agcgacgaac actgcgtgaa attcttgaaa 840

aactgctacg agtcgcttcc agaggatgga aaagttatat tagcagagtg tatacttcca 900

gagacaccag actcaagcct ctcgaccaaa caagtagtcc atgtcgactg cattatgttg 960

gcccacaatc ctggaggcaa agaacggacc gagaaagagt tcgaggcatt agctaaagga 1020

tcaggcttca aaggcatcaa cgttgcctgc aacgcttttg gtgtttacgt tattgagatg 1080

ctcaagaagt tctga 1095

Claims

1. Isatis tinctoria caffeic acid-O-methyltransferase, characterized in that the amino acid sequence is any one of the sequences of SEQ ID No. 1-4.

2. Isatis tinctoria caffeic acid-O-methyltransferase gene encoding the same according to claim 1.

3. The woad caffeic acid-O-methyltransferase gene according to claim 2, having a nucleotide sequence of any one of SEQ ID nos. 5-8.

4. A recombinant vector comprising a nucleotide sequence encoding the woad caffeic acid-O-methyltransferase according to claim 1.

5. The recombinant vector according to claim 4, which comprises the woad caffeic acid-O-methyltransferase gene according to claim 2 or 3.

6. A host cell comprising the woad caffeic acid-O-methyltransferase gene of claim 2 or 3 or the recombinant vector of claim 4 or 5.

7. Use of the woad-O-methyltransferase of claim 1, the woad-O-methyltransferase gene of claim 2 or 3, the recombinant vector of claim 4 or 5, or the host cell of claim 6 for the preparation of isorhamnetin or chrysoeriol.

8. A process for producing isorhamnetin or chrysoeriol, characterized by using the woad caffeic acid-O-methyltransferase according to claim 1, a recombinant vector or host cell capable of expressing the woad caffeic acid-O-methyltransferase according to claim 1 as a catalyst.