CN117904142A - Application of SlMYB gene in improving salt stress resistance of tomatoes - Google Patents

Application of SlMYB gene in improving salt stress resistance of tomatoes Download PDF

Info

Publication number
CN117904142A
CN117904142A CN202410302607.9A CN202410302607A CN117904142A CN 117904142 A CN117904142 A CN 117904142A CN 202410302607 A CN202410302607 A CN 202410302607A CN 117904142 A CN117904142 A CN 117904142A
Authority
CN
China
Prior art keywords
slmyb
tomato
protein
salt stress
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202410302607.9A
Other languages
Chinese (zh)
Other versions
CN117904142B (en
Inventor
董韩
胡超轶
狄延翠
王媛媛
国志信
张涛
徐金鑫
朴凤植
杜南山
董晓星
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hainan Research Institute Of Zhejiang University
Henan Agricultural University
Original Assignee
Hainan Research Institute Of Zhejiang University
Henan Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hainan Research Institute Of Zhejiang University, Henan Agricultural University filed Critical Hainan Research Institute Of Zhejiang University
Priority to CN202410302607.9A priority Critical patent/CN117904142B/en
Publication of CN117904142A publication Critical patent/CN117904142A/en
Application granted granted Critical
Publication of CN117904142B publication Critical patent/CN117904142B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention belongs to the field of modern agricultural industry, and particularly relates to application of SlMYB gene in improving salt stress resistance of tomatoes. According to the invention, tomato SlMYB gene knockout and over-expression plants are constructed by gene means, and the expression level of SlMYB protein is regulated to study the regulation mechanism of tomato salt tolerance. As a result, the salt stress can obviously induce the transcription of SlMYB and the accumulation of SlMYB52 protein, and the accumulation of tomato biomass can be improved by the overexpression of SlMYB under the salt stress, the fluorescence content of leaf green is improved, the conductivity content is reduced, and then the salt stress tolerance of tomatoes is improved. In the modern agricultural industry, the invention provides gene resources for cultivating new varieties of salt-tolerant tomatoes, has better potential application value, and lays a theoretical foundation for researching the mechanism of responding stress signals of tomato plants and the molecular mechanism of responding complex and changeable environmental factors.

Description

Application of SlMYB gene in improving salt stress resistance of tomatoes
Technical Field
The invention belongs to the field of modern agricultural industry, and particularly relates to application of SlMYB gene in improving salt stress resistance of tomatoes.
Background
Tomato (Solanum lycopersicum l.) belongs to the genus tomato of the family solanaceae, the original south america, is one of the most widely planted vegetable crops in the world. The tomato variety is rich, and can be used as vegetables and fruits. The fruit has rich nutrient substances, contains considerable organic acids such as malic acid, citric acid and the like, and also contains nutrient substances such as carotenoid, vitamin B1, lycopene and the like, and is favored by consumers due to the unique flavor and the nutritional value. In the development process of facility agriculture, due to the fact that soil is in a closed environment with high temperature and high humidity for a long time and lack of rainfall leaching, the facility soil salinization can be caused along with unreasonable modes such as continuous cropping, fertilization, planting and irrigation, and the yield and quality of tomatoes can be greatly reduced. Therefore, there is a need to explore the response of tomatoes to salt stress and the molecular mechanism thereof, search for key genes for improving the salt stress resistance of tomatoes, and improve the salt stress resistance and reduce the damage of the tomatoes.
Disclosure of Invention
The object of the first aspect of the present invention is to provide the use of SlMYB in the regulation of salt stress resistance in tomatoes.
The object of the second aspect of the invention is to provide the use of a 1) to a 3) in at least one of b 1) to b 4).
The object of the third aspect of the present invention is to provide the use of SlMYB protein inhibitors in at least one of d 1) to d 8).
The object of the fourth aspect of the present invention is to provide a method comprising the step of reducing the expression and/or activity of SlMYB protein in tomato.
The object of the fifth aspect of the present invention is to provide a method comprising the step of increasing the expression level and/or activity of SlMYB protein in tomato.
In order to achieve the above purpose of the present invention, the present invention adopts the following technical scheme:
in a first aspect of the invention, slMYB is used for modulating salt stress resistance in tomatoes.
In a second aspect of the invention there is provided the use of a 1) to a 3) in at least one of b 1) to b 4):
a1 SlMYB52 protein;
a2 A biological material associated with SlMYB proteins;
a3 Agents that target up-regulate the amount of expression of SlMYB protein and/or enhance SlMYB protein activity;
b1 Improving salt stress resistance of tomatoes;
b2 Cultivating a tomato variety;
b3 Preparing a product that increases salt stress resistance of tomatoes;
b4 Preparing a product for cultivating tomato varieties.
Preferably, the biomaterial comprises at least one of c 1) to c 12):
c1 Nucleic acid molecules encoding SlMYB proteins;
c2 An expression cassette comprising c 1) said nucleic acid molecule;
c3 A recombinant vector comprising c 1) said nucleic acid molecule;
c4 A recombinant vector comprising the expression cassette of c 2);
c5 A recombinant cell comprising c 1) said nucleic acid molecule;
c6 A recombinant cell comprising the expression cassette of c 2);
c7 A recombinant cell containing c 3) the recombinant vector;
c8 A recombinant cell comprising c 4) said recombinant vector;
c9 A recombinant microorganism comprising the nucleic acid molecule of c 1);
c10 A recombinant microorganism comprising the expression cassette of c 2);
c11 A recombinant microorganism comprising c 3) said recombinant vector;
c12 A recombinant microorganism comprising the recombinant vector of c 4).
Preferably, the tomato variety comprises the following characteristics: salt stress resistance is increased.
In a third aspect of the invention there is provided the use of a SlMYB protein inhibitor in at least one of d 1) to d 4):
d1 Reducing salt stress resistance of tomatoes;
d2 Cultivating a tomato variety;
d3 Preparing a product that reduces salt stress resistance of tomatoes;
d4 Preparing a product for cultivating tomato varieties.
Preferably, the tomato variety comprises the following characteristics: salt stress resistance is increased.
Preferably, the SlMYB protein inhibitor comprises at least one of a substance that inhibits SlMYB protein activity, a substance that degrades SlMYB protein, a substance that reduces SlMYB protein expression levels.
Preferably, the agent that reduces SlMYB protein expression levels comprises at least one of e 1) to e 13):
e1 siRNA, dsRNA, miRNA, ribozyme, shRNA, CRISPR/cas system targeting SlMYB proteins;
e2 A nucleic acid molecule encoding e 1);
e3 An expression cassette comprising e 2) said nucleic acid molecule;
e4 A recombinant vector comprising e 2) said nucleic acid molecule;
e5 A recombinant vector comprising e 3) said expression cassette;
e6 A transgenic cell comprising e 2) said nucleic acid molecule;
e7 A transgenic cell comprising e 3) said expression cassette;
e8 A transgenic cell comprising e 4) the recombinant vector;
e9 A transgenic cell comprising e 5) the recombinant vector;
e10 A recombinant microorganism comprising e 2) said nucleic acid molecule;
e11 A recombinant microorganism comprising e 3) said expression cassette;
e12 A recombinant microorganism comprising e 4) said recombinant vector;
e13 A recombinant microorganism comprising the recombinant vector of e 5).
Preferably, the SlMYB protein inhibitor comprises a CRISPR/Cas system that targets the SlMYB52 protein, the CRISPR/Cas system comprising a sgRNA.
Preferably, the nucleotide sequence of the sgRNA is as set forth in SEQ ID NO: 3.
Preferably, the CRISPR/Cas system targeting SlMYB protein further comprises a Cas protein and/or a biological material associated with a Cas protein; the biomaterial comprises: f1 At least one of) to f 12): f1 A nucleic acid molecule encoding a Cas protein; f2 An expression cassette comprising f 1) said nucleic acid molecule; f3 A recombinant vector comprising f 1) said nucleic acid molecule; f4 A recombinant vector comprising f 2) said expression cassette; f5 A transgenic cell comprising f 1) the nucleic acid molecule; f6 A transgenic cell comprising f 2) said expression cassette; f7 A transgenic cell comprising f 3) the vector; f8 A transgenic cell comprising f 4) the vector; f9 A recombinant microorganism comprising the nucleic acid molecule of f 1); f10 A recombinant microorganism comprising the expression cassette of f 2); f11 A recombinant microorganism containing the recombinant vector of f 3); f12 A recombinant microorganism comprising the recombinant vector of f 4).
Preferably, the Cas protein comprises a Cas9 protein.
In a fourth aspect of the invention, there is provided a method comprising: and (3) reducing the expression quantity and/or activity of SlMYB protein in tomato.
Preferably, the method is at least one of g 1) to g 2): g1 A method of reducing salt stress resistance of a tomato of a plant; g2 A method for cultivating tomato varieties.
Preferably, the tomato variety comprises the following characteristics: salt stress resistance is reduced.
Preferably, the tomato variety comprises the following characteristics: salt stress resistance is reduced relative to a reference level; the reference level is that of the wild type.
Preferably, the step of reducing the expression level and/or activity of SlMYB protein in tomato is to introduce at least one of h 1) to h 3) into tomato tissue and/or into tomato cells.
H1 The sgrnas described above; h2 Biological material of the above sgrnas; h3 A CRISPR/Cas system as described above.
Preferably, the means of introduction comprises various conventional or specific genetic transformation methods by using Ti plasmids, ri plasmids, plant viral vectors, direct DNA transformation, microinjection, electroporation, etc.
In a fifth aspect of the invention, there is provided a method comprising: and (3) increasing the expression quantity and/or activity of SlMYB protein in tomato.
Preferably, the method is at least one of i 1) to i 2): i1 A method of increasing salt stress resistance of tomato; i2 A method for cultivating tomato varieties.
Preferably, the tomato variety comprises the following characteristics: salt stress resistance is increased.
