CN104945493B - A kind of soybean protein GmIDD influencing plant growth period and its encoding gene and application - Google Patents
A kind of soybean protein GmIDD influencing plant growth period and its encoding gene and application Download PDFInfo
- Publication number
- CN104945493B CN104945493B CN201510458904.3A CN201510458904A CN104945493B CN 104945493 B CN104945493 B CN 104945493B CN 201510458904 A CN201510458904 A CN 201510458904A CN 104945493 B CN104945493 B CN 104945493B
- Authority
- CN
- China
- Prior art keywords
- gmidd
- plant
- arabidopsis
- soybean
- soybean protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/827—Flower development or morphology, e.g. flowering promoting factor [FPF]
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Physiology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of soybean protein GmIDD influencing plant growth period and its encoding gene and applications, belong to gene engineering technology field.The amino acid sequence of soybean protein GmIDD is as shown in SEQ ID NO.1, and the nucleotide sequence of protein coding gene is as shown in SEQ ID NO.2.Meanwhile the present invention also provides flowering of plant is being promoted in soybean protein GmIDD, adjusting the application process in plant growth period.Soybean protein GmIDD provided by the present invention, can be used for solving the problems, such as the flowering asynchronism in crossbreeding, various crops, veterinary antibiotics, the breeding time control problem of flowers, photoperiod-sensitive sex chromosome mosaicism and introduce a fine variety problem.
Description
Technical field
The present invention relates to a kind of soybean protein GmIDD influencing plant growth period and its encoding gene and applications, belong to base
Because of field of engineering technology.
Background technology
Soybean is short-day (SD) plant, very sensitive to photoperiodical reaction, especially blooms and receives the stringent control of photoperiod
System, this characteristic seriously hinder the adaptability of soybean varieties, cause the excellent soybean varieties between different zones that can not mutually reflect crowd,
Serious limitation soybean planting range, influences effective performance of yield level.The flowering time of soybean and maturity period are important agriculture
Skill character controls the yield, quality and adaptability of soybean varieties.Soybean how to be reduced to photoperiodic sensitivity, is dashed forward
Broken limitation of the photoperiod to soybean blossoming, it will be able to solve the problems, such as introducing a fine variety for interregional soybean, it is each interregional high-quality to realize
Kind is exchanged with each other, and improves soybean yields and quality.The conventional method for solving soybean photoperiod-sensitive sex chromosome mosaicism is by miscellaneous
It hands over to obtain new soybean varieties, but this method has the shortcomings of strong to the dependence of parent, breeding cycle is long.
Invention content
To solve the above problems, the present invention provides a kind of soybean protein GmIDD influencing plant growth period, taken
Technical solution is as follows：
It is an object of the present invention to provide a kind of soybean protein GmIDD influencing plant growth period, the soybean proteins
The nucleotide sequence of GmIDD is as shown in SEQ ID NO.1.
Another object of the present invention is to provide a kind of genes of encoding said proteins, and the gene source is in soybean
(Glycine max (L.) Merrill.) east agriculture 42.
The nucleotide sequence of the gene is as shown in SEQ ID NO.2.
Further, the core of 5 ' end 82-1308 in sequence shown in the nucleotide sequence of the gene such as SEQ ID NO.2
Sequence shown in thuja acid.
The present invention also provides the kit containing the gene, recombinant vector, recombinant cell or transgenic cell lines.
It is a further object of the present invention to provide the soybean protein GmIDD to promote flowering of plant, adjusts plant growth period
In application.
Further, above application is the overexpression soybean protein GmIDD in plant, promotes flowering of plant, shortens plant
Breeding time.
The step of the present invention also provides the applications, it is as follows：
1) soybean total serum IgE is extracted, and first chain of cDNA is synthesized by reverse transcription and is used as template, then carries out RT-PCR expansions
Increase, obtains amplified production；
2) by glue recycling step 1) gained amplified production and connect with plasmid vector pGM19T, acquisition recombinant plasmid
PGM19T-GmIDD, with I double digestion recombinant plasmid pGM19T-GmIDD of Xba I and Sac, while the double base that double digestion is built is planted
Object expression vector pCAMBIA3300+pBI121, and two recombinant plasmids after digestion are attached, the recombination matter after connection
Grain is pCAMBIA3300+pBI121-GmIDD；
3) the recombinant plasmid pCAMBIA3300+pBI121-GmIDD obtained by step 2) is converted into Agrobacterium by freeze-thaw method
In competent cell, recombinant cell is obtained；
4) it utilizes recombinant cell obtained by step 3) to prepare dip dyeing liquid for shell, and arabidopsis is disseminated using dip dyeing liquid for shell, it is quasi- to obtain dip dyeing
Southern mustard；
5) incubation step 4) gained dip dyeing arabidopsis, obtain the Arabidopsis plant for turning soybean GmIDD albumen.
Preferably, step 1) the RT-PCR amplifications, the sequence such as SEQ ID NO.3-SEQ ID NO.4 institutes of amplimer
Show；Amplification condition is：94 DEG C, 5min；35 cycles：94 DEG C, 30s, 56 DEG C, 30s, 72 DEG C, 1.5min；72 DEG C, 10min.
Preferably, step 4) is described disseminates arabidopsis using dip dyeing liquid for shell, and recombinant cell is linked into containing 25mg/mL profit good fortune
Flat, 25mg/mL streptomysins, 50mg/mL cards receive mycin YEP fluid nutrient mediums in, 28 DEG C, 200rpm shake cultures to OD600For
0.48-052；It is transferred to overnight incubation in the same YEP fluid nutrient mediums of 200mL, as bacterium solution OD600It is taken out when between 1.6-2.0
It uses；Room temperature 5000rpm centrifuges 10min, abandons supernatant, and precipitation is suspended in osmotic medium to OD600For 0.78-0.82；It will be resuspended
Liquid is such as plate, then arabidopsis is laid across on plate side, and plant inflorescence is immersed in suspension, impregnates 30s；Plant is taken out, it is horizontal
It is put into thermostatic chamber overnight incubation in camera bellows；Take out within second day vertical culture；After cultivating 4-5d, continue dip dyeing one to secondary；It is described
Osmotic medium contains 1/2MS+5% sucrose+0.02%silwet L-77.
What the present invention obtained has the beneficial effect that：
Present invention demonstrates that shifting to an earlier date in the transgenic Arabidopsis plants plant breeding time for being transferred to soybean GmIDD, photoperiod-sensitive
Property reduce.Utilize the gene for breed improvement so that arbitrary kind can be conducted by method for transformation, to change these
The characteristic in breeding time of kind, and finally change these plant varieties bloom and the maturity period, overcome in conventional breeding, lead to
Cross selection is crossed, or longer by the conventional methods progress breed improvement required time such as radiation and chemical reagent progress mutagenesis, and
And the weakness for the degree or direction that cannot be mutated in estimated offspring, it is a kind of relative to tradition to carry out breed improvement with these genes
Especially effective and simple and reliable method for method.
Description of the drawings
Fig. 1 GmIDD protein system chadograms.
Fig. 2 is the plasmid map of expression vector pCAMBIA3300+pBI121-GmIDD.
Fig. 3 is the digestion verification of the plasmid of constitutive expression carrier pCAMBIA3300+pBI121-GmIDD；
(M1：DL2000 DNA Marker；M2：DL15000 DNA Marker；1：PGM19T-GmIDD plasmids；2：
PGM19T-GmIDD plasmids Xba I and SacI double digestion products；3：PCAMBIA3300-pBI121-GmIDD plasmids；4：
PCAMBIA3300-pBI121-GmIDD plasmids Xba I and SacI double digestions product).
Fig. 4 is that the PCR of overexpression GmIDD gene Arabidopsis plants is identified；
(M：DL2000DNA Marker；Sun：PCAMBIA3300-pBI121-GmIDD plasmids；CK：Wild type control；Water：
Water；1-15：Overexpression GmIDD genes Arabidopsis plant).
Fig. 5 is the characterization of long-day lower 30 days transgenic Arabidopsis plants and adjoining tree.
Fig. 6 is the characterization of long-day lower 35 days transgenic Arabidopsis plants and adjoining tree.
Fig. 7 is the characterization of long-day lower 47 days transgenic Arabidopsis plants and adjoining tree.
Fig. 8 is the characterization of short-day lower 30 days transgenic Arabidopsis plants and adjoining tree.
Fig. 9 is the characterization of short-day lower 48 days transgenic Arabidopsis plants and adjoining tree.
Figure 10 is the characterization of short-day lower 60 days transgenic Arabidopsis plants and adjoining tree.
The response that different number of days changes under the long and short sunshine of Figure 11 soybean GmIDD gene pairs.
Figure 12 is the analysis expressed under soybean GmIDD gene lengths, short-day.
Figure 13 is differential expression of the soybean GmIDD genes in different tissues organ.
Wherein, TW is adjoining tree in Fig. 5-Figure 10, and GmIDD-ox is the Arabidopsis plant for being overexpressed GmIDD albumen.
Specific implementation mode
With reference to specific embodiment, the present invention will be further described, but the present invention should not be limited by the examples.
Material therefor, reagent, instrument and method in following embodiment are the routine in this field without specified otherwise
Material, reagent, instrument and method can be obtained by commercial channel.
The clone of transcription factor GmIDD genes in 1 soybean photoperiodic signal transduction pathway of embodiment
The soybean EST of short-day induction is filtered out by using the soybean inhibition subtractive cDNA library of inventor early period,
It is compared with soybean genome database, number Glyma14g10940 is named as GmIDD, (the Genbank numbers of logging in
KT266576), according to sequence mRNA design primers, Trizol reagents extract soybean (Glycine max, eastern agriculture 42；Chen Li
Monarch, different sowing dates are to 42 Character of productivity and quality dynamic rule research of soybean east agriculture, [J] Soybean Sciences, and 2008, (03) the public
Can be obtained from Northeast Agricultural University) blade total serum IgE, reverse transcription synthesize first chain of cDNA be used as template, progress PCR clone the base
Cause, it is as a result consistent with online sequence, the 1468bp mRNA sequences of ORF are obtained, ORF 1227bp encode 408 amino acid, sequence
The ORF of sequence 1 in table is 75-1646 nucleotide, and albumen shown in sequence 2, there is 4 zinc fingers in polynucleotide
(ZFs), the first two C2H2 types, most latter two is C2HC types.The IDD genes of known each species, ClustalX are collected from NCBI
Then the comparison for carrying out protein sequence constructs the systematic evolution tree of soybean GmIDD genes and other species IDD genes (such as
Fig. 1).
The acquisition and functional study of 2 turns of GmIDD arabidopsis of embodiment
One, the structure of plant expression vector pCAMBIA3300+pBI121-GmIDD
Trizol reagents extract 42 total serum IgE of soybean east agriculture, and reverse transcription is synthesized first chain of cDNA as template, drawn with justice
Object：GCTCTAGAATATGTCCAATTTGACGTCTGC (underscore part is XbaI enzyme cutting site), antisense primer：
GCGAGCTCGCTTTATTCCCTGATCAAGATG (underscore part is Sac I restriction enzyme sites), carries out PCR reactions, PCR conditions
For 94 DEG C of 5min；35 cycles：94 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 1.5min；72℃10min.By PCR product in 0.8% agar
Electrophoresis detection on sugared gel, the results showed that PCR product 1277bp.The ORF of sequence 1 in sequence table is 82-1308 cores
Thuja acid, albumen shown in sequence 2, GmIDD is named as by the albumen in polynucleotide.
Build intermediate carrier pCAMBIA3300+pBI121.With Hind III and EcoR I simultaneously double digestion pCAMBIA3300 with
The 8377bp large fragments obtained from pCAMBIA3300 connect with the 3032bp obtained from pBI121 double digestions, obtain by pBI121
Intermediate carrier pCAMBIA3300+pBI121.
The structure of recombinant plasmid pCAMBIA3300+pBI121-GmIDD.PCAMBIA3300+pBI121-GmIDD recombinates table
Up to carrier schematic diagram (such as Fig. 2).After RT-PCR is expanded, purpose band is recycled and is connect with pGM19T carriers, and to recombinant plasmid
PGM19T-GmIDD carries out determined dna sequence.PGM19T-GmIDD recombinant plasmids Xba I and Sac I couple with target gene
Digestion, what is be attached thereto is intermediate carrier pCAMBIA3300+pBI121 while also using I double digestion of Xba I and Sac, electroresis appraisal
(such as Fig. 3), blend compounds QIAquick Gel Extraction Kit recycle 1277bp GmIDD full length fragments and 9509bp carrier large fragments.Weight after connection
It is 10786bp that group plasmid, which is named as pCAMBIA3300+pBI121-GmIDD sizes, then is somebody's turn to do by Xba I, the identification of I double digestions of Sac
Recombinant plasmid, it was demonstrated that GmIDD genes have been coupled to after transformation on pCAMBIA3300+pBI121 binary plant expression vectors.It will
PCAMBIA3300+pBI121-GmIDD recombinant plasmids convert Agrobacterium tumefaciems competent cell by freeze-thaw method.
Two, turn the cultivation of GmIDD arabidopsis
1, the plantation of wildtype Arabidopsis thaliana
It takes arabidopsis seed dry to be on a small quantity put into centrifuge tube, seals.It is put into spring flower 3-5 days in 4 DEG C of refrigerators；By vernalization
Good arabidopsis seed takes out, and the 75% ethyl alcohol cleaning 10-30s of 1mL is added；The ethyl alcohol in centrifuge tube is outwelled, is added 1mL's
The distilled water of sterilizing pressure-vaccum arabidopsis seed repeatedly rinses 2-3 times；The aqua sterilisa in centrifuge tube is outwelled, the 10% of 1mL is added
Sodium hypochlorite (matching while using), be vortexed piping and druming 8min, fully sterilizes；In super-clean bench, the sodium hypochlorite in centrifuge tube is outwelled, is used
The pipette tips of sterilizing draw the distilled water of sterilizing pressure-vaccum arabidopsis seed repeatedly, rinse 3-5 times, until sodium hypochlorite rinse well for
Only；In super-clean bench, aqua sterilisa is added into the centrifuge tube equipped with arabidopsis seed, pressure-vaccum seed makes its resuspension, draws seed
On uniform point to MS culture mediums, sealed membrane sealing, tissue culture is cultivated in room；When arabidopsis germination grows 3-4 piece leaves
(5-7d) is gone to the Artificial Soil (vermiculite of sterilizing：Perlite：Flower soil=3:1:1).In illumination box illumination box 22
DEG C, 350 μm of ol m-2s-1White light is cultivated under the conditions of the long-day (16h/8h light darks) (LD).
2, it the preparation of pCAMBIA3300-pBI121-GmIDD bacterium solutions and infects
The Agrobacterium LBA4404 containing recombinant plasmid pCAMBIA3300-pBI121-GmIDD that picking has been identified is (in old
Refined king's golden hair Liu Liang (2003) rice repetitive sequence RRD3 deletants of strong Liu Bing Wang Hong mediate gusA in Rice Callus
In expression formula.Tropical and subtropical plant journal, l I (2)：127-131；The public can obtain from Northeast Agricultural University.) monoclonal
Be put in 20mL contain 25mg/mL rifampins, 25mg/mL streptomysins, 50mg/mL cards receive mycin YEP fluid nutrient mediums in, 28
DEG C, 200rpm shake cultures to OD600It is 0.5 or so；It is transferred to overnight incubation in the same YEP fluid nutrient mediums of 200mL, works as bacterium
Liquid OD600It takes out and uses when between 1.6-2.0；Room temperature 5000rpm centrifuges 10min, abandons supernatant, and precipitation is suspended in infiltration culture
Base (1/2MS+5% sucrose+0.02%silwet L-77) is to OD600≈0.8；By re-suspension liquid such as plate.Arabidopsis is laid across
On plate side, plant inflorescence is immersed in suspension, impregnates 30s.Plant is taken out, traverse enters thermostatic chamber overnight incubation in camera bellows.
Take out within second day vertical culture.After 4-5d, dip dyeing one is continued to secondary according to the growing state of arabidopsis.Culture 3-4 weeks, waits planting
After sub- maturation, seed is collected, is stored in drier.
3, it is overexpressed the screening of GmIDD Arabidopsis plants
The T of GmIDD will be overexpressed0For 4 DEG C of low-temperature treatment 2-3d of transgenic seed, then uniformly puts to be sowed at and contain respectively
On the MS culture mediums of PPT, it is put into and is cultivated 7-10 days in long-day culturing room；The arabidopsis with PPT resistances that will be grown fine
Plant, which is transplanted on the MS culture mediums without PPT, grows 7d；The PPT positive plants of normal growth are transplanted and are grown in soil.
4, the molecular Biological Detection of transgenic arabidopsis
The PCR of transgenic arabidopsis is detected
It extracts GmIDD and is overexpressed wild-type Arabidopsis plants DNA (T0, T1, T2, T3), with GmIDD gene specific primers into
Row PCR amplification (such as Fig. 4)；GmIDD gene specific primers such as the following table 1：
1 GmIDD gene specific primers of table
5, turn GmIDD arabidopsis T3 for functional analysis
The day long processing of transgenic arabidopsis
(1) long-day handles transgenic arabidopsis Phenotypic Observation
By the T of acquisition3In generation, turns 4 DEG C of low-temperature treatment 2-3d of seed of GmIDD arabidopsis, and then uniformly point is sowed at MS culture mediums
On, it is put into and is cultivated 7-10 days in long-day culturing room；By the Arabidopsis plant to grow fine transplanting in soil the long-day (16h light/
8h is dark) under the observation transgenic arabidopsis of normal growth 30 days and its leaf morphology, as shown in figure 5, GmIDD is overexpressed (GmIDD-
Ox) Arabidopsis plant is compared with the control in florescence, the lotus throne number of sheets, without larger difference, but GmIDD is overexpressed Arabidopsis plant and compares
It is big according to plant leaf, 35 days observation transgenic arabidopsis phenotypes as shown in fig. 6, GmIDD-ox Arabidopsis plants compared with the control,
GmIDD-ox Arabidopsis plants are more slightly higher than control plant height, observation transgenic arabidopsis phenotype at 47 days as shown in fig. 7,
Compared with the control, it is more slightly higher that adjoining tree ratio GmIDD is overexpressed arabidopsis plant height to GmIDD-ox Arabidopsis plants.
(2) short-day sunshine treatment transgenic arabidopsis Phenotypic Observation
By the T of acquisition3In generation, turns 4 DEG C of low-temperature treatment 2-3d of seed of GmIDD arabidopsis, and then uniformly point is sowed at MS culture mediums
On, it is put into and is cultivated 7-10 days in short-day culturing room；By the Arabidopsis plant to grow fine transplanting in soil short-day (8h light/
16h is dark) under normal growth；Transgenic arabidopsis and its leaf morphology are observed, arabidopsis phenotype is as shown in figure 8, GmIDD is overexpressed
Compared with the control, GmIDD-ox Arabidopsis plants are bigger than control plant leaf for Arabidopsis plant, at 48 days with adjoining tree blade
Size is similar, but GmIDD-ox Arabidopsis plants blade some jaundice, observation transgenic arabidopsis phenotype such as Fig. 9 institutes at 60 days
Show, it can be seen that be overexpressed plant early blossoming phenotype, observation transgenic arabidopsis phenotype is as shown in Figure 10 at 77 days, and GmIDD crosses table
Compared with the control up to Arabidopsis plant, GmIDD-ox Arabidopsis plants early blossoming, the florescence, lotus throne number of sheets mesh was flat than control 8 days in advance
9 are reduced, plant height averagely increases about 5cm, and the number that bears pods averagely increases about 14, illustrates that being overexpressed GmIDD can promote to intend
Southern mustard plant blooms under short-day.
The expression analysis of 3 soybean GmIDD genes of embodiment
1, the expression analysis under soybean GmIDD genes different number of days
By the plantation of 42 seed of eastern agriculture in flowerpot, per one, basin.It is cultivated to second under conditions of 25 DEG C, the long-day (LD)
A trifoliolate leaf is fully deployed.The consistent soybean seedling of growing way is selected, a part carries out long-day processing, and another part carries out short
Sunshine (SD) processing.15,17,20,23,26,29,32,35,45 days after illumination starts take trifoliolate leaf blade to extract respectively
RNA carries out reverse transcription, is used for quantitative fluorescent PCR.As a result as shown in figure 11, the results showed that soybean GmIDD is induced by short-day,
The gene expression abundance of soybean GmIDD genes will be significantly higher than in the expression of short-day (SD) in long-day (LD) item since 23 days
Gene expression abundance under part.
2, the response of the long short-day variation of soybean GmIDD gene pairs
By the plantation of 42 seed of eastern agriculture in flowerpot, per one, basin.It cultivates to second three under 23 DEG C, the long-day (LD)
Compound leaf is fully deployed.The consistent soybean seedling of growing way is selected, a part carries out long-day processing, and another part carries out short-day
(SD) it handles.0 after illumination starts respectively samples, extracts leaf for 4,8,12,16,20,24,28,32,36,40,44,48 hours
Piece RNA carries out reverse transcription, is used for quantitative fluorescent PCR.As a result as shown in figure 12, the results showed that the expression of soybean GmIDD genes is rich
Degree will be significantly higher than the gene expression abundance under long-day conditions in short-day expression in continuous 48 hours.
3, expression of the soybean GmIDD genes in different tissues organ
Root, stem, leaf, flower and the beanpod extraction RNA that soybean is taken under the conditions of long-day and short-day, by quantitative
PCR studies differential expression of the GmIDD genes in these organs, as a result as shown in figure 13：The gene under conditions of long-day
Expression quantity highest in root.
Although the present invention is disclosed as above with preferred embodiment, it is not limited to the present invention, any to be familiar with this
The people of technology is not departing from spirit and scope of the invention, can do various change and modification, therefore, guarantor of the invention
Shield range should be subject to what claims were defined.
Claims (4)
1. a kind of method for promoting flowering of plant, adjusting plant growth period, which is characterized in that be to be overexpressed soybean in plant
Protein G mIDD promotes flowering of plant, shortens plant growth period；The soybean protein GmIDD amino acid sequences such as SEQ ID
Shown in NO.1.
2. claim 1 the method, which is characterized in that steps are as follows：
1) soybean total serum IgE is extracted, and first chain of cDNA is synthesized by reverse transcription and is used as template, then carries out RT-PCR amplifications, is obtained
Obtain amplified production；
2) band recycling step 1) gained amplified production and connect with plasmid vector pGM19T, acquisition recombinant plasmid pGM19T-
GmIDD, with I double digestion recombinant plasmid pGM19T-GmIDD of Xba I and Sac, while the intermediate carrier that double digestion is built
PCAMBIA3300+pBI121, and two recombinant plasmids after digestion are attached, the recombinant plasmid after connection is
pCAMBIA3300+pBI121-GmIDD；
3) the recombinant plasmid pCAMBIA3300+pBI121-GmIDD obtained by step 2) is converted into Agrobacterium impression by freeze-thaw method
In state cell, recombinant cell is obtained；
4) it utilizes recombinant cell obtained by step 3) to prepare dip dyeing liquid for shell, and arabidopsis is disseminated using dip dyeing liquid for shell, obtain dip dyeing arabidopsis；
5) incubation step 4) gained dip dyeing arabidopsis, obtain the Arabidopsis plant for turning soybean GmIDD albumen.
3. claim 1 the method, which is characterized in that step 1) the RT-PCR amplifications, the sequence such as SEQ of amplimer
Shown in ID NO.3-SEQ ID NO.4；Amplification condition is：94 DEG C, 5min；35 cycles：94 DEG C, 30s, 56 DEG C, 30s, 72 DEG C,
1.5min；72 DEG C, 10min.
4. claim 1 the method, which is characterized in that step 4) is described to disseminate arabidopsis using dip dyeing liquid for shell, is that will recombinate carefully
Born of the same parents be linked into received containing 25mg/mL rifampins, 25mg/mL streptomysins, 50mg/mL cards mycin YEP fluid nutrient mediums in, 28
DEG C, 200rpm shake cultures to OD600For 0.48-052；It is transferred to overnight incubation in the same YEP fluid nutrient mediums of 200mL, works as bacterium
Liquid OD600It takes out and uses when between 1.6-2.0；Room temperature 5000rpm centrifuges 10min, abandons supernatant, and precipitation is suspended in infiltration culture
Base is to OD600For 0.78-0.82；Re-suspension liquid is poured into plate, then arabidopsis is laid across on plate side, plant inflorescence is immersed in outstanding
In supernatant liquid, 30s is impregnated；Plant is taken out, traverse enters thermostatic chamber overnight incubation in camera bellows；Take out within second day vertical culture；Cultivate 4-
After 5d, continue dip dyeing one to secondary；The osmotic medium contains 1/2MS+5% sucrose+0.02%silwet L-77.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510458904.3A CN104945493B (en) | 2015-07-30 | 2015-07-30 | A kind of soybean protein GmIDD influencing plant growth period and its encoding gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510458904.3A CN104945493B (en) | 2015-07-30 | 2015-07-30 | A kind of soybean protein GmIDD influencing plant growth period and its encoding gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104945493A CN104945493A (en) | 2015-09-30 |
| CN104945493B true CN104945493B (en) | 2018-08-10 |
Family
ID=54160608
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510458904.3A Expired - Fee Related CN104945493B (en) | 2015-07-30 | 2015-07-30 | A kind of soybean protein GmIDD influencing plant growth period and its encoding gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104945493B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114539374B (en) * | 2022-02-28 | 2023-06-13 | 东北农业大学 | GmZTL3 protein, application of encoding gene thereof and method for cultivating soybeans |
-
2015
- 2015-07-30 CN CN201510458904.3A patent/CN104945493B/en not_active Expired - Fee Related
Non-Patent Citations (4)
| Title |
|---|
| XP_006596020.1;NCBI reference sequence;《Genbank》;20140107;1 * |
| 植物C2H2型锌指蛋白的研究进展;宋冰等;《基因组学与应用生物学》;20101231;第29卷(第5期);第1133-1141页 * |
| 植物花发育的分子机理研究进展;张云等;《植物学通报》;20031231;第20卷(第5期);第589-601页 * |
| 锌指蛋白结构与功能研究进展;赵楠等;《生物技术通讯》;20090130;第20卷(第1期);第131-134页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104945493A (en) | 2015-09-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105949295B (en) | With the albumen and its encoding gene of flowering of plant time correlation and application | |
| CN112080515B (en) | UP gene and application thereof in plant improvement | |
| CN110643618A (en) | Jatropha curcas MYB transcription factor JcMYB16 gene and application thereof in improving drought resistance of plants | |
| CN106967728B (en) | Pumpkin stress resistance gene CmNAC1 and application thereof | |
| Chen et al. | Enhance sucrose accumulation in strawberry fruits by eliminating the translational repression of FabZIPs1. 1 | |
| CN113322261B (en) | Application of soybean ABC transporter gene GmALS3 in breeding of low-phosphorus-resistant and aluminum-toxicity-resistant plants | |
| CN109468333A (en) | Citrus laccase family gene CsiLAC4 and its application | |
| CN111171127B (en) | Astragalus sinicus LHY gene and application thereof | |
| CN110283241B (en) | Application of PtTST1.1 and PtTST2.1 in preparation of plant growth promoting substances | |
| CN104945493B (en) | A kind of soybean protein GmIDD influencing plant growth period and its encoding gene and application | |
| CN115851823B (en) | Cymbidium CgARF18 gene and application thereof | |
| CN108018369A (en) | Initiative, detection and the application of corn transformation event ZM2-104 | |
| CN110257401A (en) | Comospore poplar PtrMYB119 gene is improving the application in tobacco drought tolerance | |
| CN106995492B (en) | Sucrose transporter and application thereof in regulation and control of plant male sterility | |
| CN103348009B (en) | A kind of method for preparing fertility-lowered plant | |
| CN102676576B (en) | Method for improving moisture resistance of cabbage type rape | |
| CN108841837A (en) | Application of the encoding gene of arabidopsis splicing factor SR45a spliceosome in negative regulation plant salt stress response | |
| CN110029106B (en) | RNAi fragment of MSL1 and application thereof in improving cadmium stress sensitivity of plants | |
| CN108018286A (en) | Initiative, detection and the application of corn transformation event ZM8-143 | |
| CN102453084B (en) | Soybean photoreceptor GmPLP1 and coding gene and application thereof | |
| CN106811448B (en) | Cotton tyrosine phosphatase GhPTP1 and its encoding gene and application | |
| CN116621959B (en) | Soybean GmMADS5 gene and application thereof in plant flowering phase regulation | |
| CN104099355A (en) | Method for cultivating StP5CS salt-tolerance transgenic soybeans | |
| CN104195097B (en) | Culture medium for promoting transgenic tobacco with early blossoming-promoting gene NtFT5 to root and method for obtaining short-period tobacco | |
| CN116064652B (en) | Application of sugarcane raffinose synthase SsRS1 gene in improvement of drought resistance of plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180810 Termination date: 20190730 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |