CN116396968A

CN116396968A - Duck grass tillering related gene and application thereof

Info

Publication number: CN116396968A
Application number: CN202310033134.2A
Authority: CN
Inventors: 张新全; 许肖恒; 冯光燕; 王成; 焦永娟; 杨忠富; 李丹丹
Original assignee: Sichuan Agricultural University
Current assignee: Sichuan Agricultural University
Priority date: 2023-01-10
Filing date: 2023-01-10
Publication date: 2023-07-07

Abstract

The invention discloses a cogongrass tillering related gene and application thereof, and relates to the field of plant genetic engineering. The gene provided by the invention is DgCCD7-1, the nucleotide sequence of the gene is shown as SEQ ID NO.3, and the amino acid sequence of the encoded protein is shown as SEQ ID NO. 4. The over-expression vector of the gene is transferred into arabidopsis thaliana, so that the tillering capacity of the arabidopsis thaliana is reduced, the gene is prompted to have a regulation function on tillering, on the basis of the characteristics, dgCCD7-1 is silenced or knocked out in festuca arundinacea by using a transgenic technology, the tillering capacity and the reproductive capacity of the festuca arundinacea can be pertinently improved, the breeding time is shortened, the breeding efficiency is improved, and the development and the utilization of high-quality gramineous forage grass festuca arundinacea are promoted.

Description

Duck grass tillering related gene and application thereof

Technical Field

The invention relates to the field of plant genetic engineering, in particular to a cogongrass tillering related gene and application thereof.

Background

In order to achieve self-sufficiency of domestic forage grass, grazing scientists have been striving to cultivate high-yield and high-quality forage grass to meet the requirements of high-yield animal husbandry, so that the dilemma of dependence on foreign forage grass is gradually moved out. Gramineous forage grass has high carbohydrate content, and the yield of single plants is better than that of leguminous plants, so that the gramineous forage grass is widely used for fresh feeding and mixed silage and plays an important role in forage grass. Although the single plant yield of gramineous pasture is better than that of leguminous plants, under the current situation of lack of land, the yield per unit area is still difficult to meet the requirements of animal husbandry. At present, grass breeders mainly use the single-yield potential of gramineous high-quality grass to rapidly select and breed new high-yield high-quality forage grass varieties. The tillering capability is one of the important determinants of gramineous pasture yield and also one of the important determinants of single yield potential, and is always paid attention by scientists.

The genus Duck grass (Dactylisoxyla L.) is also known as orchard grass (Orchardglass), belonging to the subfamily Poaceae (Festuccoideae) Duck grass (Dactylis), which is a perennial cold season type cluster pasture widely cultivated worldwide. The festuca arundinacea has the characteristics of high growth speed, high biological yield, high sugar content, high shade resistance, wide application range and the like. As perennial pasture with the top four ranks of economic values, the festuca arundinacea has important significance for producing herbivorous animal meat and dairy products in temperate regions of the world. Besides being used as excellent pasture, the festuca arundinacea is also one of important excellent mixed sowing grasses in the grasslands and the artificial grasslands under the forests in China, is mainly suitable for western cultivation returning grass and grassland construction, and has important positive significance for cultivation returning grass and forest-grass composite construction and the like. Therefore, by changing the tillering control gene of the cogongrass, the tillering capacity of the cogongrass is improved, high-yield and high-quality varieties are cultivated, and higher yield is obtained on limited land, so that the problems of land shortage and forage gaps in China are solved.

The strigolactone is a novel plant hormone and plays an important role in inhibiting plant tillering. CCD7 is one of important genes in the synthesis of strigolactone, and the research of DgCCD7 genes in festuca arundinacea is still in a blank state so far. Therefore, the function of DgCCD7 in the festuca arundinacea is verified, and the festuca arundinacea is improved accordingly, so that the festuca arundinacea has important theoretical and application values for improving the tillering capacity and yield of the festuca arundinacea.

Disclosure of Invention

The invention aims to provide a cogongrass tillering related gene and application thereof, wherein the gene is the cogongrass DgCCD7-1 gene, researches show that the gene is overexpressed in arabidopsis thaliana, the tillering capacity of the arabidopsis thaliana is reduced, the gene is prompted to have a regulation function on tillering, and the characteristic of improving the cogongrass has important theory and application value for improving the tillering capacity and yield of the cogongrass.

In order to achieve the aim, the invention provides a cogongrass tillering related gene, which is DgCCD7-1, the nucleotide sequence of the gene is shown as SEQ ID NO.3, the gene has a regulation and control effect on tillering of arabidopsis, and the gene expression can reduce the tillering capacity of arabidopsis; the amino acid sequence of the protein coded by the gene is shown as SEQ ID NO. 4.

The invention also provides a recombinant vector containing the cogongrass tillering related gene, and the gene is DgCCD7-1.

Preferably, the recombinant vector adopts pCAMBIA1300-35S.

The invention also provides a recombinant bacterium containing the recombinant vector.

Preferably, the recombinant bacterium described above employs Agrobacterium tumefaciens GV3101.

The invention also provides application of the cogongrass tillering related gene DgCCD7-1, which comprises a duck Mao Zhu line for creating multiple tillers or an Arabidopsis line for creating multiple branches.

The invention provides a gene DgCCD7-1 related to tillering of cogongrass, which firstly discloses a tillering regulating gene in cogongrass, and defines the function of the gene, and has the following advantages:

aiming at the defects of slow effect and long period of the traditional forage grass improvement technology, the DgCCD7-1 is silenced or knocked out in the festuca arundinacea by utilizing the transgenic technology, so that the tillering capacity and the reproductive capacity of the festuca arundinacea can be pertinently improved, the breeding time is shortened, the breeding efficiency is improved, and the development and the utilization of the high-quality gramineous forage grass festuca arundinacea are promoted.

Drawings

FIG. 1 shows the result of the clone electrophoresis identification of DgCCD7-1 gene in the present invention.

FIG. 2 shows the expression of DgCCD7-1 gene in different tissues.

FIG. 3 shows the PCR identification result of colony after transformation of recombinant plasmid with DgCCD7-1 gene over-expression in the present invention.

FIG. 4 shows PCR identification results of Arabidopsis positive plants over-expressed by DgCCD7-1 gene in the invention.

FIG. 5 shows the result of comparing seedling stage phenotypes of Arabidopsis and wild type Arabidopsis over-expressed by DgCCD7-1 gene of the present invention.

FIG. 6 shows the phenotype comparison result of the DgCCD7-1 gene over-expressed Arabidopsis and wild Arabidopsis in the bolting period.

Detailed Description

The following description of the technical solutions in the embodiments of the present invention will be clear and complete, and it is obvious that the described embodiments are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Description: the reagents used in the experimental examples are all conventional reagents in the field if not described; the techniques and procedures used are not specifically described and are conventional in the art.

Experimental example 1 acquisition of DgCCD7-1 Gene

1. Preparation of experimental materials

The material selected in the experiment is a festuca arundinacea variety D20170203', which is planted in the Wenjiang school area of Sichuan agricultural university. Taking tender stem base as material to extract total RNA. The total RNA extraction kit of plant of Tiangen (Beijing) Biochemical technology Co., ltd is selected for RNA extraction, and the operation is carried out by referring to the attached instruction book.

After RNA extraction, the integrity detection is carried out by using 1% agarose gel electrophoresis, the concentration and purity of the RNA are measured by using an ultra-micro spectrophotometer, and then the reverse transcription is carried out on the extracted RNA by using PrimeScript II 1st Strand cDNA Synthesis Kit (TaKaRa), and the operation flow is referred to an attached instruction book, so that the whole genome cDNA of the experimental material is obtained.

2. Amplification of target Gene

The reference genome of the cogongrass of V1.1 version is taken as a template, the CCD7 gene in the cogongrass and the blast of rice and other species are obtained at the position in the genome, so that the sequence of the gene in the cogongrass is extracted, the amplification primers comprising an upstream primer F and a downstream primer R are designed through the whole length of the sequence, the nucleotide sequences of the primers are respectively shown as follows, the designed primers are used for carrying out PCR amplification on the extracted cDNA, and the amplification kit is a PrimeSTAR Max DNAPolymerase (TaKaRa) kit, and the specific operation is carried out by referring to the attached instruction book.

The primers designed are shown below (5 '. Fwdarw.3'):

F(SEQ ID NO.1)：ATGGCGATATGCGCGATC；

R(SEQ ID NO.2)：TCATTCATCAGCCCAGAAGCC。

the PCR amplification system is shown in the following Table 1, and the amplification reaction conditions are: pre-denaturation at 95℃for 3min; denaturation at 95℃for 30s, annealing at 60℃for 15s, extension at 72℃for 2min,35 cycles; the operation was carried out at 72℃for 10min. The amplified PCR products were electrophoretically detected on a 0.8% agarose gel, the result of which is shown in FIG. 1, wherein M is DNA ladder, and

lanes

1 and 2 are duplicate samples of the amplified products.

TABLE 1PCR amplification System

TA cloning

The gel block of the gel electrophoresis is placed under an ultraviolet lamp, the amplified band is cut, and the target fragment is recovered and purified by MiniBESTAgarose Gel DNA Extraction Kit (TaKaRa), and the specific operation is referred to in the attached specification. mu.L of the above-mentioned recovered DNA Solution was taken, 1. Mu.L of pMD19-T vector and 5. Mu.L of Solution (containing ligase) were added and mixed, and reacted at 16℃for 30 minutes. After completion of the reaction, the reaction product was added to 100. Mu.L of DH 5. Alpha. Competent cells, and after 30 minutes in an ice bath, it was heated at 42℃for 45s and left on ice for 2 minutes. 800. Mu.L of LB medium was added to the transformed competent cells, and the mixture was incubated at 37℃for 60 minutes, and the mixture was spread on an LB medium plate containing ampicillin (Amp) and incubated at 37℃upside down. Single colony on the plate after culture is selected for culture, and the cultured bacterial liquid is sent to a company for sequencing, and the sequencing primer is a universal sequencing primer M13 of a pMD19-T vector to verify whether cloning is successful.

The gene was successfully amplified by sequencing and the nucleotide sequence of the gene was shown below, and the gene was designated as DgCCD7-1.

The nucleotide sequence of the DgCCD7-1 gene (SEQ ID NO. 3) is as follows (5 '. Fwdarw.3'):

ATGGCGATATGCGCGATCGCAACAACGCACGCCGCCGTGCACCACCGTCACCATCCTCTCCTCCCCGTCCCACCGCCAGCACCGCGCCACCGCGTCCGCATCGTCGTCCGCGGGACGGCCGGCACCACCGCCGCGGCGGTGACGTCCGAGCCGGACACGATGTCCAATGCCTTTTGGGACTACAACCTCCTCTTCCGGTCGCAGCGCGCCGAGACGTCAGACCCCGTGCAGCTCCGCGTCGTCGAGGGCGCGATGCCGGCGGACTTCCCGGCGGGCACCTACTACCTCGCCGGGCCCGGCATGTTTTCCGACGACCACGGCTCCATCGTCCACCCCCTCGACGGCCACGGCTACCTCCGCTCCTTCCGGTTCCACCCCAACCACGGCGTCCACTACTCCGCACGGTACGTGGAGACGGCGGCGAAGAGCGAGGAGAAAGGGGACGGGGCGTCGTGGAGGTTCACGCACCGTGGCCCCTTCTCGGTGCTGCAGGGCGGGCACAGGGTGGGCAACGTGAAGGTGATGAAGAACGTGGCCAACACGAGCGTGCTCTGGTGGGGCGGCCGGCTGCTCTGCCTCTGGGAGGGCGGCATGCCGTACGAGCTCGACCCCAACACGCTGGACACCATCGGCCCCTTCGACCTGCTCGGGTTCGCCGACGAGGCTGCAGCGGCAGCACATGGTCGGGTGGCTGCACGGCGGTGGCAGCGGCGGCCGTGGCCGGTGGAGGCCGCGCTCGACGTGGCCACCCGCCTGCTGCGCCCAGTTCTCAGTGGCGTGTTCAGCATGCCGCCCAAGCGGCTCCTGGCGCACTACAAGGTCGACCCGAAGCGGAACCGGCTGCTCATGGTGGCCTGCAACGCCGAGGACATGCTCCTCCCGCGAGCCAACTTCACTTTCTACGAGTTCGACGCCGGCTTCGGGCTGGTGCAGAAGCGGGAGTTCGTGCTGCCGGCGCACCTCATGATCCACGACTGGGCGTTCACCGACTCCCACTACGTCGTCCTCGGCAACAGGATCAAGCTCGACATCCCCGGGTCGATGATGGCGATGACGGGCACCTACCCGATGATAGGGGCGCTGCAGCTGGACCCGAGCAAGGAGACGACGCCGGTCTACCTGCTGCCGCGCTCCACGGAGGCCGTGGCGAGCGGCCGCGACTGGACCATGCCCGTGGAGGCGCCGGCGCAGATGTGGTCGATGCACGTGGGCAACGCCTTCGAGGAGGACCTCGGCCGCGGTGGCACGGACATACGGCTGCACATGTCGGGCTGCTCTTACGACTGGTTCCACTTCCACAGAATGTTTGGTTACAATTGGAAGAACAAGAAGCTGGACCCTTCGTTCATGAACGCGGCCAAGGGGAAGGAACTGCTGCCTCGCCTCGTGCAGGTGGCAATTGAGCTTGACAAGAGAGGAGCATGCCGAAGATGCTCTGTGAAGAGAATGTCCCATCAGTGGAACAAACCTGCAGACTTCCCAGCGATAAACCCAACCTTTGCCAACAAGAGGAGCAGGTTCATCTATGCAGGCGGGTCATCCGGTTCGCGCAAATTCCTTCCGTATTTTCCATTTGACAGCATCGTGAAGGTCGACGTCTCCGATGGGACAGCGAGGCGGTGGTCTTGTGAGGGGCGCAAGTTCGTCGGGGAGCCGGTCTTCATCCCGACCGGTGGTGGGGAGGATCATGGCTATGTTATTCTTGTAGAGTATGCAGTATCTGAAGACAGGTGCAACCTGGTGGTGTTGGATGCAAGAAAAATAGGCAAAAGAAGTGCACTTGTGGCAAAACTTGCGGTTCCAAAGAACCTCACATTCCCAATGGGATTCCATGGCTTCTGGGCTGATGAATGA。

the amino acid sequence (SEQ ID NO. 4) of the protein expressed by the DgCCD7-1 gene is shown as follows:

MAICAIATTHAAVHHRHHPLLPVPPPAPRHRVRIVVRGTAGTTAAAVTSEPDTMSNAFWDYNLLFRSQRAETSDPVQLRVVEGAMPADFPAGTYYLAGPGMFSDDHGSIVHPLDGHGYLRSFRFHPNHGVHYSARYVETAAKSEEKGDGASWRFTHRGPFSVLQGGHRVGNVKVMKNVANTSVLWWGGRLLCLWEGGMPYELDPNTLDTIGPFDLLGFADEAAAAAHGRVAARRWQRRPWPVEAALDVATRLLRPVLSGVFSMPPKRLLAHYKVDPKRNRLLMVACNAEDMLLPRANFTFYEFDAGFGLVQKREFVLPAHLMIHDWAFTDSHYVVLGNRIKLDIPGSMMAMTGTYPMIGALQLDPSKETTPVYLLPRSTEAVASGRDWTMPVEAPAQMWSMHVGNAFEEDLGRGGTDIRLHMSGCSYDWFHFHRMFGYNWKNKKLDPSFMNAAKGKELLPRLVQVAIELDKRGACRRCSVKRMSHQWNKPADFPAINPTFANKRSRFIYAGGSSGSRKFLPYFPFDSIVKVDVSDGTARRWSCEGRKFVGEPVFIPTGGGEDHGYVILVEYAVSEDRCNLVVLDARKIGKRSALVAKLAVPKNLTFPMGFHGFWADE。

experimental example 2DgCCD7-1 Gene functional analysis

1. The gene expresses in different tissues of festuca arundinacea

45 single tillered festuca arundinacea plants 'D20170203' with similar sizes and shapes are planted in quartz sand, randomly divided into three groups of 15 repeats each, and quantitative Hoagland nutrient solution is applied to the single tillered festuca arundinacea plants every day to ensure sufficient nutrient supply. All plants were grown in growth chambers with growth conditions of light for 14 hours at 22℃and darkness for 10 hours at 15℃and relative humidity of 70%. When the new tillered shoots grow to 0.5cm, four tissues of shoot (B), shoot (S), root (R) and leaf (L) in each group are collected simultaneously, a mixed sample of each tissue in the same group is taken as 1 biological repetition, and 3 materials in 3 groups are collected in total. The collected tissue sample is immediately frozen by liquid nitrogen and then transferred into a refrigerator at the temperature of minus 80 ℃ for standby. The expression of the DgCCD7-1 gene was detected by qRT-PCR. The expression of DgCCD7-1 gene in different tissues is shown in FIG. 2, and it is known that DgCCD7-1 is expressed in the highest amount in duck Mao Jingji.

2. Construction of an over-expression recombinant vector

Firstly amplifying a target gene DgCCD7-1 in experimental example 1, designing an amplification primer by taking EcoRI and BamHI as insertion sites according to a map of a vector pCAMBIA1300-35S, synthesizing the primer, and carrying out PCR by taking a single colony with correct sequencing verification in experimental example 1 as a template, wherein the nucleotide sequence of the synthesized amplification primer is shown as the following (5 '. Fwdarw.3');

upstream primer P71-F (SEQ ID NO. 5):

CGGGGATCCTCTAGAGTCGACATGGCGATATGCGCGATC；

downstream primer P1254-R (SEQ ID NO. 6):

AATGTTTGAACGATCCTGCAGTCATTCATCAGCCCAGAAGCC。

wherein, the PCR amplification uses high-fidelity enzyme, and the amplification reaction system is shown in the following table 2:

TABLE 2PCR amplification System

The PCR reaction procedure is pre-denaturation at 95 ℃ for 3min; denaturation at 95℃for 30s, annealing at 60℃for 30s, extension at 72℃for 2min,35 cycles; extending at 72℃for 5min. The PCR products were electrophoresed in a 1.8% agarose gel at a voltage of 150V for 15min, the electrophoresis results were recorded by photography, and the target bands were cut off rapidly by observation under an ultraviolet lamp. The target fragment is recovered by using a gel recovery kit (OMEGA), the specific method is carried out according to the specification of the kit, the target gene sequence containing EcoRI and BamHI enzyme cutting sites is obtained, and the target gene sequence is connected with a vector pCAMBIA1300-35S which is subjected to double enzyme cutting by EcoRI and BamHI in vitro, so as to construct a recombinant vector containing DgCCD7-1 genes, and the connection system is shown in the following table 3:

TABLE 3 ligation System for recombinant plasmids

1. The conversion of the ligation product is carried out as follows:

a. sterilizing with ultra-clean bench for 30min, taking out 100 μl of competent cells from-70deg.C ultra-low temperature refrigerator, placing on ice, and pre-cooling for 10min.

b. One EP tube, labeled, was removed, placed on ice and 80. Mu.L of DH 5. Alpha. Competent cells were added (ice working).

c. Adding 10 mu L of the connection product, sucking and beating by a pipetting gun, and then uniformly mixing, and carrying out ice bath for 30min;

d. after ice bath is finished, placing the ice bath into a constant-temperature water bath kettle at 42 ℃ for heat shock for 90 seconds, and then rapidly placing the ice bath kettle into ice cubes for 2 minutes;

e. mu.L of the extract containing no Kan ⁺ Placing the LB liquid culture solution in an EP tube, uniformly mixing, and shaking in a shaking table at 160rpm/min and 37 ℃ for 1h;

f. taking out the EP tube ending in the shaking table, centrifuging at 2000-3000 rpm/min for 5min, discarding 300 μl of supernatant, gently sucking the rest bacterial liquid, beating, mixing, and adding into a liquid containing Kan ⁺ Uniformly coating the LB solid culture dish with a glass coating rod, and drying; culturing in a constant temperature incubator at 37 ℃ for 16-20h。

The colony PCR identification is carried out by randomly selecting 10 single clones in a culture dish, the nucleotide sequences of the used primers (D-F and D-R) are shown as follows, the colony PCR identification result is shown as figure 3, wherein M is DNAlader, lanes 1-10 are respectively the bacterial liquid PCR results of 10 single clones, the selected single colonies are positive colonies, any one of the selected single colonies is selected for culture, and the plasmid is extracted and then stored at-80 ℃.

Wherein, the primers for colony identification are shown as follows (5 '. Fwdarw.3');

D-F(SEQ ID NO.7):ATGGCGATATGCGCGATCGC；

D-R(SEQ ID NO.8):AGCACGCTCGTGTTGGCCAC。

the PCR amplification system for colony identification is shown in Table 4 below, and the PCR reaction procedure is: pre-denaturation at 98 ℃ for 5min; cycles of denaturation at 98℃for 10s, annealing at 55℃for 30s, elongation at 72℃for 1min,35 cycles; extending at 72℃for 5min.

TABLE 4 amplification reaction System

2. Transformation of Arabidopsis thaliana

(1) Agrobacterium transformation: the agrobacteria GV3101 are taken out from the refrigerator at the temperature of 80 ℃ below zero, the agrobacteria GV3101 are thawed on ice for 2min,3 to 5 mu L of recombinant plasmid extracted from the colony successfully identified is added, and the recombinant plasmid is placed on ice for 5min. The EP tube was placed in liquid nitrogen for quick freezing for 1min, water bath at 37℃for 5min, ice bath for 2min, 800. Mu.L of liquid LB medium without resistance was added, and the culture was carried out for 3h at 28℃with shaking table at 150 rpm/min. Centrifuging at 8000rpm/min for 1min, removing 600 μl of supernatant, suspending, and applying to solid LB medium (containing 50 μg/mL Kan) ⁺ And 50. Mu.g/mL rifampicin), the incubator was inverted incubated at 28℃for 48h. The monoclonal was picked.

(2) Planting arabidopsis thaliana: the vermiculite matched matrix (2:1) with good water absorption and loose soil quality is selected as the arabidopsis planting soil. Flower pots with the diameter of 9cm are selected, and 50-100 pots are sown in each pot. Watering and coating after sowing, and providing a moist environment for the growth of plants. The growth condition of the Arabidopsis thaliana room is that the illumination intensity is 2000-3000lx, the illumination time is 14h/day, and the humidity is 40-60%.

(3) Transplanting: sowing for 10-15 days, and transplanting after the arabidopsis seedlings grow to four leaves, wherein each pot is 4-5 plants.

(4) Removing the top: after transplanting, water is poured every 3 days, nutrient solution is added every two weeks, and after about 25-30 days, buds are cut off when the arabidopsis is flowering for the first time, so that the proliferation of more flowers and branches of the side branches can be promoted. Flowers suitable for transformation of plants are not mature nor produce fertilized fruits.

(5) Preparing a soaking dye solution: the agrobacteria were resuspended in 5% sucrose solution to od=0.8 and the sucrose solution was ready for use without sterilization. 100-200mL of the plant is impregnated with 2-3 small basin plants, 400-500mL of the plant is impregnated with 2-3 flowerpot (9 cm). The surfactant silwet-77 was added to a concentration of 0.05% (500. Mu.L/L) prior to padding.

(6) Dip dyeing: the flower surface portion of the flowering phase Arabidopsis thaliana was immersed in the Agrobacterium suspension for 20-30s while gently rotating.

(7) Dark culture: and (5) bagging the plant subjected to dip dyeing, and culturing for 24 hours in a dark room with a high humidity state.

(8) Culturing after dip dyeing: watering every other day to ensure sufficient water.

(9) Seed collection: the seeds are ripe, and the seeds can be harvested after the fruits are naturally cracked.

(10) Transgenic seed selection: the seed obtained after the dip-dyeing is cultivated on a plate containing hygromycin antibiotics. About 200 seeds of 40mg were vernalized on 0.5 XMS medium containing 10-50. Mu.g/mL hygromycin for 2 days, followed by cultivation under continuous light conditions for 7-10 days. Judging whether the seed is a transgenic seed according to the growth condition. Seeds successfully transferred into the recombinant plasmid can normally grow more than 4 true leaves on the resistant culture. Non-transgenic seeds cannot grow normally, only 2 cotyledons can grow, and root growth is also severely inhibited, and death usually occurs after 10 days of germination.

(11) Transgenic plant soil-shifting cultivation: transgenic seed in MS ⁺ Hygromycin platesAfter germination for 2 weeks, the positive plants are transferred into soil for continuous culture. The specific method comprises the following steps: positive plant leaves were taken for genomic DNA extraction and PCR validation was performed using the amplification primers described above (SEQ ID No.7 and SEQ ID No. 8). Randomly selecting 5 positive plants obtained in the above way for PCR identification, wherein the identification results are shown in figure 4, and lanes Oc-1, oc-2, oc-3, oc-4 and Oc-5 are respectively 5 positive plants; the plasmid is the over-expression positive plasmid constructed above; blank is empty plasmid; the wild type is a wild type plant without transforming over-expression plasmid, and the constructed positive plant is reliable.

And (3) continuously planting the positive plants successfully identified for 3 generations to obtain T3 seeds, and respectively tillering and counting the arabidopsis transgenic plants and the non-transgenic wild arabidopsis plants when the T3 transgenic plants grow to the bolting period, wherein the phenotype comparison result of the seedling period is shown in figure 5, the first row of 'WT-max3' is three repeated plants of the wild arabidopsis, and the second row is three repeated plants over-expressed with 'DgCCD 7-1'. The result shows that compared with the wild type Arabidopsis control, the tillering capacity of the Arabidopsis strain transformed with the DgCCD7-1 gene obtained by the research is obviously lower than that of the wild type Arabidopsis control. The phenotype comparison results of the arabidopsis and wild arabidopsis over-expressed by the DgCCD7-1 gene in the bolting stage are shown in figure 6, which shows that the expression of the DgCCD7-1 gene of the festuca arundinacea can inhibit the tillering capability of plants, especially arabidopsis, and can be predicted to obtain, silence or knock out the gene to create multi-branched arabidopsis plants.

On the whole, the gene DgCCD7-1 has a regulation and control effect on tillering, and on the basis of the characteristic, the DgCCD7-1 is silenced or knocked out in the festuca arundinacea by utilizing a transgenic technology, so that the tillering capacity and reproductive capacity of the festuca arundinacea can be pertinently improved, the gene DgCCD7-1 can be used for creating a multi-tillered duck Mao Zhu line, the breeding time is shortened, the breeding efficiency is improved, and the development and utilization of high-quality gramineous forage grass festuca arundinacea are promoted.

While the present invention has been described in detail through the foregoing description of the preferred embodiment, it should be understood that the foregoing description is not to be considered as limiting the invention. Many modifications and substitutions of the present invention will become apparent to those of ordinary skill in the art upon reading the foregoing. Accordingly, the scope of the invention should be limited only by the attached claims.

Claims

1. A gene related to tillering of cogongrass, characterized in that the gene is DgCCD7-1, the nucleotide sequence of the gene is shown as SEQ ID NO.3, the gene has a regulatory effect on tillering of Arabidopsis, and expression of the gene can reduce tillering capacity of Arabidopsis.

2. A protein encoded by the tillering related gene of claim 1, wherein the amino acid sequence of the protein is shown in SEQ ID No. 4.

3. A recombinant vector comprising the cogongrass tillering-related gene of claim 1.

4. The recombinant vector according to claim 3, wherein the recombinant vector is pCAMBIA1300-35S.

5. A recombinant bacterium comprising the recombinant vector according to claim 3.

6. The recombinant bacterium according to claim 5, wherein the recombinant bacterium uses Agrobacterium GV3101.

7. The use of a gene related to tillering of cogongrass according to claim 1, wherein the use comprises use in creating a multi-tillered duck Mao Zhu line or creating a multi-branched arabidopsis line.