Preferably, the tomato variety comprises the following characteristics: salt stress resistance is increased relative to a reference level; the reference level is that of the wild type.
Preferably, the step of increasing the expression level and/or activity of SlMYB protein in tomato is to introduce a nucleic acid molecule encoding SlMYB protein into tomato tissue or tomato cells.
The beneficial effects of the invention are as follows:
The invention discovers the application of the tomato SlMYB in the breeding of tomato varieties for the first time, and SlMYB can regulate and control various aspects of salt tolerance, biomass accumulation, photosynthesis level, plant height, lateral bud number and the like of the tomato. The invention constructs a transgenic plant of tomato SlMYB gene over-expression and gene knockout for the first time, and performs functional research. Through salt stress treatment experiments, slMYB genes are found to play a role in forward regulation in salt stress tolerance of tomatoes. The SlMYB gene provided by the invention provides gene resources for cultivating new species of tomato salt tolerance, and has good potential application value. In the field of modern agricultural industry, a theoretical foundation is laid for researching a regulation network and a signal mechanism of a tomato response stress signal, and the method has important significance and wide application value for cultivating new varieties of tomatoes with salt tolerance and promoting commercial and modern breeding processes of tomatoes.
Drawings
FIG. 1 shows the Western Blot detection results of the SlMYB gene over-expressed tomato strain in example 3 of the present invention; wherein A is the expression level of tomato SlMYB gene and B is the expression level of tomato SlMYB protein.
FIG. 2 shows the sequencing result of the sgRNA sequence of the mutant myb52 plant and the expression level of the mutant material SlMYB gene in example 3 of the present invention; wherein, the sequencing result of the sgRNA sequence of the A mutant myb52 plant is in a simplified diagram, and B is the expression level of tomato SlMYB gene.
FIG. 3 shows the expression change and protein accumulation change of SlMYB gene of tomato in salt stress treatment at different times in example 1; wherein A is the expression level of tomato SlMYB gene under salt stress, and B is the expression level of tomato SlMYB protein under salt stress.
FIG. 4 shows the growth phenotype, fresh weight and dry matter accumulation levels of wild type plants, over-expressed plants MYB52-OE and mutant MYB52 plants of example 1 of the invention, after 7 days of normal and salt stress treatment; wherein A is the growth condition of the tomato overground part, B is the fresh weight level of the tomato overground part, C is the fresh weight reduction proportion of the tomato overground part of three materials under salt stress, D is the dry weight level of the tomato overground part, and E is the biomass reduction proportion of the tomato overground part of three materials under salt stress.
FIG. 5 shows the plant height statistics of wild type plants, over-expressed plants MYB52-OE and mutant MYB52 plants of effect example 1 of the invention after 7 days of normal and salt stress treatment; wherein A is the statistical result of tomato plant height, and B is the descending proportion of tomato plant height of three materials under salt stress.
FIG. 6 shows root growth phenotype, fresh weight and dry matter accumulation levels of wild type plants, over-expressed plants MYB52-OE and mutant MYB52 plants after 7 days of normal and salt stress treatment in examples of the invention; wherein A is the growth condition of the underground part of the tomato, B is the fresh weight level of the root system of the tomato, C is the fresh weight reduction proportion of the root system of the tomato of the three materials under the stress of salt, D is the dry weight level of the root system of the tomato, and E is the biomass reduction proportion of the root system of the tomato of the three materials under the stress of salt.
FIG. 7 shows leaf relative conductivity levels of wild-type, over-expressed, MYB52-OE and mutant MYB52 plants of example 1 of the effect of the invention after 7 days of normal and salt stress treatment.
FIG. 8 shows the maximum photochemical efficiency (Fv/Fm) change of leaf PSII after normal and salt stress treatment for 7 days in wild-type, over-expressed and mutant MYB52 plants of example 1.
FIG. 9 shows statistical results of tomato lateral bud growth phenotype, lateral bud number and length under normal growth conditions (no salt stress) growth conditions for wild type plants, over-expressed plants MYB52-OE and mutant MYB52 plants in example 1 of effect of the invention; wherein A is the result of lateral bud phenotype shooting, B is the result of total lateral bud length statistics, and C is the number of single lateral buds.
Detailed Description
The conception and the technical effects produced by the present invention will be clearly and completely described in conjunction with the embodiments below to fully understand the objects, features and effects of the present invention. It is apparent that the described embodiments are only some embodiments of the present invention, but not all embodiments, and that other embodiments obtained by those skilled in the art without inventive effort are within the scope of the present invention based on the embodiments of the present invention.
Significance description: the data of the following examples of the invention are expressed as mean ± standard deviation (n=4), with significant differences between treatments represented by the x and different letters (P <0.05, student's t test or Tukey's test), wherein x is student's t test and the letter tukey's test.
Example 1SlMYB construction of Gene overexpression vector
The SlMYB gene is derived from tomato and is numbered Solyc g093890 in the tomato genome database (https:// solgenomics. To investigate the effect of SlMYB over-expression on the salt stress resistance of tomato, the SlMYB gene was first cloned from the tomato genome. Based on the sequence analysis of the coding region, specific primers SlMYB-F and SlMYB-R were designed, and restriction sites (AscI and KpnI) were added to the primers, and the sequence of SlMYB-F was: TTACAATTACCATGGGGCGCGCCATGCCAAGGGTACAACAACAGC (5 '-3', SEQ ID NO: 1); slMYB52-R has the sequence: AACATCGTATGGGTAGGTACCGATATTTCCAAGTACATCAATCCAGAA (5 '-3', SEQ ID NO: 2). The SlMYB fragment is amplified by KOD high-fidelity enzyme PCR, then the PCR amplified fragment and the vector are subjected to enzyme digestion, and the SlMYB fragment is connected to pFGC1008-HA to obtain a plant overexpression vector pFGC1008: slMYB52-HA. The recombinant plasmid is sent to the Kango company for sequencing and confirmation, and the nucleotide sequence of the obtained gene SlMYB is shown as SEQ ID NO. 1; the amino acid sequence of the protein coded by the gene is shown as SEQ ID NO. 2. The results showed that the cloned sequence was identical to the sequence published in Solgenomics (Solyc g 093890) and that positive plasmids were extracted for use, designated pFGC1008: slMYB52-HA.
Example 2SlMYB construction of CRISPR/Cas9 Gene knockout vector
To explore the effect of SlMYB gene deletion on tomato salt tolerance, the present example designed SlMYB target gene sequence, constructed pCAMBIA1301-U6-26-sgRNA 1-SlMYB-35S-Cas 9SK vector by enzyme digestion connection, and constructed SlMYB gene knockout material by CRISPR/Cas9 technology for research.
First, a CRISPR-P website ((http): the target sequence of the SlMYB gene was designed by// cbi.hzau.edu.cn/cgi-bin/CRISPR), the specific sequence being sgRNA1: GGAGGCGATCATAAAGAAGG (5 '-3', SEQ ID NO: and 3) annealing the synthesized sgRNA1 sequence (single strand) to form double-stranded sgRNA1, and simultaneously, connecting the formed sgRNA1 with the BbsI restriction enzyme-cut AtU-26 SK vector, extracting positive plasmid for later use, named U6-26-sgRNA1-SlMYB 52-SK., simultaneously double-cutting the U6-26-sgRNA 1-SlMYB-SK and 35S-Cas9SK vector by KpnI and SalI restriction enzyme, recovering the respective cut products and connecting the cut U6-26-sgRNA 1-SlMYB-SK fragment to the same cut 35S-Cas9SK vector, detecting positive plasmid for later use by U6-26-sgRNA 1-SlMYB-SK. (5 '-3', SEQ ID NO: 4), detecting positive clone, and simultaneously converting the positive clone to the cut product by using the same, namely, connecting the cut product to the cut product of the cut U6-26-sgRNA 1-SlMYB-SK 9S 35S, namely, to the cut 35S-Cas9SK vector, and the cut 35S-35S 37S cut by using the PCR detection primer of the bacterial liquid for PCR, wherein the PCR detection of U6-26-F GACGGCCAGTGAATTGTA (5 '-3', SEQ ID NO: 4), the positive plasmid is picked up, and the positive clone is detected by the U6-26-6-35S 35 SK, and the cut product is transferred to the cut by the cut product of the PCR by the PCR, and the cut product of the PCR reagent, and the cut PCR reagent, and the positive and the PCR and the positive and the PCR and the masmasand and the masand and the masand and the and the and for and for, single colonies were picked and grown overnight in liquid LB medium containing 50mg/L kanamycin (Kan), at 37℃with shaking at 200 rpm. And designing primers at the 5' end of the pCAMBIA1301 vector to carry out bacterial liquid PCR detection (about 550 bp), and respectively verifying positive clones by sequencing the upstream and downstream primers ,U6-26-Cas9-F：GCTCGTATGTTGTGTGGAAT（5'-3',SEQ ID NO：6）,U6-26-Cas9-R：TATCTAAGCGATGTGGGACT（5'-3',SEQ ID NO：7）. through Kangsu corporation to extract positive plasmids for standby, wherein the positive plasmids are named pCAMBIA1301-U6-26-sgRNA 1-SlMYB-35S-cas 9.
Example 3SlMYB acquisition of transgenic plants
SlMYB52-HA and pCAMBIA1301-U6-26-sgRNA1-Sl MYB52-35S-cas9 as plant over-expression vector pFGC1008 are transformed into agrobacterium GV3101 by electric shock method, and wild type (AILSA CRAIG) tomato cotyledon is infected, and through inducing callus, resistance induced differentiation and rooting culture, tissue culture seedling is obtained, and single plant verification seed collection is carried out. The verification method comprises the following steps: the positive transgenic plants are subjected to over-expression by utilizing a fluorescence quantitative experiment and Western Blot verification SlMYB, and the result of the fluorescence quantitative experiment shows that the SlMYB gene expression in the over-expression strain is obviously up-regulated compared with the wild type (shown as A in figure 1); western Blot experiments showed that the wild type had no SlMYB-HA protein band and that a distinct SlMYB-HA band appeared in the over-expressed plants (as shown in FIG. 1B). Primer sequences used for fluorescent quantitation experiments were as follows ：RT-SlMYB52-F: CCAACCACATTCCATTCCCC（5'-3',SEQ ID NO：8）、RT-SlMYB52-R:AACTAGGACCTGCACATGGG（5'-3',SEQ ID NO：9）、RT-SlACTIN2-F: TGTCCCTATTTACGAGGGTTATGC（5'-3',SEQ ID NO：10）、RT-SlACTIN2-R：CAGTTAAATCACGACCAGCAAGAT（（5'-3',SEQ ID NO：11）、RT-SlUBI3-F: GCCGACTACAACATCCAGAAGG（5'-3',SEQ ID NO：12）、RT-SlUBI3-R: TGCAACACAGCGAGCTTAACC（5'-3',SEQ ID NO：13）.
Positive SlMYB mutant transgenic plants (plants transformed into pCAMBIA1301-U6-26-sgRNA1-SlMYB52-35S-Cas9 vectors prepared in example 2) are verified by using plant tissue DNA extraction, PCR and sequencing technologies, and sequencing results show that mutant MYB52 plants (SlMYB CRISPR/Cas9 knockout line) lack 1 base (shown in figure 2A), stop codon translation occurs in advance due to base deletion, so that the effect of functional inactivation of MYB52 proteins is achieved. The present example also examined the expression levels of MYB52 gene in wild-type and mutant MYB52 leaves, and found that MYB52 gene expression tended to decrease dramatically in the mutant compared to the wild-type, with little MYB52 gene expression detected in the mutant MYB52 material (as shown in B in fig. 2).
Effect example 1SlMYB transgenic plants evaluation of salt tolerance
1. Experimental materials
The tomato variety selected for the assay was wild-type AILSA CRAIG and SlMYB over-expressed and SlMYB52 CRISPR/Cas9 knockout strain obtained in example 3.
2. Experimental method
Soaking tomato seeds in 55 ℃ warm soup for sterilization 15 min, transferring to a shaking table with the temperature of 28 ℃ and the rotating speed of 200 rpm for germination acceleration for 2d, sowing the tomato seeds in a cavity tray filled with a mixture (2:1, v/v) 72 of turf and vermiculite for seedling culture after the seeds are about 80% exposed, and culturing in a plant factory under the following growth conditions: the photosynthetic photon flux density was 300. Mu. Mol.m -2·s-1 at 25℃C/20℃C and photoperiod 12/12 h (day/night). After emergence, watering according to the water content of the matrix, keeping the matrix moist, watering Hoagland nutrient solution (PH 1782, PHYGENE) in the whole process, and transplanting the seedlings into a nutrition pot with the diameter of 10 cm and the depth of 9 cm to a plant factory when the tomato seedlings grow to 3 leaves and 1 heart (about 15d after sowing).
Salt stress treatment and control: salt stress treatment is carried out when tomato seedlings grow to five leaves and one heart: the treatment was performed with 200mL of Hoagland nutrient solution (pH 1782, PHYGENE) containing 250 mM NaCl as salt stress treatment, and with an equal volume (200 mL) of Hoagland nutrient solution containing 0mM NaCl as control, and root irrigation treatment was performed every three days. Performing phenotype shooting after salt stress treatment for 7d, and counting dry weight, maximum photochemical efficiency measurement of a photosystem II and relative conductivity measurement; gene and protein experiments under salt stress response were salt stress treatments 0h, 6h, 12h, 24h, 48h, 72h for RNA and protein sampling.
Tomato total RNA extraction, cDNA synthesis and gene expression analysis: RNA is extracted from young leaves of tomatoes which are subjected to salt stress treatment for 0h, 6h, 12h, 24h, 48h and 72 h. After liquid nitrogen milling of plant leaf tissue, total tissue RNA was extracted using a plant total RNA extraction kit (Tiangen, beijing) with reference to the instructions. After confirming the concentration and quality of the RNA samples with Nanodrop, the RNA was reverse transcribed into cDNA using REVERTRAACE QPCR RT KIT (Toyobo) (containing genomic DNA clearing enzyme) with reference to the instructions. Real-time fluorescent quantitative PCR was performed on a Roche LIGHT CYCLER480 PCR apparatus using SYBR fluorescent dye kit (Takala). The relative expression levels of the genes were calculated according to the method of (Livak and schmittgen, 2001) using tomato ACTIN2 and ubiquitin 3 genes as internal references.
Tomato leaf protein extraction and Western-blot detection: for the extraction of total protein of tomatoes, salt stress treatment is adopted for 0h, 6h, 12h, 24h, 48h and 72h, young tomato leaves are ground into powder in liquid nitrogen, about 0.1 g mL of extracting solution （100 mM HEPES, pH 7.5, 5 mM EDTA, 5 mM EGTA, 10 mM DTT, 10 mM NaVO3, 10 mM NaF, 50 mM-glycerophosphate, 10% （v/v）glycerol, 1 mM PMSF and 5%（w/v）PVPP）, is added, after being mixed uniformly by vortex at 13000 rpm and at 4 ℃,20 and min are centrifuged at 4 ℃, the supernatant is the protein content of the obtained protein, the protein content is quantified by using Coomassie brilliant blue, and the supernatant is mixed with 2 Xloading buffer (250 mM Tris-HCl, pH 6.8, 10% (w/v) SDS,0.5% (w/v) bromophenol blue, 50% (v/v) glycerol and 10 mM DTT) in equal volume, and the temperature of 95 ℃ is modified by heating to 10 min.80 or 100. Mu.g of total protein was separated by electrophoresis on a 10% (w/v) SDS-polyacrylamide gel and transferred to nitrocellulose membrane. After blocking 1h with TBST (20 mM Tris, pH 7.5, 30 mM NaCl, 0.05% (v/v) Tween 20) containing 5% (w/v) BSA as blocking solution at room temperature, the membrane was washed 3-5 times with TBST, 5 min each.
For MYB52 protein: 1h was incubated with 0.1% (v/v) HA polyclonal antibody (Abcam, ab18181, cambridge, mass., USA) at room temperature, and 1h was incubated with anti-mouse-HRP conjugated antibody (Abcam, ab205719, cambridge, mass., USA) after washing. TBST washes the membrane 5 times, 5min at a time. Finally, the signal on the blot was observed using a high-sensitivity chemiluminescent kit (PERKIN ELMER, massachusetts, USA) according to the manufacturer's instructions. The plant actin monoclonal antibody (PLANT ACTIN Monoclonal Antibody, Q30, cat#YM3034) served as a control for Western-blot analysis.
The method for measuring the relative conductivity of the plants comprises the following steps: cutting the treated tomato leaves into strips with proper length (avoiding main pulse), rapidly weighing 3 parts of fresh samples, respectively placing 0.2g of fresh samples into a graduated centrifuge tube filled with 20mL of deionized water, covering a cover, and placing into a shaking table at 28 ℃ for leaching for 1.5-2 h. The conductivity R1 of the extract was measured by a conductivity meter, then heated in a boiling water bath for 15min, cooled to room temperature and shaken well, and the conductivity R2 of the extract was measured again. Relative conductivity = R1/R2 x 100%.
The specific determination method of the maximum photochemical efficiency of the optical system II comprises the following steps: after the plants were subjected to dark environment adaptation for 30 minutes, detection light (< 0.5. Mu. Mol m- 2s-1) was irradiated using a chlorophyll fluorescence imager (IMAG-PAM; heinz Walz, germany), minimum fluorescence Fo was measured, and saturated pulsed light (4000. Mu. Mol m -2s-1) was further irradiated, and maximum fluorescence Fm was measured.
The fluorescence parameter calculation method is PS II maximum photochemical efficiency (Fv/Fm) = (Fm-Fo)/Fm.
The tomato collateral phenotype observation and statistics method comprises the following steps: tomatoes of three materials were grown under the above normal conditions (no salt stress treatment) for about 50d (10-12 leaf period), the lateral bud phenotype was observed and photographed, and the lateral bud length and number were counted. Counting the total lateral bud length in the three materials, counting the lateral bud lengths of 1-10 sections from bottom to top by using plants with the lateral bud lengths at 10 sections upwards in sequence from the first true leaf, and summing to obtain the total lateral bud length; statistics of the number of single lateral buds are carried out according to the statistics that the length of each node lateral bud is greater than 0.3 cm, 15 replicates are treated each time, and the independent experiment is repeated for 3 times.
2. Experimental results
1) Tomato SlMYB response to salt stress
The tomato varieties selected in the test are wild AILSA CRAIG and the SlMYB over-expression and SlMYB CRISPR/Cas9 knockout strain obtained in the example 3, seeds are sown in plastic pots filled with 3:1 turf and vermiculite composite culture medium, the medium is watered according to the water content of the medium after emergence of seedlings to keep moist, hoagland nutrient solution is watered in the whole process, and salt stress treatment is carried out when tomato seedlings grow to five leaves and one heart: root irrigation treatment was performed every three days with 200mL of Hoagland nutrient solution (pH 1782, PHYGENE) containing 250 mM NaCl as salt stress treatment, and an equal volume (200 mL) of Hoagland nutrient solution containing 0mM NaCl as control. Performing phenotype shooting after salt stress treatment for 7d, and counting dry weight, maximum photochemical efficiency measurement of a photosystem II and relative conductivity measurement; gene and protein experiments under salt stress response were salt stress treatments 0h, 6h, 12h, 24h, 48h, 72h for RNA and protein sampling.
First, 200mL of a holland nutrient solution containing 250 mM NaCl was applied to wild-type AILSA CRAIG tomato seedlings grown to a five-leaf-one-heart state, and salt stress treatment was performed on each seedling. And (3) performing salt stress treatment for 0h, 6h, 12h, 24h, 48h and 72h, sampling RNA and protein, and performing correlation detection. The result of transcription of SlMYB gene is shown in FIG. 3A, and the result of expression of SlMYB52 protein is shown in FIG. 3B. The salt stress can obviously induce the transcription of SlMYB and the accumulation of MYB52 protein, and along with the increase of the salt stress treatment time, the transcription of SlMYB gene is obviously increased and then gradually decreased, and the salt stress treatment 6h induces the expression level of SlMYB gene to be highest; and the MYB52 protein also tends to gradually accumulate and then decrease along with the increase of the salt stress treatment time, and the salt stress treatment is carried out for 24 hours to promote the mass accumulation of SlMYB protein. The above results demonstrate that tomato SlMYB responds to salt stress.
2) SlMYB52 effects on tomato phenotype
The five-leaf, one-heart wild tomato seedling (WT), slMYB gene over-expression strain (MYB 52-OE) obtained in example 3 and mutant strain (MYB 52) were then subjected to salt stress treatment: and (3) taking 200mL of Hoagland nutrient solution containing 250 mM NaCl of each plant as salt stress treatment, taking an equal volume (200 mL) of Hoagland nutrient solution containing 0mM NaCl as a control, respectively carrying out root irrigation treatment, and observing the growth phenotype and salt damage phenotype of tomato plants of wild type, over-expressed plant lines and mutant plant lines after one week after every three days of treatment.
The real object shooting result of the growth condition of the tomato is shown in a graph A in fig. 4, the fresh weight weighing result of the tomato on the overground part is shown in a graph B in fig. 4, the fresh weight of the tomato on the overground part of three materials under the salt stress is reduced compared with that of the tomato on the overground part of three materials, for example, the fresh weight weighing result of the tomato on the overground part of three materials is shown in a graph C in fig. 4, the weighing result of the dry weight of the tomato on the overground part of three materials under the salt stress is shown in a graph D in fig. 4, and the biomass reduction ratio of the tomato on the overground part of the three materials under the salt stress is shown in a graph E in fig. 4. The effect of salt stress on the growth and development of plants can be expressed in various aspects, wherein the change of plant biomass is visual representation of the plant on the salt stress, and is also a direct index of plant tolerance, so that the plant growth condition and the capability of resisting the salt stress can be reflected to a certain extent. Research results show that after the wild tomato plants are subjected to salt stress, plant leaves turn yellow, the fresh weight and biomass of overground parts are obviously reduced, and the reduction ratio is respectively 32.1 percent and 42.4 percent. The mutant myb52 plants had the worst tolerance to salt stress, and the aerial stem basal leaves of myb52 plants became severely yellow and died off after salt stress (as shown in fig. 4 a). And after salt stress, the fresh weight and dry weight of the overground parts of myb52 mutant plants are reduced to the greatest extent, and the reduction ratio is 51.5% and 62.8% respectively. However, MYB52-OE plants are most tolerant to salt stress, leaves of MYB52-OE plants remain fresh green under salt stress, yellowing of leaves does not occur, and fresh weight and biomass reduction amplitude of overground parts of MYB52-OE plants after salt stress are minimum, and the reduction ratio is 19% and 34.8%, respectively (as shown by B-E in FIG. 4).
The tomato plant height phenotype statistics are shown in figure 5. The statistical results of tomato plant heights are shown in a figure 5A, and the decreasing proportion of tomato plant heights of three materials subjected to salt stress is shown in a figure 5B. It was found that under normal growth conditions, the plant height of the mutant MYB52 plants was up to 25.1cm, significantly higher than the WT and MYB52-OE plants, whereas the plant height of the over-expressed SlMYB plants was significantly reduced compared to the wild type plants, only 12.3cm. Crop salt tolerance can be identified by means of plant dry matter, plant height and other indexes, wherein plant height is used as one of the indexes of salt stress sensitivity. It was also found that under salt stress treatment, the plant heights of the three plants WT, MYB52-OE and MYB52 were all significantly reduced, but the plant height reduction ratio of the MYB52-OE plant under salt stress was at least 23.3% and the plant height reduction ratio of the MYB52 mutant plant was at most 40.8%, thus further proving that the MYB52-OE plant was more tolerant to salt stress.
The photographing result of the real object of the underground growth condition of the tomatoes is shown in a graph A in fig. 6, the weighing result of the fresh weight of the underground part is shown in a graph B in fig. 6, the fresh weight of the roots of the tomatoes with three materials under the salt stress is reduced compared with that of the tomatoes with three materials, for example, the fresh weight of the roots is shown in a graph C in fig. 6, the weighing result of the dry weight of the roots is shown in a graph D in fig. 6, and the biomass reduction ratio of the roots of the tomatoes with three materials under the salt stress is shown in a graph E in fig. 6. Salt stress can obviously inhibit the growth of tomatoes, so that plants are dwarf, leaves turn yellow and root systems are dysplasia. Root system change is also one of the indicators for salt stress resistance. The research shows that the root system of the WT tomato plant is obviously inhibited under the salt stress, the number of the root system is reduced, the fresh weight and the dry weight of the root system are obviously reduced, and the reduction ratio is 34.8 percent and 32.5 percent respectively compared with the control without the salt stress. The mutant myb52 plant has the most serious root inhibition, the shortest root system and the most obvious reduction of fresh weight and dry weight of the root system after being subjected to salt stress, and the reduction ratio is 49.9 percent and 41.4 percent respectively. And under salt stress, the MYB52-OE plant root system is least inhibited, the fresh weight and dry weight reduction ratio of the root system are least, and the reduction ratio is 25.3% and 19.6% respectively. Therefore, the root system of the MYB52-OE plant is least affected by salt stress, and the salt stress tolerance is strongest.
In general, MYB52-OE plants have the strongest tolerance to salt stress, keep the leaf color dark green, have no yellowing and falling off phenomena, have long root systems and more lateral roots, are not basically inhibited, have the lowest reduction ratio of biomass of overground parts and root systems, and can accumulate more biomass under salt stress.
The tomato leaf conductivity measurements are shown in figure 7. Under normal conditions, plant cell membranes have the capacity of selective permeability to substances, when a plant is influenced by a stress environment, the cell membranes are destroyed, the membrane permeability is increased, so that electrolyte in the cells is extravasated, and the conductivity of a cell leaching solution is increased, therefore, the greater the relative conductivity is, the greater the damage degree of plant tissues is, and the more serious the leakage of cell molecular substances is. The results show that under normal conditions, the conductivity contents of the three materials are not obviously different; while the conductivity content of the leaf is obviously increased after the Wild Type (WT) tomato plant is subjected to salt stress, and is increased by 134.0% compared with a control without salt stress; the conductivity content of the leaf of the myb52 mutant plant is dramatically increased after salt stress, which is 177.1 percent higher than that of a control without salt stress; however, the proportion of MYB52-OE plants subjected to salt stress with the leaf conductivity content increased is the lowest, 71.8%, and leaf conductivity content under salt stress is significantly lower for MYB52-OE plants than for wild-type (WT) and MYB52 mutant lines, thus it can be seen that overexpression of the MYB52 gene can significantly improve salt tolerance of tomatoes.
In addition, the measurement results of the maximum photochemical efficiency of the photosystem II (PS II) of tomato plants are shown in FIG. 8. The maximum photochemical efficiency Fv/Fm of PS II is the most basic parameter in chlorophyll fluorescence parameters, and reflects the potential maximum photosynthetic capacity of plants, and is an effective index for measuring the photoinhibition degree. Plant leaves Fv/Fm which are not subjected to stress and which have been sufficiently dark adapted are generally constant between 0.70 and 0.85. And after the plant leaves suffer from the adversity stress, the Fv/Fm of the plant leaves has a obviously reduced trend, and the Fv/Fm is the optimal index for measuring the adversity stress. The results show that under normal conditions (a control group without salt stress), the Fv/Fm of the plant leaves of the three materials of WT, MYB52-OE and MYB52 are about 0.81 without obvious difference; whereas salt stress caused a significant decrease in Fv/Fm of wild-type tomato (WT) leaf from 0.81 to 0.53; salt stress makes the Fv/Fm reduction of the myb52 mutant plant leaf blade most obvious, and the Fv/Fm reduction is reduced from 0.81 to 0.26; however, the Fv/Fm reduction of leaf blades of MYB52-OE plants under salt stress is minimal, from 0.81 to 0.63; the maximum photochemical quantum yield (Fv/Fm) of leaf PSII of MYB52-OE plants under salt stress is significantly higher than that of wild-type tomato (WT), while the Fv/Fm in leaf of MYB52 mutant plants under salt stress is lowest. It follows that MYB52-OE plants are most tolerant to salt stress and have a light absorbing capacity closer to normal levels after being subjected to salt stress.
Next, using wild-type tomato seedlings (WT), slMYB gene over-expression strain (MYB 52-OE) obtained in example 3 and mutant strain (MYB 52) grown under the above-described normal conditions (salt-free stress treatment) for about 50d (10-12 leaf stage), the lateral bud phenotype was observed and photographed, and the lateral bud length and number were counted.
The physical shooting result of the growth condition of the lateral branches of the overground parts of tomatoes is shown as a graph in fig. 9A, the total length result of lateral buds is shown as a graph in fig. 9B, and the number result of single lateral buds is shown as a graph in fig. 9C. The result shows that SlMYB gene is involved in regulating and controlling the quantity and length of tomato lateral buds, and the quantity and length of the lateral buds of a MYB52-OE plant are obviously higher than those of a WT plant and a mutant MYB52 plant, and the mutant MYB52 plant has the shortest and least lateral buds.
In conclusion, slMYB gene has important value in the field of modern agriculture of tomatoes. For normal environmental breeding, tomato plants with SlMYB gene knocked out have higher plant heights and fewer lateral buds. The tomato planting process has the problems of more side branches, tedious pruning and branching and high labor cost. Therefore, tomato plants with SlMYB gene knocked out can reduce pruning and branching of tomatoes, and promote light and simplified cultivation. In addition, the MYB52-OE plant has the characteristic of dwarfing, and the dwarfing is an important link of the cultivation of the facility tomatoes at present, and the proper dwarfing can increase the illumination intensity, promote the growth and development of fruits and improve the yield. Therefore, tomato plants over-expressing SlMYB genes can promote tomato facility cultivation dwarf close planting. Aiming at the saline-alkali environment, the high salt has obvious stress on plants, so that the growth and development of overground parts and underground parts of crops are inhibited, biomass is reduced, and the yield is reduced, thereby causing great economic loss. The tomato over-expressed with SlMYB gene has the advantages that even if the tomato is subjected to salt stress, the growth of overground parts and root systems is more similar to the normal level, the leaf color is kept dark green, yellowing and falling phenomena are avoided, the root systems are long and lateral roots are more, the tomato is basically not inhibited, the reduction ratio of overground parts and root systems biomass is lowest, the reduction ratio of plant heights is lowest, more biomass can be accumulated under the salt stress, the tomato under the salt stress has the leaf conductivity and chlorophyll fluorescence capability which are more similar to the normal level in the saline-alkali environment, the salt stress resistance capability is more suitable for survival and cultivation under the saline-alkali environment, and high-quality germplasm resources are provided for tomato breeding on saline-alkali soil.

Claims (10)

  1. Use of slmyb52 in modulating salt stress resistance in tomatoes.
  2. Use of a 1) to a 3) in at least one of b 1) to b 4):
    a1 SlMYB52 protein;
    a2 A biological material associated with SlMYB proteins;
    a3 Agents that target up-regulate the amount of expression of SlMYB protein and/or enhance SlMYB protein activity;
    b1 Improving salt stress resistance of tomatoes;
    b2 Cultivating a tomato variety;
    b3 Preparing a product that increases salt stress resistance of tomatoes;
    b4 Preparing a product for cultivating tomato varieties.
  3. 3. The use according to claim 2, characterized in that:
    The biomaterial comprises at least one of c 1) to c 12):
    c1 Nucleic acid molecules encoding SlMYB proteins;
    c2 An expression cassette comprising c 1) said nucleic acid molecule;
    c3 A recombinant vector comprising c 1) said nucleic acid molecule;
    c4 A recombinant vector comprising the expression cassette of c 2);
    c5 A recombinant cell comprising c 1) said nucleic acid molecule;
    c6 A recombinant cell comprising the expression cassette of c 2);
    c7 A recombinant cell containing c 3) the recombinant vector;
    c8 A recombinant cell comprising c 4) said recombinant vector;
    c9 A recombinant microorganism comprising the nucleic acid molecule of c 1);
    c10 A recombinant microorganism comprising the expression cassette of c 2);
    c11 A recombinant microorganism comprising c 3) said recombinant vector;
    c12 A recombinant microorganism comprising c 4) said recombinant vector;
    the tomato variety comprises the following characteristics: salt stress resistance is increased.
  4. Use of a slmyb52 protein inhibitor in at least one of d 1) to d 4):
    d1 Reducing salt stress resistance of tomatoes;
    d2 Cultivating a tomato variety;
    d3 Preparing a product that reduces salt stress resistance of tomatoes;
    d4 Preparing a product for cultivating tomato varieties;
    The tomato variety comprises the following characteristics: salt stress resistance is reduced.
  5. 5. The use according to claim 4, characterized in that:
    the SlMYB protein inhibitor comprises at least one of a substance that inhibits SlMYB protein activity, a substance that degrades SlMYB protein, and a substance that reduces SlMYB protein expression levels.
  6. 6. The use according to claim 5, characterized in that:
    the substance that reduces SlMYB protein expression levels comprises at least one of e 1) to e 13):
    e1 siRNA, dsRNA, miRNA, ribozyme, shRNA, CRISPR/cas system targeting SlMYB proteins;
    e2 A nucleic acid molecule encoding e 1);
    e3 An expression cassette comprising e 2) said nucleic acid molecule;
    e4 A recombinant vector comprising e 2) said nucleic acid molecule;
    e5 A recombinant vector comprising e 3) said expression cassette;
    e6 A transgenic cell comprising e 2) said nucleic acid molecule;
    e7 A transgenic cell comprising e 3) said expression cassette;
    e8 A transgenic cell comprising e 4) the recombinant vector;
    e9 A transgenic cell comprising e 5) the recombinant vector;
    e10 A recombinant microorganism comprising e 2) said nucleic acid molecule;
    e11 A recombinant microorganism comprising e 3) said expression cassette;
    e12 A recombinant microorganism comprising e 4) said recombinant vector;
    e13 A recombinant microorganism comprising the recombinant vector of e 5).
  7. 7. The use according to claim 6, characterized in that:
    the SlMYB protein inhibitor comprises a CRISPR/Cas system that targets SlMYB protein, the CRISPR/Cas system comprising an sgRNA;
    the nucleotide sequence of the sgRNA is shown as SEQ ID NO: 3.
  8. 8. The use according to claim 7, characterized in that:
    The CRISPR/Cas system targeting SlMYB proteins further comprises a Cas protein and/or a biological material associated with a Cas protein; the biomaterial comprises: f1 At least one of) to f 12): f1 A nucleic acid molecule encoding a Cas protein; f2 An expression cassette comprising f 1) said nucleic acid molecule; f3 A recombinant vector comprising f 1) said nucleic acid molecule; f4 A recombinant vector comprising f 2) said expression cassette; f5 A transgenic cell comprising f 1) the nucleic acid molecule; f6 A transgenic cell comprising f 2) said expression cassette; f7 A transgenic cell comprising f 3) the vector; f8 A transgenic cell comprising f 4) the vector; f9 A recombinant microorganism comprising the nucleic acid molecule of f 1); f10 A recombinant microorganism comprising the expression cassette of f 2); f11 A recombinant microorganism containing the recombinant vector of f 3); f12 A recombinant microorganism comprising f 4) said recombinant vector;
    The Cas protein comprises a Cas9 protein.
  9. 9. A method, comprising: a step of reducing the expression level and/or activity of SlMYB protein in tomato;
    the method is at least one of g 1) to g 2): g1 A method of reducing salt stress resistance of a tomato of a plant; g2 A method for cultivating tomato varieties;
    the tomato variety comprises the following characteristics: reduced salt stress resistance;
    the tomato variety comprises the following characteristics: salt stress resistance is reduced relative to a reference level; the reference level is a wild-type level;
    the step of reducing the expression quantity and/or activity of SlMYB protein in tomato is to introduce at least one of h 1) to h 3) into tomato tissue and/or tomato cells;
    h1 The sgRNA of claim 7; h2 A biological material of the sgRNA of claim 8; h3 The CRISPR/Cas system of claim 8;
    the mode of introduction includes at least one of Ti plasmid, ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation.
  10. 10. A method, comprising: a step of increasing the expression level and/or activity of SlMYB protein in tomato;
    the method comprises at least one of i 1) to i 2): i1 A method of increasing salt stress resistance of tomato; i2 A method for cultivating tomato varieties;
    the tomato variety comprises the following characteristics: salt stress resistance is improved;
    The tomato variety comprises the following characteristics: salt stress resistance is increased relative to a reference level; the reference level is a wild-type level;
    The step of increasing the expression level and/or activity of SlMYB protein in tomato is to introduce a nucleic acid molecule encoding SlMYB protein into tomato tissue or tomato cells.
CN202410302607.9A 2024-03-18 2024-03-18 Application of SlMYB gene in improving salt stress resistance of tomatoes Active CN117904142B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202410302607.9A CN117904142B (en) 2024-03-18 2024-03-18 Application of SlMYB gene in improving salt stress resistance of tomatoes

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202410302607.9A CN117904142B (en) 2024-03-18 2024-03-18 Application of SlMYB gene in improving salt stress resistance of tomatoes

Publications (2)

Publication Number Publication Date
CN117904142A true CN117904142A (en) 2024-04-19
CN117904142B CN117904142B (en) 2024-06-25

Family

ID=90690885

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202410302607.9A Active CN117904142B (en) 2024-03-18 2024-03-18 Application of SlMYB gene in improving salt stress resistance of tomatoes

Country Status (1)

Country Link
CN (1) CN117904142B (en)

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109777811A (en) * 2019-01-30 2019-05-21 浙江大学 Tomato SlMYB0 gene and its application in raising plant frigostabile
CN112143746A (en) * 2020-09-30 2020-12-29 南京农业大学 Gene GmAP5 for improving disease resistance of plants and application thereof
US20230079816A1 (en) * 2020-02-12 2023-03-16 Pioneer Hi-Bred International, Inc. Cas-mediated homology directed repair in somatic plant tissue
CN116120416A (en) * 2023-02-23 2023-05-16 北京农学院 SlWRKY57 gene and application of coding protein thereof in regulation and control of salt tolerance of tomatoes
US20230175002A1 (en) * 2020-04-03 2023-06-08 The Regents Of The University Of California Suberin biosynthetic genes and regulators
US20230270073A1 (en) * 2022-02-25 2023-08-31 Benson Hill, Inc. Compositions and methods comprising plants with modified anthocyanin content
CN116731143A (en) * 2023-08-03 2023-09-12 浙江大学海南研究院 Application of tomato ERF17 gene in regulation and control of plant insect resistance
WO2023194291A1 (en) * 2022-04-06 2023-10-12 Syngenta Crop Protection Ag Plants with improved pathogen resistance
CN117088957A (en) * 2023-10-17 2023-11-21 山东省烟台市农业科学研究院(山东省农业科学院烟台市分院) Application of tomato SlMYB13 protein and encoding gene thereof in regulation and control of salt tolerance and drought tolerance of plants
CN117106820A (en) * 2023-09-25 2023-11-24 东北农业大学 Method for creating few lateral branches of tomatoes through genome editing and application of method

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109777811A (en) * 2019-01-30 2019-05-21 浙江大学 Tomato SlMYB0 gene and its application in raising plant frigostabile
US20230079816A1 (en) * 2020-02-12 2023-03-16 Pioneer Hi-Bred International, Inc. Cas-mediated homology directed repair in somatic plant tissue
US20230175002A1 (en) * 2020-04-03 2023-06-08 The Regents Of The University Of California Suberin biosynthetic genes and regulators
CN112143746A (en) * 2020-09-30 2020-12-29 南京农业大学 Gene GmAP5 for improving disease resistance of plants and application thereof
US20230270073A1 (en) * 2022-02-25 2023-08-31 Benson Hill, Inc. Compositions and methods comprising plants with modified anthocyanin content
WO2023194291A1 (en) * 2022-04-06 2023-10-12 Syngenta Crop Protection Ag Plants with improved pathogen resistance
CN116120416A (en) * 2023-02-23 2023-05-16 北京农学院 SlWRKY57 gene and application of coding protein thereof in regulation and control of salt tolerance of tomatoes
CN116731143A (en) * 2023-08-03 2023-09-12 浙江大学海南研究院 Application of tomato ERF17 gene in regulation and control of plant insect resistance
CN117106820A (en) * 2023-09-25 2023-11-24 东北农业大学 Method for creating few lateral branches of tomatoes through genome editing and application of method
CN117088957A (en) * 2023-10-17 2023-11-21 山东省烟台市农业科学研究院(山东省农业科学院烟台市分院) Application of tomato SlMYB13 protein and encoding gene thereof in regulation and control of salt tolerance and drought tolerance of plants

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
MUHAMMAD ANWAR等: "Recent Advanced Metabolic and Genetic Engineering of Phenylpropanoid Biosynthetic Pathways", INT J MOL SCI, vol. 22, no. 17, 30 September 2021 (2021-09-30), pages 1 - 22 *
PANPAN ZHAO等: "Genome-wide identification and characterization of R2R3MYB family in Solanum lycopersicum", MOL GENET GENOMICS, vol. 286, no. 06, 10 July 2014 (2014-07-10), pages 1183 - 1207 *
YUJIN YUAN等: "R2R3 MYB-dependent auxin signalling regulates trichome formation, and increased trichome density confers spider mite tolerance on tomato", PLANT BIOTECHNOL J, vol. 19, no. 01, 31 January 2021 (2021-01-31), pages 138 - 152 *
ZHENJUN LI等: "Genome-Wide Identification and Analysis of the MYB Transcription Factor Superfamily in Solanum lycopersicum", PLANT AND CELL PHYSIOLOGY, vol. 57, no. 08, 31 August 2016 (2016-08-31), pages 1657 - 1677 *
曹翔等: "植物转录因子MYB基因家族研究进展", 河南农业, no. 24, 25 August 2020 (2020-08-25), pages 41 - 43 *
杨晶婷等: "MYB类转录因子调控植物耐逆机制的研究进展", 杭州师范大学学报(自然科学版), vol. 20, no. 06, 30 November 2021 (2021-11-30), pages 621 - 627 *
陈丽萍等: "植物抗旱耐盐基因的研究进展", 基因组学与应用生物学, vol. 29, no. 03, 28 June 2010 (2010-06-28), pages 542 - 549 *

Also Published As

Publication number Publication date
CN117904142B (en) 2024-06-25

Similar Documents

Publication Publication Date Title
CN111748556A (en) Application of SlmiR319b in regulation and control of tomato plant type, recombinant plasmid, recombinant strain and transgenic strain
CN105294847A (en) Stress tolerance-related protein of plants and encoding gene and application of stress tolerance-related protein
WO2022227102A1 (en) METHOD FOR IMPROVING PLANT STRESS RESISTANCE AND YIELD BY HETEROLOGOUS SYNTHESIS OF γ-POLYGLUTAMIC ACID IN PLANT
Saravanan et al. Genetic engineering of sugarcane for drought and salt tolerant transgenic plants expressing the BcZAT12 gene
CN110358772A (en) The OsEBP89 gene and preparation method of raising rice abiotic stress resistance and application
CN106591324A (en) Millet siasr4 gene and application
CN116589545A (en) Application of ONAC096 gene in controlling drought resistance of rice
CN117904142B (en) Application of SlMYB gene in improving salt stress resistance of tomatoes
CN106191059B (en) Capsella bursa-pastoris peroxidase gene promoter and application thereof in improving cold resistance of plants
CN115896045A (en) Application of birch pear E3 ubiquitin ligase gene PbrATL18 in genetic improvement of plant drought resistance and anthracnose
CN104673803A (en) Application of gene methylation in gene expression regulation
CN113604475B (en) Application of cotton GH_D03G1517 gene in promotion of drought resistance and salt tolerance
CN104945493B (en) A kind of soybean protein GmIDD influencing plant growth period and its encoding gene and application
CN117821499B (en) Biological material for regulating expression of TaWRKY24 protein coding gene and application thereof
CN113249394B (en) Application of receptor-like kinase gene MdMRLK2 in improving plant water utilization efficiency
KR102633473B1 (en) SIPRR2-2 gene and Method for improving the resistance to the drought and salt stresses using SIPRR2-2 in plants
KR102633465B1 (en) SIPRR2-1 gene and Method for improving the resistance to the drought and salt stresses using SIPRR2-1 in plants
CN117603993B (en) Application of tobacco NtDUF868-E5 gene in drought resistance of tobacco
KR102051453B1 (en) Expression vector and process for enhancing biomass of plants by using suppression of PagSAP11 gene
CN116396968A (en) Duck grass tillering related gene and application thereof
CN117305316A (en) Application of OsRSS1 gene in rice salt stress tolerance
Shah et al. Morphological analysis of cold-tolerant tomato (Solanum lycopersicum Mill.) plants expressing CBF3 gene
CN102888409B (en) Eucalyptus PGEF 10 gene and plant expression vector, host cell and application thereof
CN117947061A (en) Tomato SlLOX protein, coding gene and application of cis-3-hexenol in improving low temperature resistance of tomatoes
CN115725599A (en) Soybean NAC transcription factor gene and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant