CN104988176B - Method for improving gum content of eucommia ulmoides - Google Patents

Abstract

The invention relates to a method for improving the gum content of eucommia ulmoides, which comprises the following steps: 1) peeling cortex Eucommiae into multiple lattices to form a lattice-spaced cambium with exposed surface; 2) carrying out infection operation: selecting a bacterial solution cultured by agrobacterium tumefaciens single colony containing a recombinant expression vector EuTIDS5, and infecting a peeled surface cambium of eucommia; 3) and (4) wrapping the peeled surface by using a plastic film after peeling and infection, moisturizing and sun-proof growth. The infection method is simple and easy to implement, and the effect of increasing the gel content is excellent.

Description

Method for improving gum content of eucommia ulmoides

Technical Field

The invention relates to a method for improving the gum content of eucommia ulmoides, in particular to a method for improving the gum content of eucommia ulmoides by specific gene introduction.

Background

Eucommia ulmoides (Eucommia ulmoides Oliv.) is a peculiar rare medicinal tree species in China, and various tissues such as barks, roots, stems, leaves, flowers and fruits contain a large amount of white filamentous substances, namely Eucommia Ulmoides Rubber (EUR), so that the Eucommia ulmoides is regarded as a high-quality natural rubber tree species. Rubber is an important strategic material resource in China, and the rubber industry is one of the most important basic industries of national economy in China. The trefoil rubber is very narrow in the suitable growing area of China, and the productivity reaches the limit. The demand of the natural rubber in China far exceeds the yield in China, and the shortage of the natural rubber resources restricts the development of the rubber industry in China, so that the development of the second natural rubber resource is urgent. The eucommia rubber is a terpenoid high molecular compound generated by the secondary metabolic pathway of eucommia, is different from the trefoil rubber, has a trans-polyisoprene structure, has rubber-plastic duality, and is far superior to the trefoil rubber in the aspects of low-temperature plasticity, thermal elasticity, blending property, high insulativity and corrosion resistance. However, the production cost is high due to the low gel content of the eucommia leaves, and the method becomes a bottleneck of the industrialization of the eucommia rubber.

The most fundamental way to improve the yield of the eucommia ulmoides rubber is to disclose a gene regulation mechanism in the biosynthesis process of the eucommia ulmoides rubber. Eucommia ulmoides rubber, a high molecular weight trans-polyisoprene, is formed by the continuous condensation of low molecular weight trans-isoprene by a specific prenyltransferase, and the biosynthesis of low molecular weight isoprene is formed by the continuous condensation of isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP) (Nishibe-S.Bioactive ligands and vitamins from molecular mediators [ J ]. Polyphenol International Conference,1995, 113-122.). Several genes involved in trans-rubber biosynthesis have been identified, such as the important rubber protein coding gene (MLP), rubber elongation factor (RFF), rubber granule membrane protein (RPMP), small rubber granule protein (SRPP), trans-isopentenyl pyrophosphate synthase gene (TIDS) and others (MichelRohm. the discovery of a surfactant-independent pathway in bacteria, organism and higher plants [ J ] Nat. Prod.1999, 16:565-574. Lyle BL and others, Structure of a two rubber particles kinase, 11. promoter expression of 2012 grid protocols [ J ] Proteins,2009,76: 237-CL et al, organic synthesis of rubber biosynthesis [ J ] expression of microorganism of strain of, DOI10.1007/s00425-012 and 1679-x.). Although the related gene of eucommia ulmoides rubber synthesis is cloned and transformed, the application method of the related gene is not disclosed. The invention screens out key enzyme genes synthesized by the eucommia ulmoides rubber, designs a transgenic infection method and greatly improves the content of the eucommia ulmoides rubber from the genetic level. The method is simple and easy to implement, improves the gel content of the new pericarp, and has important significance for reducing the production cost of the eucommia rubber, promoting the rapid development of the eucommia rubber industry and meeting the requirements of the rubber industry in China.

Disclosure of Invention

In order to solve the problems to a certain extent, the invention aims to provide a key enzyme gene of eucommia ulmoides rubber by utilizing a gene expression rule and an eucommia ulmoides rubber synthesis rule, the gene is transformed into eucommia ulmoides by a genetic transformation infection method to obtain a transgenic plant, and biological function verification shows that the cloned EuTIDS5 gene remarkably increases the rubber content of the eucommia ulmoides, namely the invention provides a method for increasing the rubber content of the eucommia ulmoides.

In order to achieve the purpose, the invention adopts the following technical scheme:

the EuTIDS5 gene is cloned according to a plant gene cloning technology, the expression of different tissues of the gene in different periods is detected by Real-Time PCR, eucommia rubber is extracted by a Soxhlet extraction method, and the synthesis rule of the eucommia rubber is analyzed, so that the key enzyme gene for synthesizing the eucommia rubber is EuTIDS 5. The genetic transformation of eucommia bark mediated by agrobacterium is utilized, and the biological function verification of the obtained transgenic plant shows that the EuTIDS5 gene cloned by the invention has the function of regulating and controlling the synthesis of eucommia bark rubber. The method for separating and cloning, expression rule and function verification of the key enzyme gene EuTIDS5 gene of rubber synthesis will be described in detail in the embodiment section of the invention.

The EuTIDS5 gene can be derived from a variety of eucommia ulmoides commonly found in our country, such as those listed in Table 1 below:

TABLE 1 eucommia ulmoides variety table

The invention provides a method for improving the gum content of eucommia ulmoides, which comprises the following steps:

1) peeling cortex Eucommiae into multiple lattices to form a cambium with exposed surface at intervals;

2) carrying out infection operation: selecting a bacterial solution cultured by agrobacterium tumefaciens single colony containing a recombinant expression vector EuTIDS5, and infecting a peeled surface cambium of eucommia;

3) and (4) wrapping the peeled surface with a plastic film after peeling and infection, moisturizing and sun-proof growth.

Furthermore, the unit lattice area of the lattice is 2-10cm²More preferably 3 to 6cm²The lattice may be in various shapes, and is a 2cm × 2cm square as a preferred example.

Further, OD of the bacterial liquid in the step 2)₆₀₀The value is 0.5 to 0.9.

Further, the plastic film wrapping and peeling time in the step 3) is 20 to 100 days, for example, 20 days, 40 days, or 50 days, or 60 days, or 70 days, or 80 days, or 90 days, or 100 days, more preferably 30 to 90 days, and still more preferably 40 to 80 days.

Further, the infection operation of step 2) is performed 2-5 times with 2-4 days interval, preferably, the infection operation is performed 3 times with 3 days interval.

Further, the agrobacterium single colony containing the recombinant expression vector is obtained by the following method: adding the plasmid containing EuTIDS5 into competent cells of Agrobacterium tumefaciens strain GV3101, gently mixing, and adding into a precooled electric shock transformation cup for electric shock transformation; after electric shock transformation, adding competent cytoplasm with plasmid into culture medium, and culturing; taking the solution, uniformly coating the solution on a solid culture medium containing corresponding antibiotics, and performing inverted culture; picking single colony and shaking the colony until the growth logarithmic phase. A preferred embodiment is: adding 1 mu L of plasmid containing EuTIDS5 into competent cells of Agrobacterium tumefaciens strain GV3101, gently mixing, and adding into a precooled electric shock transformation cup for electric shock transformation; after electric shock transformation, adding competent cytoplasm with plasmid into 200 μ L liquid culture medium, culturing at 28 deg.C and 180rpm for 2 h; uniformly coating 100 mu L of bacterial liquid on a solid culture medium containing corresponding antibiotics, and performing inverted culture at 28 ℃ for 48 hours; and picking a single colony, shaking the bacteria at 28 ℃, 180rpm for 24 hours until the logarithmic phase of growth.

Further, the plasmid containing EuTIDS5 was prepared by: EuTIDS5 was amplified by PCR, ligated plasmid transformed and cultured, and extracted to obtain a plasmid containing EuTIDS 5. A preferred embodiment is: cloning was performed by means of PCR, the PCR system of which is shown in the following table:

the PCR cloning reaction conditions were: pre-denaturation at 98 ℃ for 1 min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 15s, extension at 68 ℃ for 2min, and 8 cycles; denaturation at 98 ℃ for 10s, extension at 68 ℃ for 2min, 32 cycles; extending for 10min at 68 ℃;

the ligation reaction product was transformed into E.coli and the plasmid was extracted.

Further, the coding sequence of EuTIDS5 is shown in SEQ ID NO 2.

Further, the upstream primer (5'-3') and the downstream primer (5'-3') of EuTIDS5 were amplified by PCR as shown in SEQ ID Nos. 3 and 4, respectively.

The invention has the advantages that: can obviously improve the gum content of the eucommia.

Drawings

FIG. 1: the glue content of the leaves and fruits of eucommia ulmoides at different periods.

FIG. 2: expression levels of EuTIDS5 in different stages in leaves and fruits of eucommia ulmoides oliv.

FIG. 3: relative expression and gum growth rate of EuTIDS5 in folium Eucommiae at different periods.

FIG. 4: relative expression and gum growth rate of EuTIDS5 in eucommia ulmoides fruits at different periods.

FIG. 5: and (3) carrying out PCR detection on an electrophoretogram of the transgenic tobacco plant.

FIG. 6: different lines of transgenic tobacco 35s the relative expression level of EuTIDS 5.

FIG. 7: and (5) transforming eucommia bark.

FIG. 8: transgenic bark phenotype analysis.

Detailed Description

The following description of the present invention is provided in connection with examples to enable those skilled in the art to better understand the present invention, and various changes and modifications may be made to the present invention to adapt it to various usages and conditions without departing from the spirit and scope of the present invention.

The eucommia variety referred to in the following examples is 12001X from Shennong's shelf in Hubei.

In order to facilitate better understanding of the present invention, examples of relevant basic experiments are given below together with examples of the present invention, and please refer to examples 8-10 for the core contents of the present invention, and examples 1-7 are relevant basic experiments to better understand the present invention. Example 1 rubber content of leaves and fruits of eucommia ulmoides at different periods

The present invention uses a soxhlet extraction method (see Ren Chen et al, Overexpression of anistropic diphosphateisomerase gene to enhance trans-polyisopreneoplastic Eucomamia ulmoides Oliver [ J ].2012,12:78) to determine the polyisoprene content in different tissues (fruits and leaves) at different times [ 5 months from pollination (early 4 months) to fruit ripening (late 8 months) ]. The results show that the gel content of the eucommia leaves and fruits at different periods of time is increased continuously along with the time, which indicates that the synthesis of the eucommia rubber is a process of increasing and accumulating gradually. The rubber content of the fruits of eucommia ulmoides rapidly increases from 50 days after pollination (4 middle months) to 5 middle months, and then the rubber content of the fruits slowly increases and gradually becomes stable. Compared with the eucommia ulmoides fruit, the glue content in the eucommia ulmoides leaves is steadily increased along with time. At the same time, the rubber content of the eucommia ulmoides fruit is 1.2-3.2 times of the rubber content of the leaves (see FIG. 1 for details).

Example 2 isolation cloning of the EuTIDS5 Gene

Using the eucommia ulmoides transcriptome database, a sequence related to EuTIDS5 was obtained. The invention adopts RACE method to amplify the complete sequence of EuTIDS5 by using 5 'and 3' -RACE kits (TaKaRa, Dalian, China) of Taraka company. RNA extraction Using the Qiagen RNA extraction Kit (RNeasy Plant mini Kit, Qiagen, Hilden)Germany), first strand cDNA Synthesis according to SuperScript from Invitrogen^TMIII First-Strand Synthesis System (Life technologies, Carlsbad, California, U.S.) reverse transcription kits, all according to kit instructions.

Amplification was performed using PrimerPremier 5.0 primers designed to the EuTIDS5 sequence as follows:

core fragment forward (SEQ ID NO:5):

5’-AAGGTTGGGATGATTGCGAT-3’

core fragment reverse (SEQ ID NO:6):

5’-TTTCACGACTAACCAAGTGC-3’

5’RACE OuterPrimer(SEQ ID NO:7):

5’-CATGGCTACATGCTGACAGCCTA-3’

5’RACE InterPrimer(SEQ ID NO:8):

5’-CGCGGATCCACAGCCTACTGATGATCAGTCGATG-3’

5' RACE reverse (SEQ ID NO:9):

5’-TGTCCTTCATGCCACTATGAGTTTCTAG-3’

3' RACE Forward (SEQ ID NO:10):

5’-GAGGAAGCATTTTCGGACCAAACCTT-3’

3’RACE OuterPrimer(SEQ ID NO:11):

5’-TACCGTCGTTCCACTAGTGATTT-3’

3’RACEInterPrimer(SEQ ID NO:12):

5’-CGCGGATCCTCCACTAGTGATTTCACTATAGG-3’

the PCR amplification reaction system is as follows:

core fragment: 12.5. mu.L of Taq PCR Mastermix, 1. mu.L of Primer1 (10. mu. mol. L)^-1) And Primer2 (10. mu. mol. L)^-1) 2. mu.L of template DNA, 8.5. mu.L of sterilized ddH₂O。

3 'RACE and 5' RACE were amplified using nested PCR.

3' RACE: mu.L of cDNA, 8. mu.L of 1 × cDNA Dilution Buffer II, 2. mu.L of 3 'RACE Outer Primer (10. mu.M), 2. mu.L of 3' RACE forward Primer, 4. mu.L of 10 × LA PCR Buffer II (Mg 2)⁺Free), 3. mu.L of MgCl₂(25mM), 0.25. mu.L of TaKaRa LA

(5U/. mu.l), 28.75. mu.L of ddH₂O。

5' RACE: mu.L of cDNA, 8. mu.L of 1 × cDNA Dilution Buffer II, 2. mu.L of 5 'RACE Outerprimer (10. mu.M), 2. mu.L of 5' RACE reverse Primer, 4. mu.L of 10 × LA PCR Buffer II (Mg 2)⁺Free), 3. mu.L of MgCl2(25mM), 0.25. mu.L of TaKaRa LA

(5U/. mu.l), 28.75. mu.L of ddH₂O。

The PCR amplification conditions were:

core fragment: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 50 ℃ for 30s, extension at 72 ℃ for 1min, 30 cycles, and total extension at 72 ℃ for 5 min.

3’RACE：

1. Pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 52 ℃ for 30s, extension at 72 ℃ for 1min, 30 cycles, and total extension at 72 ℃ for 5 min.

2. Obtaining the PCR product diluted by 10 times in 1 as a template

Pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 1min, 30 cycles, and total extension at 72 ℃ for 5 min.

5’RACE：

1. Pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 1min, 30 cycles, and total extension at 72 ℃ for 5 min.

2. Obtaining the PCR product diluted by 10 times in 1 as a template

Pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 1min, 30 cycles, and total extension at 72 ℃ for 5min

PCR amplification product recovery was performed according to the procedure of the Kit for Taraka MiniBEST Agarose Gel DNAextraction Kit of Taraka, the target band obtained by amplification was recovered by electrophoresis Gel and linked to pMD18-T vector, the reaction system was 0.5. mu.L of md18-T Vertor, 2. mu.L of sert DNA, 2.5. mu.L of Solution I, 4. mu.C overnight linking, 1. mu.L of the ligation product was added to E.coli (Escherichia coil) DH5 α competent cells, after 30min on ice, after heat shock at 42 ℃ for 50s, they were quickly placed on ice for 2min, then 200. mu.L of liquid medium (containing NO antibiotic) was added, 1h (180r/min) was shake-cultured at 37 ℃, 100. mu.L of shake-cultured penicillin was evenly spread on benzyl-containing ampicillin, placed on ice for 2h (12-16h), single colony culture was randomly picked up and the sequence was compared with the sequence of Eupatatin gene encoding the full-length DNA sequence of the cDNA sequence of the target gene of the cDNA sequence of the cDNA encoding cDNA of the cDNA sequence of the cDNA encoding cDNA of the cDNA of the cDNA clone cDNA of the cDNA (cDNA of the cDNA of the cDNA clone of the cDNA of the cDNA of the cDNA of the cDNA of.

Example 3 analysis of expression regularity of EuTIDS5

In order to analyze the relationship between the expression of EuTIDS5 gene and rubber content in different tissues at different Time, the present invention adopts Real-Time quantitative PCR (Real-Time PCR) according to SYBR Premix Ex Taq of TaKaRa^TMThe kit instructions operate to amplify using a two-step process (amplification curve and dissolution curve). The relative expression of EuTIDS5 in leaves and fruits of eucommia ulmoides at different stages, RNA extraction and cDNA synthesis of leaves and fruits of eucommia ulmoides are the same as in example 1. The primers used were the housekeeping gene ACTIN forward (SEQ ID NO:13):

5’-TGAGATGCACCACGAAGCTC-3’

reverse (SEQ ID NO:14):

5’-CCAACATTGTCACCAGGAAGTG-3’,

and the gene-specific primer forward (SEQ ID NO:15):

5’–ACTTGGTTAGTCGTGAAAGC-3’，

reverse (SEQ ID NO:16) 5'-TAAAGCTCCTTCACTTTTGC-3'.

The results show that: EuTIDS5 was expressed in both leaves and fruits of eucommia ulmoides at different periods (see FIG. 2 for details), wherein the expression level of EuTIDS5 was significantly higher in the middle of 4 to 5 months than in other periods, the expression level of EuTIDS5 gene in fruits at the same period was higher than that in leaves by 90%, and the expression level of EuTIDS5 gene was highly expressed in fruits at young stage, which corresponds to the phenomenon that the gel content of fruits at the same period was higher than that of fruits at the same period, so that it was presumed that the expression of EuTIDS5 gene was related to the synthesis of eucommia ulmoides rubber. The relative expression of the EuTIDS5 gene in the leaves and fruits of eucommia ulmoides at different periods is analyzed in combination with the change rule of the growth rate of the rubber content of the leaves and fruits of eucommia ulmoides at different periods, the expression rule of the EuTIDS5 gene in the leaves and fruits of eucommia ulmoides at different periods is completely coincided with the rubber synthesis rule of the leaves and fruits of eucommia ulmoides (detailed figures 3 and 4), the expression amount of the EuTIDS5 gene in the fruits is higher than that of the leaves during the rapid rubber synthesis period, and the rule that the rubber content of the fruits at the same period is higher than that of the leaves is met, so that the EuTIDS5 gene is a key enzyme gene for synthesizing the eucommia ulmoides rubber.

EXAMPLE 4 construction of plant expression vectors

The invention adopts a Gateway method to construct a rubber synthesis key enzyme gene overexpression vector 35S, namely EuTIDS5 and an RNA interference vector RNAi-EuTIDS 5. The method comprises the following steps of constructing according to the construction requirements of Gateway carriers (which are already in circulation use by main scientific research institutions in China and are presented by subsidiary research institutes of the Chenjun of China forestry scientific research institute): cloning of target fragment, constructing entry vector and constructing expression vector.

1. Cloning of the fragment of interest

Primers were designed using Primer Premier 5.0 and the sequence with Gateway linker added to both ends of the Primer was as follows (the underlined part is the Gateway linker sequence):

forward (SEQ ID NO:17):

5’–GGGGACAACTTTGTACAAAAAAGTTGGAATGGCGGAAACGACCCA-3’

reverse (SEQ ID NO:18):

5’–GGCGGCCGCACAACTTTGTACAAGAAAGTTGGGTATCAATAATGCCTCCGATAGATCTT-3’。

RNAi primers:

forward (SEQ ID NO:19):

5’-GGGGACAACTTTGTACAAAAAAGTTGGAATGGCGGAAACGACCCA-3’

reverse (SEQ ID NO:20):

5’-GGCGGCCGCACAACTTTGTACAAGAAAGTTGGGTACGGACCAAACCTTATTATCT-3’，

cloning of the target fragment of the gene was performed by PCR amplification.

Gateway PCR reaction System 25. mu.L

HS DNA Polymerase, 1. mu.L Primer1 (10. mu. mol. L)^-1) And Primer2 (10. mu. mol. L)^-1) 1. mu.L of template DNA, 22. mu.L of sterilized ddH₂O。

The Gateway PCR cloning reaction condition is that the denaturation is carried out for 1min at the temperature of 98 ℃; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 15s, extension at 68 ℃ for 2min, and 8 cycles; denaturation at 98 ℃ for 10s, extension at 68 ℃ for 2min, 32 cycles; extension at 68 ℃ for 10 min.

2. Entry vector construction

Construction of entry vector according to Gateway BP clone Enzyme Mix kit ligation entry vector reaction system was 2. mu.L attB-PCR product, 0.4. mu.L pDONR222.1, 0.6. mu.L BP clone, gently mixed, briefly centrifuged to collect reaction fluid to the bottom of the centrifuge tube, linked overnight at 25 ℃, ligation reaction product transformed E.coli, 1. mu.L plasmid was added to E.coli (Escherichia coli) DH5 α competent cells, after 30min on ice, heat shock at 42 ℃ for 50s, rapidly placed on ice for 2min, then 200. mu.L liquid medium (without antibiotic) was added, shaking cultured at 37 ℃ for 1h (180r/min), 100. mu.L shaking cultured bacterial fluid was evenly spread on LB solid medium containing ampicillin, placed on 37 ℃ for overnight, inverted culture (12-16h) until single colony grows out, plasmid was picked up, and recombinant plasmid was extracted according to Axgenygen Enzyme Mix kit instructions.

3. Construction of expression vectors

The successful construction of the entry vector requires linearization to join the entry vector to the expression vector. The successfully constructed entry vector plasmid is digested by Mlu I restriction enzyme, and the digestion system is as follows: mu.L of Mlu I enzyme, mu.L of 10 XBuffer 3, 2. mu.L of BP reaction plasmid, 4.5. mu.L of sterilized ddH₂O。The Enzyme digestion product is subjected to LR recombination reaction according to the instructions of Gateway LR clone Enzyme Mix reagent, and the system is as follows: mu.L of linearized entry vector, 0.4. mu.L of expression vector, 0.6. mu.L of LRClonase, 1.8. mu.L of TE Buffer (pH 8.0), to subclone the fragment of interest into the expression vector.

Example 5 genetic transformation of tobacco

1 infection: taking a proper amount of tobacco sterile seedling leaves in a superclean workbench, uniformly scratching a plurality of wounds on the leaves in a direction vertical to a main vein by using a sterile blade, picking agrobacterium tumefaciens single bacterial colony containing a recombinant expression vector, and culturing to OD₆₀₀Putting the leaves in fresh bacterial liquid for infection for 15min, slightly rotating and oscillating the leaves during the infection, enabling the leaves to be fully contacted with the agrobacterium, and sucking the leaves with sterile absorbent paper after the infection is finished to prevent the agrobacterium from excessively growing in later experiments;

2, co-culture: placing the infected explants in a differentiation medium (MS + agar 5g/L + sucrose 30g/L + 6-BA0.5mg/L)

+ NAA0.05mg/L), dark culture (28 ℃, about 3d) until a small amount of Agrobacterium appears around the leaves;

3, selective culture: placing the infected tobacco leaves in a screening culture medium (MS + agar 5g/L + sucrose 30g/L +6-BA0.5mg/L + NAA0.05mg/L +200mg/L timentin +50mg/L hygromycin) for selective culture (24 ℃,16 h/8 h);

4, rooting culture: when the adventitious bud grows to about 2cm, the adventitious bud is transferred to a rooting medium (1/2MS + agar 5g/L + sucrose 30g/L +6-BA0.5mg/L + NAA0.05mg/L +200mg/L timentin +50mg/L hygromycin) for rooting culture (24 ℃,16 h/8 h).

Example 6 identification of transgenic plants

1. PCR detection of transgenic plants

The conventional CTAB method is adopted to extract the tobacco genome DNA (see Murray M et al Rapid isolation of high molecular weight plant DNA. nucleic Acids Research,1980,8: 4321-. Using tobacco genome DNA as template, adopting EuTIDS5 gene upstream and downstream specific primer to detect, forward primer 5' -AGAGCTAACTGATCATAA

AAAAGGG-3 ' reverse primer 5'-TCAATAATGCCTCCGATAGATCTT-3'. And adopting non-transgenic wild tobacco as negative control (-) to construct successful expression vector plasmid as positive control (+).

The PCR reaction program is: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 30s for 30 cycles; extending for 7min at 72 ℃; the PCR amplification products were detected by 1.0% agarose gel electrophoresis (see FIG. 5 for details), and transgenic positive plants were selected.

2. Real-time PCR detection of transcription expression of transgenic plant

The relative expression level of the over-expression of the identified tobacco positive plants on the transcription level is detected by using Real-time PCR, the RNA extraction and cDNA synthesis method of the transgenic tobacco leaves are the same as example 2, the Real-time PCR operation and the used primers are shown in example 3. The results show that the expression of EuTIDS5 gene in the transgenic tobacco was higher than that in the wild type tobacco (see FIG. 6 for details).

Example 7 gel content determination of transgenic plants

And collecting the determined transgenic tobacco plants, and determining the trans-isoprene content by using non-transgenic wild tobacco as a control. See example 1 for assay methods. The results show that the content of trans-isoprene in the wild type tobacco is not detected, while the content of trans-isoprene in the tobacco which is transgenic 35S: < EuTIDS5 > positive is detected to be 0.28%, which shows that EuTIDS5 participates in the synthesis of trans-isoprene, and the increase of the expression of EuTIDS5 gene is beneficial to the synthesis of trans-isoprene.

Example 8 expression vector construction

1) Cloning of the fragment of interest

The study used the Gateway method to construct subcellular localization, overexpression and RNA interference vectors. According to the requirement of the Gateway method for vector construction, primers are designed by using Primer Premier 5.0, sequences with Gateway linkers are added at two ends of the primers, and cloning of target fragments of genes is carried out by PCR amplification. The primers are detailed in Table 2, and the Gateway linker sequence is underlined.

TABLE 2 cloning primers for fragments of interest

PCR System for Gateway cloning is shown in Table 3 below

Table 3: PCR System for Gateway cloning

The Gateway PCR cloning reaction conditions are as follows: pre-denaturation at 98 ℃ for 1 min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 15s, extension at 68 ℃ for 2min, and 8 cycles; denaturation at 98 ℃ for 10s, extension at 68 ℃ for 2min, 32 cycles; extension at 68 ℃ for 10 min.

2) Entry vector construction

The procedure was performed according to the Gateway BP clone Enzyme Mix kit instructions, with the following ligation entry vector reaction system:

mix gently, centrifuge briefly, collect the reaction to the bottom of the centrifuge tube, 25 ℃, link overnight. 3) Ligation reaction product transformed into Escherichia coli

Adding 1 mu L of plasmid into Escherichia coli (Escherichia coil) DH5 α competent cells, standing on ice for 30min, performing heat shock at 42 ℃ for 50s, quickly putting on ice for 2min, adding 200 mu L of liquid culture medium (containing no antibiotics), performing shaking culture at 37 ℃ for 1h (180r/min), uniformly coating 100 mu L of shake-cultured bacterial liquid on an LB solid culture medium containing ampicillin, performing inversion culture at 37 ℃ for overnight (12-16h), picking a single colony in an LB liquid culture medium (containing 50mg/L ampicillin), performing PCR detection of the bacterial liquid, wherein the PCR reaction system is shown in the following table 4.

Table 4: PCR reaction system

The PCR amplification conditions were 94 ℃ for 4min for pre-denaturation, 94 ℃ for 30s, 60 ℃ for 30s, 72 ℃ for 60s for 30 cycles, and 72 ℃ for 10min for extension. The positive single colony bacteria liquid detected by PCR is sent to the company for sequencing. Adding sterilized glycerol into the positive clone bacterial liquid, and storing at-80 ℃ for later use.

4) Extraction of recombinant plasmids

The procedures were performed according to the instructions of the plasmid extraction kit from Axygen.

5) Construction of expression vectors

The successful construction of the entry vector requires linearization to join the entry vector to the expression vector. And (3) digesting the successfully constructed entry vector plasmid by using corresponding restriction Enzyme, and performing LR recombination reaction on the digestion product according to the instruction of the Gateway LR clone Enzyme Mix reagent so as to subclone the target fragment into the expression vector. The construction of the expression vector mainly comprises the construction of rubber synthesis related enzyme gene subcellular localization vectors pEarleyGate 101-EuGene and pEarleyGate104-EuGene, the construction of rubber synthesis key enzyme gene over-expression vectors pMDC32-EuGene and rubber synthesis key enzyme gene RNA interference vectors pH 7G-EuGene. The digestion and LR recombination reaction systems and reaction conditions are shown in Table 5 below.

Table 5: reaction system and reaction conditions

The Mlu I digestion system is shown in Table 6 below.

The reaction was terminated at 37 ℃ for 10h and 65 ℃ for 20 min.

Xba I digestion system is shown in Table 6 below.

Table 6: enzyme digestion reaction system

The reaction was terminated at 37 ℃ for 10h and 65 ℃ for 20 min.

The LR reaction system is shown in table 7 below.

Table 7: LR reaction system

Ligation was performed at 37 ℃ for 5 h.

EXAMPLE 9 transformation of Agrobacterium with expression vector

Adding 1 mu L of plasmid into competent cells of Agrobacterium tumefaciens strain GV3101, gently mixing, and adding into a precooled electric shock transformation cup for electric shock transformation. After electric shock transformation, adding competent cytoplasm with plasmid into 200 μ L liquid culture medium, culturing at 28 deg.C and 180rpm for 2 h; uniformly coating 100 mu L of bacterial liquid on a solid culture medium containing corresponding antibiotics, and performing inverted culture at 28 ℃ for 48 hours; and picking a single colony, shaking the bacteria at 28 ℃, 180rpm for 24 hours until the logarithmic phase of growth.

Example 10 transient expression transformation

1) After the agrobacterium is activated, selecting a monoclonal and adding the monoclonal into a liquid culture medium containing 50mg/L Gen, 17mg/L Rif and 50mg/L Ka antibiotics for shake culture at 28 ℃;

2) taking 500uL of the agrobacterium, detecting the concentration of the bacterial liquid, and using a heavy suspension (MgCl)₂Acetosyringone) heavy suspension bacterial liquid;

3) under the condition of weak light, a small amount of resuspended agrobacterium liquid is absorbed by an injector, the bacterial liquid is injected into the epidermal cells of the tobacco leaves, and the cells are placed and cultured for 6 hours in the dark and then are cultured under normal illumination (22 ℃,16 hours in the light and 8 hours in the dark);

4) after the 3 rd day of normal culture, the tobacco leaf injection area with a blade with the size of about 5mm multiplied by 5mm is placed in the center of the glass slide, a drop of clear water is dripped, the glass slide is covered to avoid generating bubbles, and a fluorescence signal is detected by a laser copolymerization fluorescence microscope.

Example 11 transformation of bark peeling and Performance Observation of eucommia ulmoides

A bark genetic transformation system of eucommia is established by utilizing the bark peeling regeneration principle of eucommia. Cortex Eucommiae (phloem)) Peeling into multiple 2cm × 2cm squares, exposing cambium layer on surface, culturing Agrobacterium single colony containing recombinant expression vector to OD₆₀₀And (3) repeatedly infecting the peeled eucommia surface cambium by using the bacterial liquid with the value of 0.6-0.8, so that the bacterial liquid is uniformly distributed on the surface of the cambium, and testing at different times of infection. Because the peeled cambium is exposed in the air, in order to prevent the trees from drying up and dying after being dehydrated, the peeled cambium is coated with a plastic film after being peeled and infected, the peeled cambium is moisturized and sun-protected, the infection efficiency is improved, and the splitting of immature xylem cells is accelerated under favorable conditions to form new periderm.

The results show that: after 3 infestations, there was no significant change in the cambium of the control and transformed at day 5 compared to the control (same tree was peeled but not transformed), after about 30 days both the cambium of the control and transformed grew green callus, and after about 90 days the bark had fully grown (see figure 7 for details). Observing the rubber content of the peeled bark, and comparing with a control, wherein in 35S, the rubber silk in the bark of the EuTIDS5 tree body is obviously increased, which shows that the rubber content in the bark is increased, and the rubber content of the new bark of eucommia bark after the bark is peeled again at the new bark is still kept higher; trans-RNAi-EuTIDS 5 the bark of the tree body contained significantly less glue silk, indicating a reduced glue content in the bark (see FIG. 8 for details). Therefore, the EuTIDS5 is proved to be beneficial to improving the content of the eucommia ulmoides rubber, and the reduction of the expression level of EuTIDS5 has an inhibiting effect on the synthesis of the eucommia ulmoides rubber. See table 8 for results.

TABLE 8

The above examples are provided for clarity of illustration only and are not intended to limit the invention to the particular embodiments described. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. Any obvious variations or modifications which come within the spirit and scope of the invention are desired to be protected by the following claims.

Claims (1)

1. The method for improving the gum content of eucommia ulmoides is characterized by comprising the following steps of:

1) peeling cortex Eucommiae into multiple lattices to form a lattice-spaced cambium with exposed surface; the single lattice area of the lattice is 2-10cm²；

2) Carrying out infection operation: infecting a bark-peeled surface cambium of eucommia with a bacterial solution cultured by agrobacterium tumefaciens single colony containing an EuTIDS5 recombinant expression vector; the bacterial liquid for single colony culture of agrobacterium tumefaciens containing the recombinant expression vector is obtained by the following method: adding plasmids containing EuTIDS5 into GV3101 competent cells, mixing gently, adding into a precooled electric shock transformation cup for electric shock transformation, adding competent cells with plasmids into a culture medium after electric shock transformation, culturing, taking liquid, uniformly coating on a solid culture medium containing corresponding antibiotics, carrying out inverted culture, picking single colony, shaking bacteria, and shaking bacteria to a logarithmic phase of growth; said composition comprising EuTIDS5The preparation method of the plasmid comprises the following steps: amplifying EuTIDS5 by PCR method, extracting plasmid containing EuTIDS5 after the transformation culture of the ligation plasmid; the upstream primer (5'-3') and the downstream primer (5'-3') of EuTIDS5 amplified by PCR are shown as SEQ ID NO. 3 and 4, respectively; OD of the bacterial liquid₆₀₀The value is 0.5 to 0.9; the sequence of EuTIDS5 is shown as SEQ ID NO. 2;

3) wrapping the peeled surface with plastic film after peeling and infection, moisturizing and sun-proof growth; the plastic film wrapping time is 20-100 days.

Images