CN114410607A - Thermophilic carboxylesterase mutant and application thereof - Google Patents

Abstract

The invention relates to the technical field of genetic engineering, in particular to a thermophilic carboxylesterase mutant and application thereof. The thermophilic carboxylesterase mutant provided by the invention is obtained by mutating thermophilic carboxylesterase of bacillus wustiti, the optimum pH value is 8.0, the optimum temperature is 60 ℃, the thermal stability is good under the conditions of pH8.0 and 70 ℃, and after 60-DEG C incubation for 60h, about 40% of residual enzyme activity is still remained. And the carboxylesterase is kept at 70 ℃ for 1h, the carboxylesterase still has good enzyme activity and is suitable for the requirement of industrial application, the expression enzyme activity of the mutant in yeast is 387U/mg, and the application space is wider.

Description

Thermophilic carboxylesterase mutant and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a thermophilic carboxylesterase mutant and application thereof.

Background

Carboxylesterases (EC 3.1.1.1) as important industrial enzymes catalyzing hydrolysis of carboxylic esters, which are one of esterases, do not require coenzymes and are tolerant to organic solvents based on their regiospecificity, stereospecificity, broad substrate specificity, and are attractive catalysts. Carboxylic esterases belong to the family of α/β hydrolases, hydrolyze water-soluble, small molecular substances containing ester bonds to produce the product alcohol and carboxylic acid. Carboxylesterases generally catalyze the hydrolysis of water-soluble, shorter (<10 carbon atoms) fatty acid chain esters (Le L T H L, Yoo W, Jeon S, et al. Characterisation and mobilization of a novel SGNH family esterases (LaSGNH1) from Lactobacillus acidophilus NCFM. International Journal of Biological Macromolecules,2020,21(1): 91; Bhatt P, Huang Y, Zhan H, et al. Brault G, Sharek F, Hubertise Y, et al. isolation and catalysis of EstC, a new color-active esterase core A3(2). ploS, 7(3): 32041).

The carboxylesterase has wide application, and several carboxylesterases derived from bacteria or fungi have become biological catalysts for commercial use, and are widely applied to various industries, such as food, pharmacy, cosmetics, organic synthesis, detergents, biofuels and seasoning production.

However, the catalytic reaction of a conventional carboxylesterase cannot be carried out under severe conditions such as high temperature, inappropriate salinity, inappropriate pH, or the presence of a strong concentration of an organic solvent. Therefore, it is necessary to conduct a large number of screening, and attempts are made to screen carboxylesterases having specific properties from existing or unearthed microorganisms, or to improve catalytic performance by modifying the structures of existing carboxylesterases. For example, carboxylesterase Est5250 derived from Bacillus thermophilus thermocleare has a strong tolerance to various organic solvents (Yang Y, Ghatge S, Hur H G. characteristics of a novel thermostable carboxylesterase from Thermoalkaline Bacillus thermocardium Bacillus thermocyclaceae. biosci. Biotech.Bioch.2019,83(5): 882. 891).

However, at present, pesticide residues or overproof pesticide are caused by excessive or irregular use of pesticide, so that the environment is seriously polluted and even the living of organisms is harmed. In the degradation of pesticides, the environment of enzyme reaction is harsh, so that it is important to further research on thermophilic carboxylesterase with good tolerance.

Disclosure of Invention

In view of the above, the present invention provides a thermophilic carboxylesterase mutant with good stability and its application.

The thermophilic carboxylesterase mutant provided by the invention has the advantage that the 160 th methionine in the wild amino acid sequence shown as SEQ ID NO. 1 is mutated into lysine.

In the present invention, the thermophilic carboxylesterase mutant is designated Est₇₄₁The amino acid sequence is shown in SEQ ID NO. 2. The mutant is derived from carboxylesterase of Bacillus stearothermophilus, and has stronger stability and higher enzyme activity compared with a wild type. The carboxylesterase mutant has high catalytic property and good stability at high temperature, and has wide industrial application prospect.

The invention also provides a method for coding the thermophilic carboxylesterase mutant Est₇₄₁The nucleic acid of (1).

The nucleic acid sequence of the wild thermophilic carboxylesterase is shown as SEQ ID NO 3. The 478-480 nucleic acid is codon encoding methionine, and the 478-480 nucleic acid in the mutant encoding nucleic acid sequence of the invention is codon encoding lysine, for example, it can be AAA or AAG. In some embodiments, the gene encoding the thermophilic carboxylesterase mutant Est₇₄₁The sequence of the nucleic acid of (1) is shown in SEQ ID NO. 4.

The invention also provides an expression vector comprising the inventionThe coded thermophilic carboxylesterase mutant Est₇₄₁The nucleic acid of (1).

The invention also provides a host cell transformed or transfected with the expression vector.

The expression vector of the invention can be a shuttle vector which is preserved in escherichia coli and expresses protein in yeast. The skeleton vector of the expression vector is pPIC 9K. The escherichia coli is escherichia coli DH5 alpha, and the yeast is pichia pastoris.

The preparation method of the mutant comprises the following steps: culturing the host cell of the invention, and inducing the expression of the mutant.

In the preparation method of the invention, the inducer for inducing is methanol. The culture medium is liquid BMGY medium.

Mutant Est provided by the invention₇₄₁The nucleic acid, the expression vector, the host cell or the product prepared by the preparation method are applied to degradation of ester substances.

In the present invention, the esters include C2 to C16 esters, including p-nitrophenyl acetate (C2), p-nitrophenyl butyrate (C4), p-nitrophenyl hexanoate (C6), p-nitrophenyl octanoate (C8), p-nitrophenyl decanoate (C10), p-nitrophenyl laurate (C12), p-nitrophenyl myristate (C14), and p-nitrophenyl palmitate (C16). The esters of the invention also include ester insecticides. For example, the esters include pyrethrins, pyrethroids, and malathion.

The invention also provides a product for degrading ester substances, which is characterized by comprising the mutant Est of the invention₇₄₁The nucleic acid, the expression vector, the host cell or the product prepared by the preparation method are applied to degradation of ester substances.

The product for degrading the ester substances provided by the invention is a microbial inoculum or an immobilized enzyme preparation. In the embodiment of the invention, the product for degrading the ester substances is a packed bed bioreactor. The reactor comprises an inner filling of the mutant Est of the invention₇₄₁Double-layer sleeveThe double-layer sleeve is made of glass or polyvinyl chloride.

The invention also provides a method for degrading ester substances, which comprises the step of treating the ester substances with the product.

In some embodiments, the method for degrading ester substances comprises passing the pollutants through the packed bed bioreactor of the invention, and incubating and degrading at 60 ℃.

The invention provides a thermophilic carboxylesterase mutant, which is obtained by mutating thermophilic carboxylesterase of thermophilic bacillus wustiti, has the optimum pH value of 8.0 and the optimum temperature of 60 ℃, has good thermal stability at 70 ℃ under the condition of pH value of 8.0, and still retains about 40 percent of residual enzyme activity after 60-hour incubation at 60 ℃. And the carboxylesterase is kept at 70 ℃ for 1h, the carboxylesterase still has good enzyme activity and is suitable for the requirement of industrial application, the expression enzyme activity of the mutant in yeast is 387U/mg, and the application space is wider.

Drawings

FIG. 1: protein electrophoresis pattern of induction expression of thermophilic bacillus wuchersonii carboxylesterase pichia KM71 recombinant bacteria under 1% methanol, wherein M is protein Marker, 1-2 is Est₇₄₁Est 3-4 on the third and fifth days of induction_741MInduction on the third and fifth days;

FIG. 2 shows a standard curve for p-nitrophenol (p-NP);

FIG. 3 shows recombinant carboxylesterase Est₇₄₁And Est_741MThe optimum pH of (1);

FIG. 4 shows recombinant carboxylesterase Est₇₄₁And Est_741MThe optimum substrate of (1);

FIG. 5 shows recombinant carboxylesterase Est₇₄₁And Est_741MThe optimum temperature of (2);

FIG. 6 shows recombinant carboxylesterase Est₇₄₁And Est_741MTemperature resistance of (a);

FIG. 7 shows the chemical reagent versus recombinant carboxylesterase Est_741MThe influence of (a);

FIG. 8 shows a packed bed bioreactor for biodegradation of pesticides;

FIG. 9 shows a malathion standard curve;

FIG. 10 shows the immobilized enzyme lx-Est_741MThe degradation effect on the malathion is shown, wherein a is the content of the malathion measured by using malathion residual test paper; from left to right: malathion standard, lx-Est_741MResults of malathion concentrations of 10mg/L, 20mg/L, 50mg/L for the catalytic reaction, blank (not containing malathion), b, c show the detection of immobilized enzyme 1x-Est by HPLC_741MThe degradation effect on malathion;

FIG. 11 shows the detection wavelength of bifenthrin, pictures after degradation reaction and HPLC detection results before and after reaction, wherein a shows UV-Vis absorption spectrum of bifenthrin, b shows the picture of solution change before and after biodegradation reaction of bifenthrin, c shows the HPLC detection sample after bifenthrin standard and river water are added with bifenthrin standard, and d shows immobilized enzyme 1x-Est_741MHPLC plots before and after degrading bifenthrin wastewater;

FIG. 12 shows the immobilized enzyme lx-Est_741MCan be repeatedly used.

Detailed Description

The invention provides a thermophilic carboxylesterase mutant and application thereof, and a person skilled in the art can use the content for reference and appropriately modify the process parameters to realize the thermophilic carboxylesterase mutant. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. With regard to the definitions and terminology in this field, the expert can refer in particular to Current Protocols in Molecular Biology (Ausubel). The abbreviations for amino acid residues are standard 3-letter and/or 1-letter codes used in the art to refer to one of the 20 commonly used L-amino acids.

The invention provides a thermophilic carboxylesterase from thermophilic bacillus wucherii, the amino acid sequence of which is as follows: MKIVPPKPFFFEAGERAALLLHGFTGNSADVRMLGRFLESKGYTCHAPIYKGHGVPPEELVRTGPDDWWQDVMNSYQFLKNKGYEKIAVAGLSLGGVFSLKLGYTVPIEGIVTMCAPMYVKSEETMYEGVLEYAREYKKREGKSAEQIEQEMERFKQTPMKTLKALQELIADVRAHLDLVYAPTFVVQARHDEMINPDSANIIYNEIESPVKRIKWYEQSGHVITLDQEKDQLHEDIYAFLESLDW (SEQ ID NO: 1).

The nucleic acid sequence of the thermophilic carboxylesterase of the thermophilic Bacillus wustitus shown in SEQ ID NO. 1 is as follows: atgaaaattgttccgccgaagccgtttttctttgaagccggggagcgggcggcgctgcttttgcacggattcactggcaattcggctgacgttcggatgctcgggcgattccttgaatcgaaaggctacacatgccatgccccgatttacaaagggcacggcgtgccgccggaagagctcgtccgcaccgggccggacgattggtggcaagacgttatgaacagctatcagtttttaaaaaacaaaggttacgaaaaaattgccgtggccgggttgtcgcttggaggggtattttcgttgaaattaggttacactgtacctatagaagggattgtgacgatgtgcgcgccgatgtatgtcaaaagcgaggaaacgatgtatgaaggcgtcctcgagtatgcgcgcgaatataaaaagcgggaaggaaaatcggccgaacaaatcgaacaggaaatggaacggttcaagcagacgccgatgaagacgttgaaagccttacaggagctcattgccgatgtgcgcgcccatcttgatttggtttatgcaccgacgttcgtcgtccaagcgcgccatgatgagatgatcaatcccgacagcgcgaacatcatttataacgaaattgaatcgccggtcaaacggatcaaatggtatgagcagtctggccatgtgattacgcttgatcaagaaaaagatcagctgcatgaagatatttatgcatttcttgaatcgttagattggtaa (SEQ ID NO: 2).

The invention provides a mutant with carboxylesterase activity, which is characterized in that methionine at the 160 th site of an amino acid sequence shown as SEQ ID NO. 1 is mutated into lysine, namely est_741MThe encoded amino acid sequence is: MKIVPPKPFFFEAGERAALLLHGFTGNSADVRMLGRFLESKGYTCHAPIYKGHGVPPEELVRTGPDDWWQDVMNSYQFLKNKGYEKIAVAGLSLGGVFSLKLGYTVPIEGIVTMCAPMYVKSEETMYEGVLEYAREYKKREGKSAEQIEQEMERFKQTPKKTLKALQELIADVRAHLDLVYAPTFVVQARHDEMINPDSANIIYNEIESPVKRIKWYEQSGHVITLDQEKDQLHEDIYAFLESLDW (SEQ ID NO:3, denoted as Est)_741M)

The nucleic acid sequence of the thermophilic carboxylesterase mutant of the thermophilic Bacillus wustitus shown in SEQ ID NO. 3 is as follows: atgaaaattgttccgccgaagccgtttttctttgaagccggggagcgggcggcgctgcttttgcacggattcactggcaattcggctgacgttcggatgctcgggcgattccttgaatcgaaaggctacacatgccatgccccgatttacaaagggcacggcgtgccgccggaagagctcgtccgcaccgggccggacgattggtggcaagacgttatgaacagctatcagtttttaaaaaacaaaggttacgaaaaaattgccgtggccgggttgtcgcttggaggggtattttcgttgaaattaggttacactgtacctatagaagggattgtgtcgatgtgcgcgccgatgtatgtcaaaagcgaggaaacgatgtatgaaggcgtcctcgagtatgcgcgcgaatataaaaagcgggaaggaaaatcggccgaacaaatcgaacaggaaatggaacggttcaagcagacgccgaagaagacgttgaaagccttacaggagctcattgccgatgtgcgcgcccatcttgatttggtttatgcaccgacgttcgtcgtccaagcgcgccatgatgagatgatcaatcccgacagcgcgaacatcatttataacgaaattgaatcgccggtcaaacggatcaaatggtatgagcagtctggccatgtgattacgcttgatcaagaaaaagatcagctgcatgaagatatttatgcatttcttgaatcgttagattggtaa (SEQ ID NO: 4).

The invention clones and obtains a new thermostable carboxylesterase gene from Geobacillus uzenensis, discovers that an enzyme protein coded by the gene has excellent enzymological properties, and can be applied to production processes such as catalytic reaction of ester hydrolysis and the like. Meanwhile, the engineering bacteria capable of expressing carboxylesterase in large quantity are successfully cloned, large-scale production of the carboxylesterase can be realized, and the method becomes the basis of subsequent industrial application.

In the process of degrading pesticides by microorganisms, the growth and metabolism of microorganisms are greatly influenced by the surrounding environment. This environmental impact can be eliminated if the degradation reaction can use the corresponding pesticide-degrading enzyme. In addition, the pesticide degrading enzyme has better environmental tolerance, high catalytic reaction efficiency, safe application and easy wide pesticide degradation. The mutant provided by the invention can effectively degrade bifenthrin.

Degradation experiments on the pesticide malathion are carried out: when the concentration of malathion is 20mg/L, 50U of immobilized enzyme lx-Est_741MAfter 40 minutes of reaction, the marathion removal was 95.8%. In addition, to the degradation reaction of pyrethroid pesticides, Est_741MHas better degradation effect on bifenthrin. Subsequent use of immobilized enzyme lx-Est with pesticide degradation capability_741MAnd processing bifenthrin in water through a packed bed reactor. Namely, a 10mL column packed bed reactor is used for treating 500mg/L bifenthrin wastewater. After the reaction conditions are optimized, the removal rate of bifenthrin reaches 90.4 percent. And is subjected to continuous reaction of 10 batches of bifenthrin pesticide degradationAfter that, immobilized lx-Est_741M72% of the initial activity was retained. During the wastewater treatment process, the degradation of pesticides and the hydrolysis of oil in wastewater can be simultaneously realized. The continuous packed bed reactor is capable of efficiently treating wastewater and exhibits excellent performance in terms of high stability and simplified operation.

The test materials adopted by the invention are all common commercial products and can be purchased in the market. The invention is further illustrated by the following examples:

example 1 amplification of carboxylesterase and its mutant Gene

1.1 strains and their culture

The carboxylesterase gene disclosed by the invention is cloned from Bacillus thermophilus (Geobacillus uzenensis), can be directly purchased from German microorganism strain collection center, and has the strain number of DSMZ 23157. Therefore, the bacillus wustitus of the present invention can be obtained through a commercial way, and can also be obtained through field collection and other ways.

Inoculating glycerol strain to No. 1 culture medium, culturing at 50 deg.C for 48 hr, and collecting thallus for genome extraction.

1.2 genome extraction

Refer to general bacterial genomic DNA Rapid extraction kit instructions.

1.3 amplification of the thermophilic Bacillus wustitus carboxylesterase Gene

Finding out the gene sequence of carboxylesterase of the similar species of the Bacillus wustitensis on NCBI, designing a primer, carrying out PCR amplification by taking genome DNA as a template, and sequencing the obtained PCR product. The sequencing result shows that the nucleic acid fragment obtained by PCR amplification comprises a restriction enzyme site and a nucleic acid fragment with a nucleotide sequence shown in SEQ ID NO. 3; the nucleotide sequence shown in SEQ ID NO. 3 is 743bp in total, and the coding sequence shown in SEQ ID NO. 1 is 246 amino acid residues in total. The nucleic acid fragment having the nucleotide sequence shown by SEQ ID NO. 3 was named est₇₄₁. A nucleic acid fragment having the nucleotide sequence shown in SEQ ID NO. 3 can also be prepared by artificial synthesis.

1.4 Synthesis of nucleic acid sequence encoding Bacillus stearothermophilus carboxylesterase mutant

Mutant Est_741MThe coding nucleic acid sequence is synthesized by Nanjing Jinslei Biotechnology GmbH, the nucleic acid sequence is shown as SEQ ID NO. 4, the coded amino acid sequence is shown as SEQ ID NO. 2, and the total number of amino acid residues is 246, wherein the 160 th amino acid is mutated into lysine from methionine in a wild type amino acid sequence shown as SEQ ID NO. 1.

Example 2 construction and expression of recombinant expression vector of Pichia pastoris containing carboxylesterase and its mutant

2.1 recombinant expression vector pPIC9K-Est₇₄₁Construction of

Plasmid is extracted from Escherichia coli DH5 alpha host bacteria containing pPIC9K by using an AxyPrep plasmid DNA extraction kit (the operation steps refer to an instruction book), the pPIC9K plasmid is subjected to double digestion by Not I and EcoR I (purchased from Thermo), the digestion product and the gene fragment amplified in the example 1 are connected under the action of T4 DNA ligase to obtain a recombinant plasmid, the recombinant plasmid is transformed into Escherichia coli DH5 alpha (purchased from Tiangen Biochemical technology, Inc. (Beijing) Limited), positive clones are verified by PCR and sequenced, the sequencing result is compared on NCBI and analyzed to show that the obtained carboxylate gene DNA consists of 741 nucleotides, and the sequence is shown as SEQ ID NO: 3. The DNA codes for 246 amino acids, and the sequence is shown in SEQ ID NO 1.

2.2 recombinant expression vector pPIC9K-Est_741MConstruction of

Recombinant expression vector pPIC9K-Est_741MSynthesized by Nanjing Kingsler Biotech GmbH, in E.coli DH5 alpha host.

2.3 Pichia pastoris expression System

pPIC9K-Est with Sal I₇₄₁Carrying out single enzyme digestion, transferring the linearized recombinant plasmid into pichia pastoris competent cells by an electrotransformation method, and screening by using G418 plates containing different concentration gradients. Selecting transformants grown on a high-concentration G418(4mg/mL) plate, inoculating the transformants into a 250mL triangular flask containing 25mL liquid BMGY medium, and culturing at 30 ℃ and 220r/min for 18 h; after centrifugation at 6000rpm and 4 ℃ for about 10min, the cells were collected and resuspended in 250mL Erlenmeyer flask containing 25mL of liquid BMMY medium at 30 ℃ and 220 ℃r/min, during the culture process, methanol is supplemented every 24h, and the final concentration of the methanol is 1% (v/v) every time; sampling every 24h while deleting the methanol induced expression, measuring the enzyme activity of the crude enzyme solution, centrifuging the fermentation liquor at 6000rpm for 10min when the enzyme activity reaches the maximum, collecting the supernatant and the thalli, and storing at-40 ℃.

pPIC9K-Est_741MYeast transformation and induction expression are the same as above.

FIG. 1: protein electrophoresis pattern of induction expression of thermophilic bacillus wuchersonii carboxylesterase pichia KM71 recombinant bacteria under 1% methanol, wherein M is protein Marker, 1-2 is Est₇₄₁Est 3-4 on the third and fifth days of induction_741MInduction on the third and fifth days.

EXAMPLE 3 carboxylesterase enzyme Activity assay

3.1 Standard Curve plotting

The p-nitrophenol stock solution prepared at a concentration of 50mM was diluted 10-fold and added to an Ep tube according to the following table system, and the absorbance was measured at 405 nm. At the concentration and OD of p-nitrophenol (p-NP)₄₀₅Values were plotted as a standard curve. The results of the experiment are shown in FIG. 2.

Reaction system:

serial number	5mM p-NP	Concentration of p-NP	50mM Tris-HCl buffer
				1	0	0	1000μL
2	1μL	5μM	999μL
				3	2μL	10μM	998μL
4	4μL	20μM	996μL
				5	6μL	30μM	994μL
6	8μL	40μM	992μL
				7	12μL	60μM	988μL

3.2 enzyme Activity assay

The carboxylesterase enzyme activity determination method is characterized in that the enzyme activity of the carboxylesterase is defined by hydrolyzing p-nitrophenol ester to generate a product p-nitrophenol (p-NP) which has an ultraviolet absorption peak (yellow) at 405nm and finally detecting the amount of the generated p-NP. 1 unit enzyme activity (U): the carboxylesterase required to produce 1. mu. moL of product p-NP per unit time. Solutions of each substrate (25mM) were mixed with isopropanol in a 3:1 volume ratio: and (4) preparing a dimethyl sulfoxide solution. And (3) determining an enzyme activity system: 2mL of EP tube, 900. mu.L of buffer, 20. mu.L of substrate solution were mixed, and 20. mu.L of the appropriate diluted carboxylesterase solution was added. Reacting for 5min under the condition of the optimal temperature of the enzyme, adding 1mL of 95% ethanol into the system to terminate the reaction, then measuring the light absorption value (405nm), and obtaining the enzyme activity by contrasting a standard curve (p-nitrophenol) (using a sample of a blank control test tube to zero a spectrophotometer).

EXAMPLE 4 determination of the enzymatic Properties of the recombinant carboxylesterase

4.1 optimal reaction substrate assay: the optimum substrates were first determined by measuring the ability of carboxylesterases to hydrolyze various p-nitrophenol ester (C2-C16) substrates in phosphate buffer at pH 7.0, the test substrates including: p-nitrophenyl acetate (C2), p-nitrophenyl butyrate (C4), p-nitrophenyl hexanoate (C6), p-nitrophenyl octanoate (C8), p-nitrophenyl decanoate (C10), p-nitrophenyl laurate (C12), p-nitrophenyl myristate (C14), p-nitrophenyl palmitate (C16). Wherein the highest enzyme activity is set as 100%.

As shown in FIG. 4, Est was determined after purification₇₄₁And Est_741MThe results of the enzymology property show that Est₇₄₁And Est_741MThe most suitable substrates of (A) are p-nitrophenylhexanoate (C6), short-chain fatty acids, but mutated Est_741MThe enzyme activity is slightly improved.

4.2 determination of optimum reaction temperature: the optimum reaction temperature of carboxylesterase was determined by using Tris-HCl buffer (substrate C6) of pH8.0 in a standard reaction system at a temperature gradient of 30-80 ℃ with the highest enzyme activity set at 100%.

As shown in FIG. 5, it was revealed that the recombinant carboxylesterase Est₇₄₁The optimum reaction temperature of the enzyme is 50 ℃, and the enzyme activity is still more than 80 percent at the temperature of 60 ℃. Mutant Est_741MThe optimum temperature of (2) is also 60 ℃ and the specific Est₇₄₁The optimum temperature of the enzyme is 10 ℃ higher, and the enzyme activity is still more than 80 percent at 70 ℃.

4.3 determination of optimum pH: the optimum pH was determined by measuring the enzyme activity at 50 ℃ with C6 as a substrate and in different buffers at pH 4.0 to 10.0 (pH 4.0-5.0: 50mM citrate buffer, pH 6.0-7.0: 50mM sodium phosphate buffer, pH8.0 50mM Tris-hydrochloric acid buffer, pH 9.0-10.0: 50mM glycine-sodium hydroxide buffer), with the highest enzyme activity set at 100%.

As shown in FIG. 3, Est₇₄₁The optimum pH of (1) is 8.0, and the enzyme activity is greatly influenced when the pH is higher or lower. Est_741MThe optimum pH of (1) is the same as that of the wild type.

4.4 thermal stability analysis: the thermostability was assessed by incubating the enzyme at a temperature (50 ℃, 60 ℃, 70 ℃) for 60 hours to determine its residual enzyme activity. The enzyme activity of the control (enzyme before incubation) was 100% activity, and each group was assayed 3 times.

As shown in FIG. 6, Est₇₄₁After 60h incubation at 60 ℃ 41.8% of the residual enzyme activity remained, but when the temperature was 70 ℃, only 20% of the maximum enzyme activity was observed after 2h incubation. Purified Est was determined using the same treatment_741MThermal stability of (2). No major difference in enzyme activity was observed at 60 ℃ but at 70 ℃ with Est₇₄₁(1.3h) comparison, Est_741MTemperature resistance of (2) shows T_1/2The increase is 2.5 h. The enzyme is proved to have excellent thermal stability and meet the requirements of industrial application.

4.5 Effect of chemical Agents on Carboxylic esterase enzyme Activity

For practical applications, the effect of various surfactants and some chemicals on the carboxylesterase activity was also determined, and this study experimented with the addition of several typical chemicals (e.g., SDS, CTAB, Tween-20, Tween-80, TritonX-100 and the chelating agent EDTA) to the reaction system, incubation for 1 hour and determination of their effect on the carboxylesterase activity.

As shown in FIG. 7, the surfactants SDS and Tween20 had little effect on the carboxylesterase activity, CTAB and TritonX-100 reduced the enzyme activity, while EDTA improved the enzyme activity. These results indicate that the common chelating agent EDTA and the classical surfactant SDS have little effect on enzyme activity. The carboxylesterase is suitable for industrial application and can be used as a substitute for chemical catalysts in wastewater treatment.

Example 5 degradation of pesticides by recombinant carboxylesterase

5.1 Experimental reagents

Several pesticide standards were purchased at the national center for standards, simulating different concentrations of pesticide contaminated wastewater by adding different concentrations of commercially available pesticides to the domestic water. The malathion rapid test card was purchased from oasis food technology (Guangzhou) Inc. All other chemicals were analytically pure or HPLC pure and purchased from local markets.

5.2 other materials

The experiment used a column reactor, which consisted of double-walled glass with a length of 10cm and an internal diameter of 1.0cm, a packed volume of 10mL, a 0.22 μm filter installed at the inlet and outlet of the column, and all openings closed with silicon tubes with cork stoppers. Delivery pump BT1002(LongerPump, baoding, china).

5.3 Experimental methods

5.3.1 arrangement of pesticide degradation reactor

The self-made small-sized column reactor consists of double-layer polyvinyl chloride tubes, and the volume is 10 mL. A proper amount of immobilized enzyme lx-Est is added_741MPlaced in the reactor and passed through a transfer pump BT 1002. A certain rate (0.7mL/min) of substrate (e.g. p-nitrophenol hexanoate) incubated at 60 ℃ was pumped into the reactor to verify the feasibility of the reactor.

The type of reactor is chosen taking into account the status of the enzyme used in the experiment, the nature of the enzyme, the physicochemical properties of the reaction substrate, the conditions of the enzymatic reaction, the stability of the carboxylesterase, the operating requirements of the reaction and the versatility and practicality of the application. Based on the results of the previous studies, the catalytic properties of carboxylesterase on pesticides, and the morphology and properties of immobilized enzymes, a classical PBR (packed bed reactor) was selected for this experiment. Immobilizing enzyme lx-Est with certain mass_741MLoading into a designed column reactor, fixing both ends, screwing down nuts, and loading immobilized enzyme lx-Est into column_741MAnd (3) carrying out moderate compaction to fix the immobilized enzyme therein for subsequent operation. Then the bottom to be reactedThe material is pumped by a pump and flows into the column reactor from bottom to top at a certain speed. The packed bed column reactor of this experiment was set up as shown in FIG. 8.

As shown in the device sequence chart of fig. 8, the specific operation steps are as follows:

1. substrate pretreatment: dissolving pesticide (commercially available or standard) in water, adding salt solution with certain concentration, adjusting pH to about 8.0, heating the baked cake, stirring for about 20min, and adjusting pH of the substrate solution to about 8.0.

2. The pretreated substrate (pesticide) solution is input into the immobilized enzyme lx-Est by a constant-speed delivery pump_741MThe immobilized enzyme and the substrate are allowed to contact and react in the reactor for a sufficient period of time.

3. After the reaction is finished, collecting the treated liquid, and using a proper amount of buffer solution to ensure that the immobilized enzyme lx-Est in the reactor is_741MThe reaction was continued for the next batch by washing 3 times and then repeating the above steps. The enzyme activity obtained in the first reaction was defined as 100%, and the reaction was repeated 10 times to test the number of times the immobilized enzyme could be reused.

5.3.2 lx-Est_741MDegradation of organophosphorus pesticide malathion

For using lx-Est_741MThe enzymatic degradation of pesticides such as malathion has many advantages, which can be summarized as follows:

the enzyme catalysis reaction has high specificity, can not affect the external environment conditions of microorganism growth and catalysis efficiency, has low function efficiency of a whole cell system under high salinity or dilution conditions without affecting enzyme basically, can be applied to various environments with malnutrition which is not beneficial to microorganism growth, is harmless to the environment, can not generate toxic and harmful byproducts which are generated by microorganism conversion, can produce the enzyme microorganism non-engineering bacteria, has higher production speed, can be produced in large batch, has high economic benefit, and can bear various changes of wider temperature and pH microenvironment. These advantages are advantageous for the development of novel carboxylesterases Est₇₄₁Can be applied on an industrial scale. At the same time, the immobilized enzyme orThe soluble enzyme can eliminate the pollution of pesticide such as malathion, and has great significance for restoring ecological environment.

The degradation conditions of the organophosphorus pesticide malathion are as follows: placing the reaction system in a 10mL conical flask, adding immobilized enzyme lx-Est_741MThe final concentration of the substrate malathion for the reaction was 10 to 50mg/L, and the reaction was carried out at 150rpm and 50 ℃ for 100 minutes, and a sample was taken at 20 minutes, and 3 experiments were repeated. The solution after completion of the reaction was extracted twice with n-hexane. After centrifugation at 12000 Xg for 10 minutes, the supernatant was transferred to a new EP tube, and n-hexane in the supernatant was evaporated and then redissolved with methanol. Standard malathion was treated the same and used as a control. Results of control HPLC. The HPLC conditions for detecting the degradation effect of malathion were as follows: ZORBAX Eclipse XDB C18, column temperature 30 ℃, mobile phase: methanol: water 68.5: 31.5(v/v), flow rate 1.0 mL/min. The sample was filtered through a 0.45 μm filter, and the amount of sample was 20 μ L, and the detection wavelength was 220 nm.

5.3.3 lx-Est_741MFor degradation of pyrethroid pesticides

1x-Est_741MThree pyrethroid insecticides (fenvalerate, cypermethrin and bifenthrin) were degraded for evaluation of 1x-Est_741MThe degradation capability of the pyrethroid pesticide. Degradation conditions of pyrethroids: first, a preliminary experiment was performed in a 10mL reaction system. Immobilizing enzyme lx-Est_741MAdded to the pesticide solution with a substrate final concentration of 100-800mg/mL and reacted at 150rpm and 50 ℃ for 20-100 minutes, and samples were taken every 20 minutes. After adjusting the pH of the 1mol/L hydrochloric acid solution to 3.0, the lower organic phase was collected by extraction twice with an equal volume of dichloromethane. Then evaporating the dichloromethane at normal temperature, re-dissolving the dichloromethane by using a certain volume of methanol, and treating a wastewater sample containing bifenthrin by using the same treatment method by using the reactor. The liquid chromatography conditions were as follows: ZORBAX Eclipse XDB C18, column temperature 25 ℃, mobile phase: methanol: the water flow was 80:20(v/v) and the flow rate was 1.0 mL/min. The sample was filtered through a 0.45 μm filter, and the amount of sample was 20 μ L, and the detection wavelength was 206 nm.

5.3.4 treatment of bifenthrin-containing wastewater with a reactor

Weighing a proper amount of bifenthrin, respectively dissolving the bifenthrin into 100mL of tap water and river water, placing the bifenthrin into a beaker or a conical flask, adjusting the final concentration of the bifenthrin to be 500mg/mL, and adjusting the pH to be about 8.0 (comparing with a standard substance to judge the reliability of an experimental analysis method). The reacted bottle is placed in a constant temperature water bath kettle at 50 ℃, and is conveyed to a kettle filled with 2.5g of immobilized enzyme 1x-Est by a pump_741MIn the column reactor, the solution is finally collected for detection. After the wastewater solution from the outlet of the reactor was introduced into the collection pipe, 10mL of the wastewater treatment solution was collected as one reaction batch, and then the next reaction was carried out. The enzyme activity of the first batch of reaction is 100 percent, and the immobilized enzyme 1x-Est after each batch of reaction is measured_741MCatalytic activity, whereby 1x-Est in the reactor was evaluated_741MDegradation ability and stability of repeated operation.

5.4 Experimental results and discussion

5.4.1 lx-Est_741MEffect on degradation of malathion

Although malathion is widely used due to its good physicochemical properties, its large-scale production and large-scale use pose a threat to the environment, and it also pollutes water, air and even soil. Malathion is also detected in general river water environments, and the concentration range is 0.001 to 0.6mg/L, which also has an influence on the survival of organisms. When the malathion content is 0.06ppb, the malathion is extremely toxic to freshwater fishes and some invertebrate fishes, and the toxicity of the malathion is hereditary and causes severe damage to tissues and DNA of the fishes. In addition, malathion pollution can also harm human health, and reports that under a certain malathion concentration, the malathion can cause oxidative stress reaction of human livers and has toxic effect on tissues and cells, and the malathion pollution environment can change cell proliferation and influence human hormones.

In order to study the concentration of malathion on lx-Est_741MThe influence of degradation effect, the reaction is firstly carried out in a 10mL flask, and malathion with the final concentration of 10-50mg/L is added in a reaction system. Due to TLCThe steps of the malathion color development method are complex, the standard malathion solution is adopted in the experiment, the result is finally preliminarily detected by adopting convenient and visible market malathion residual test paper, the result is further verified by HPLC (high performance liquid chromatography), and a standard curve of the malathion is shown in FIG. 9.

The test paper for the degradation results is shown as a in fig. 10, the malathion standard shows no color on the test paper, indicating the presence of malathion and a pesticide concentration of over 1mg/L (the concentration of the actual dropwise added malathion standard is 10 mg/L). lx-Est_741MThe residual concentration of the malathion after the reaction can be observed primarily by testing the intensity of the color of the test paper card, and the darkest blue is a blank group without the malathion in the system. When the concentration of the malathion is 20mg/L, the degradation effect is the best: the reaction temperature is 60 ℃, and the enzyme is immobilized at 1x-Est in 50U_741MAfter 40 minutes of reaction, the maximum removal of malathion was 95.8%. This indicates Est_741MHas the capability of degrading organophosphorus pesticide malathion. In addition, b and c in FIG. 10 confirmed the carboxylesterase Est by determining the peak time of malathion at 6.2 minutes by HPLC and performing quantitative analysis₇₄₁Can degrade malathion.

This experiment tested lx-Est at 60 ℃ and pH8.0_741MProbably because the enzyme activity is lost after the immobilization, the degradation efficiency is not as good as that of free enzyme Est_741MThe effect of (2) is good. Carboxylesterase Est_741MThe condition for degrading the pesticide is simple and mild. Compared with the reaction condition of free enzyme, the immobilized enzyme lx-Est_741MCan be recycled, improves the tolerance of the enzyme and reduces the use cost of the enzyme. The carboxylesterase lx-Est_741MThe removal rate of the malathion reaches 95.8 percent. Thus, the biocatalyst lx-Est of the present invention_741MCan be applied in the environment polluted by malathion on a large scale.

5.4.2 lx-Est_741MEffect on bifenthrin degradation

First, we chose to use the immobilized enzyme lx-Est in a 10mL reaction system with a stoppered flask_741MThe hydrolysis rates for 3 pesticides (bifenthrin, fenvalerate and fenpropathrin) were tested. 1x-Est was found_741MBifenthrin, then fenpropathrin, then fenvalerate can be efficiently degraded (table 1). Due to carboxylesterase lx-Est_741MThe degradation efficiency of the latter two pesticides is low, the experiment is mainly aimed at optimizing the degradation conditions of bifenthrin, and a packed bed reactor is designed to treat wastewater containing bifenthrin.

TABLE 1 lx-Est_741MSubstrate specificity of

For further practical application, 10mL of packed bed column reactor is used for degrading bifenthrin in the experiment, the condition of common wastewater is simulated, bifenthrin with a certain concentration is added into water, and 1x-Est is tested_741MThe result of the ability to degrade pyrethroid pesticide waste water is shown in FIG. 11. In the reactor, the bifenthrin solution as the substrate flows through the membrane from top to bottom of the reactor and is mixed with the immobilized enzyme 1x-Est_741MAnd (4) reacting. The results showed that 2.5g of immobilized enzyme 1x-Est was used_741MThe mixture was charged into a 10mL column reactor, and the final concentration of bifenthrin was 500 mg/L. Reaction conditions are as follows: the reaction temperature is 60 ℃, the pump speed is 0.7mL/min (optimization data not shown), and the bifenthrin detection method is established in the experiment. The measurement of the results is shown in fig. 11, which shows that the maximum absorption wavelength of bifenthrin is around 220nm, indicating that the content of bifenthrin can be measured by the absorbance at 220 nm. (b) Shows the change of the clarity before and after the degradation of the wastewater and shows 1x-Est_741MFor wastewater treatment, the solution becomes clear and possibly other fatty substances are also degraded. (c) The result of HPLC detection after the same treatment of the standard or the wastewater added with bifenthrin shows that the peak time of bifenthrin is about 3.5min, which proves that the detection method established by the experiment has reliability. The final degradation result is shown in the figure, after the reactor treatment, 1x-Est_741MTo contain coupletThe degradation rate of the waste water of the phenothrin reaches 90.4 percent.

The catalytic stability of the resin and the regeneration conditions of the resin are crucial in the continuous catalytic reaction, and the application of the resin catalyst to the continuous production of biodiesel has good effect, but the operation stability of the reactor and the regeneration of the resin are not ideal in many researches. In this study, the immobilized enzyme lx-Est was studied using a laboratory scale reactor (packed bed reactor) with a biocatalyst_741MThe performance of treating bifenthrin wastewater, and the degradation reaction of bifenthrin is continuously carried out in PBR. In the operation process, after a batch of treatment liquid at the outlet of the reactor is introduced into the collecting pipe, the detection of the result is carried out after the time of finishing each reaction (namely collecting one column volume of treatment liquid), and in order to further verify the accuracy of the detection result, an experiment of the accuracy of the bifenthrin analysis method is also carried out, which shows that the recovered result is between 86 and 92 percent and has reliability.

TABLE 2 Experimental results on the accuracy of bifenthrin analysis method

Actual dock, adding a certain amount of bifenthrin standard sample into a bifenthrin suspension sample in missible oil with the known content of 20 percent; the organic dock: bifenthrin standard sample (treated the same).

As shown in figure 12, after 10 batches of continuous reaction for the degradation of bifenthrin pesticide, the immobilized lx-Est_741MHas high operation stability and maintains 72 percent of initial activity.

lx-Est_741MCan exert advantages in the recycling of waste water treatment. The results show that PBR (packed bed reactor) contributes to the degradation of bifenthrin in wastewater and has good operational stability. Meanwhile, in the wastewater treatment process, the degradation of pesticides and the hydrolysis of oil in wastewater can be simultaneously realized. The treated solution became clear and no surface oil slick appeared.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that it is obvious to those skilled in the art that various modifications and improvements can be made without departing from the principle of the present invention, and these modifications and improvements should also be considered as the protection scope of the present invention.

Sequence listing

<110> Shanghai Wei high medical technology development Co., Ltd

<120> thermophilic carboxylesterase mutant and application thereof

<130> MP22002761

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 246

<212> PRT

<213> Bacillus wuchersonii thermophilus (Geobacillus uzenensis)

<400> 1

Met Lys Ile Val Pro Pro Lys Pro Phe Phe Phe Glu Ala Gly Glu Arg

1 5 10 15

Ala Ala Leu Leu Leu His Gly Phe Thr Gly Asn Ser Ala Asp Val Arg

20 25 30

Met Leu Gly Arg Phe Leu Glu Ser Lys Gly Tyr Thr Cys His Ala Pro

35 40 45

Ile Tyr Lys Gly His Gly Val Pro Pro Glu Glu Leu Val Arg Thr Gly

50 55 60

Pro Asp Asp Trp Trp Gln Asp Val Met Asn Ser Tyr Gln Phe Leu Lys

65 70 75 80

Asn Lys Gly Tyr Glu Lys Ile Ala Val Ala Gly Leu Ser Leu Gly Gly

85 90 95

Val Phe Ser Leu Lys Leu Gly Tyr Thr Val Pro Ile Glu Gly Ile Val

100 105 110

Thr Met Cys Ala Pro Met Tyr Val Lys Ser Glu Glu Thr Met Tyr Glu

115 120 125

Gly Val Leu Glu Tyr Ala Arg Glu Tyr Lys Lys Arg Glu Gly Lys Ser

130 135 140

Ala Glu Gln Ile Glu Gln Glu Met Glu Arg Phe Lys Gln Thr Pro Met

145 150 155 160

Lys Thr Leu Lys Ala Leu Gln Glu Leu Ile Ala Asp Val Arg Ala His

165 170 175

Leu Asp Leu Val Tyr Ala Pro Thr Phe Val Val Gln Ala Arg His Asp

180 185 190

Glu Met Ile Asn Pro Asp Ser Ala Asn Ile Ile Tyr Asn Glu Ile Glu

195 200 205

Ser Pro Val Lys Arg Ile Lys Trp Tyr Glu Gln Ser Gly His Val Ile

210 215 220

Thr Leu Asp Gln Glu Lys Asp Gln Leu His Glu Asp Ile Tyr Ala Phe

225 230 235 240

Leu Glu Ser Leu Asp Trp

245

<210> 2

<211> 741

<212> DNA

<213> Bacillus wuchersonii thermophilus (Geobacillus uzenensis)

<400> 2

atgaaaattg ttccgccgaa gccgtttttc tttgaagccg gggagcgggc ggcgctgctt 60

ttgcacggat tcactggcaa ttcggctgac gttcggatgc tcgggcgatt ccttgaatcg 120

aaaggctaca catgccatgc cccgatttac aaagggcacg gcgtgccgcc ggaagagctc 180

gtccgcaccg ggccggacga ttggtggcaa gacgttatga acagctatca gtttttaaaa 240

aacaaaggtt acgaaaaaat tgccgtggcc gggttgtcgc ttggaggggt attttcgttg 300

aaattaggtt acactgtacc tatagaaggg attgtgacga tgtgcgcgcc gatgtatgtc 360

aaaagcgagg aaacgatgta tgaaggcgtc ctcgagtatg cgcgcgaata taaaaagcgg 420

gaaggaaaat cggccgaaca aatcgaacag gaaatggaac ggttcaagca gacgccgatg 480

aagacgttga aagccttaca ggagctcatt gccgatgtgc gcgcccatct tgatttggtt 540

tatgcaccga cgttcgtcgt ccaagcgcgc catgatgaga tgatcaatcc cgacagcgcg 600

aacatcattt ataacgaaat tgaatcgccg gtcaaacgga tcaaatggta tgagcagtct 660

ggccatgtga ttacgcttga tcaagaaaaa gatcagctgc atgaagatat ttatgcattt 720

cttgaatcgt tagattggta a 741

<210> 3

<211> 246

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Lys Ile Val Pro Pro Lys Pro Phe Phe Phe Glu Ala Gly Glu Arg

1 5 10 15

Ala Ala Leu Leu Leu His Gly Phe Thr Gly Asn Ser Ala Asp Val Arg

20 25 30

Met Leu Gly Arg Phe Leu Glu Ser Lys Gly Tyr Thr Cys His Ala Pro

35 40 45

Ile Tyr Lys Gly His Gly Val Pro Pro Glu Glu Leu Val Arg Thr Gly

50 55 60

Pro Asp Asp Trp Trp Gln Asp Val Met Asn Ser Tyr Gln Phe Leu Lys

65 70 75 80

Asn Lys Gly Tyr Glu Lys Ile Ala Val Ala Gly Leu Ser Leu Gly Gly

85 90 95

Val Phe Ser Leu Lys Leu Gly Tyr Thr Val Pro Ile Glu Gly Ile Val

100 105 110

Thr Met Cys Ala Pro Met Tyr Val Lys Ser Glu Glu Thr Met Tyr Glu

115 120 125

Gly Val Leu Glu Tyr Ala Arg Glu Tyr Lys Lys Arg Glu Gly Lys Ser

130 135 140

Ala Glu Gln Ile Glu Gln Glu Met Glu Arg Phe Lys Gln Thr Pro Lys

145 150 155 160

Lys Thr Leu Lys Ala Leu Gln Glu Leu Ile Ala Asp Val Arg Ala His

165 170 175

Leu Asp Leu Val Tyr Ala Pro Thr Phe Val Val Gln Ala Arg His Asp

180 185 190

Glu Met Ile Asn Pro Asp Ser Ala Asn Ile Ile Tyr Asn Glu Ile Glu

195 200 205

Ser Pro Val Lys Arg Ile Lys Trp Tyr Glu Gln Ser Gly His Val Ile

210 215 220

Thr Leu Asp Gln Glu Lys Asp Gln Leu His Glu Asp Ile Tyr Ala Phe

225 230 235 240

Leu Glu Ser Leu Asp Trp

245

<210> 4

<211> 741

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgaaaattg ttccgccgaa gccgtttttc tttgaagccg gggagcgggc ggcgctgctt 60

ttgcacggat tcactggcaa ttcggctgac gttcggatgc tcgggcgatt ccttgaatcg 120

aaaggctaca catgccatgc cccgatttac aaagggcacg gcgtgccgcc ggaagagctc 180

gtccgcaccg ggccggacga ttggtggcaa gacgttatga acagctatca gtttttaaaa 240

aacaaaggtt acgaaaaaat tgccgtggcc gggttgtcgc ttggaggggt attttcgttg 300

aaattaggtt acactgtacc tatagaaggg attgtgtcga tgtgcgcgcc gatgtatgtc 360

aaaagcgagg aaacgatgta tgaaggcgtc ctcgagtatg cgcgcgaata taaaaagcgg 420

gaaggaaaat cggccgaaca aatcgaacag gaaatggaac ggttcaagca gacgccgaag 480

aagacgttga aagccttaca ggagctcatt gccgatgtgc gcgcccatct tgatttggtt 540

tatgcaccga cgttcgtcgt ccaagcgcgc catgatgaga tgatcaatcc cgacagcgcg 600

aacatcattt ataacgaaat tgaatcgccg gtcaaacgga tcaaatggta tgagcagtct 660

ggccatgtga ttacgcttga tcaagaaaaa gatcagctgc atgaagatat ttatgcattt 720

cttgaatcgt tagattggta a 741

Claims (10)

1. A thermophilic carboxylesterase mutant characterized in that the methionine at position 160 in the amino acid sequence of wild-type thermophilic carboxylesterase as shown in SEQ ID NO 1 is mutated to lysine.

2. A nucleic acid encoding the mutant of claim 1.

3. The nucleic acid of claim 1, wherein the nucleic acid sequence is set forth in SEQ ID NO. 4.

4. An expression vector comprising the nucleic acid of claim 2 or 3.

5. A host cell transformed or transfected with the expression vector of claim 4.

6. A method for preparing the mutant of claim 1, comprising: culturing the host cell of claim 4, and inducing expression of the mutant.

7. Use of the mutant according to claim 1, the nucleic acid according to claim 2 or 3, the expression vector according to claim 4, the host cell according to claim 5 or the product of the preparation process according to claim 6 for the degradation of esters.

8. Use according to claim 7, characterized in that the esters comprise pyrethrins, pyrethroids and malathion.

9. A product for degrading esters, comprising the mutant of claim 1, the nucleic acid of claim 2 or 3, the expression vector of claim 4, the host cell of claim 5 or the product obtained by the method of claim 6.

10. A method of degrading esters comprising treating with the product of claim 9.

Images