CN114774387A - Thermophilic carboxylesterase mutants and application thereof - Google Patents

Abstract

The invention relates to the technical field of genetic engineering, in particular to a thermophilic carboxylesterase mutant and application thereof. The thermophilic carboxylesterase mutant provided by the invention is obtained by mutating thermophilic carboxylesterase of bacillus wustiti, the optimum pH value is 8.0, the optimum temperature is 60 ℃, the thermal stability is good under the conditions of pH 8.0 and 70 ℃, and after 60-DEG C incubation for 60h, about 40% of residual enzyme activity is still remained. The carboxylesterase still has good enzyme activity after being kept at 70 ℃ for 1 hour, and is suitable for the requirements of industrial application, the expression enzyme activity of the mutant in yeast is 387U/mg, and the application space is wider.

Description

Thermophilic carboxylesterase mutants and application thereof

The present application claims priority from the chinese patent application entitled "mutant thermophilic carboxylesterase and use thereof" filed by the chinese patent office at 22/03/2022 under the application number 202210282464.0, the entire contents of which are incorporated herein by reference.

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a thermophilic carboxylesterase mutant and application thereof.

Background

Carboxylesterases (EC 3.1.1.1), which are important industrial enzymes that catalyze the hydrolysis of carboxylic esters, are one of esterases, do not require coenzymes for the reaction and are tolerant to organic solvents based on their regiospecificity, stereospecificity, broad substrate specificity, and are attractive catalysts. Carboxylic esterases belong to the family of α/β hydrolases, hydrolyze water-soluble, small molecular substances containing ester bonds to produce the product alcohol and carboxylic acid. Carboxylesterases are generally catalysts for the hydrolysis of water soluble, shorter (<10 carbon atoms) fatty acid chain esters (Le L T H L, Yoo W, Jeon S, et al. Characterization and catalysis of a novel SGNH family esterases (LaSGNH1) from Lactobacillus acidophilus NCFM. intellectual Journal of Biological Macromolecules, 2020, 21 (1): 91; Bhatt P, Huang Y, Zhan H, et al. Brault G, Shareck F, Hurtuse Y, et al. isolation and catalysis of EstC, a new Cold-active 2012 strain microorganism A3(2), ploS One, 7 (3): 32041).

The carboxylesterase has wide application, and several carboxylesterases derived from bacteria or fungi have become biological catalysts for commercial use, and are widely applied to various industries, such as food, pharmacy, cosmetics, organic synthesis, detergents, biofuels and seasoning production.

However, the catalytic reaction of the conventional carboxylesterase cannot be carried out under severe conditions, such as high temperature, inappropriate salinity, inappropriate pH, or the presence of a strong concentration of an organic solvent. Therefore, it is necessary to conduct a large number of screenings, and attempts are being made to screen carboxylesterases having specific properties from existing or unearthed microorganisms, or to modify the structures of existing carboxylesterases, thereby to improve the catalytic performance thereof. For example, carboxylesterase Est5250 derived from Bacillus thermophilus thermoclearae has a strong tolerance to various organic solvents (Yang Y, Ghatge S, Hur H G. Characterisation of a novel thermostable carboxylesterase from thermohalilic bacterium Bacillus thermocyclaceae. biosci. Biotech. Bioch.2019, 83 (5): 882-.

However, at present, pesticide residues or overproof pesticide are caused by excessive or irregular use of pesticide, so that the environment is seriously polluted and even the living of organisms is harmed. In the degradation of pesticides, the environment of enzyme reaction is harsh, so that there is great significance in further research on thermophilic carboxylesterase with good tolerance.

Disclosure of Invention

In view of the above, the present invention provides a thermophilic carboxylesterase mutant with good stability and the application thereof.

The invention provides a thermophilic carboxylesterase mutant which has the structural formula shown in SEQ ID NO: 1 to lysine in the amino acid sequence of the wild type shown in 1.

In the context of the present invention, the thermophilic carboxylesterase mutant is designated Est₇₄₁The amino acid sequence is shown as SEQ ID NO: 2, respectively. The mutant is derived from carboxylesterase of Bacillus stearothermophilus, and has stronger stability and higher enzyme activity compared with a wild type. The carboxylesterase mutant has high catalytic property and good stability at high temperature, and has wide industrial application prospect.

The invention also provides a codeThermophilic carboxylesterase mutant Est₇₄₁The nucleic acid of (1).

Nucleic acid sequence of wild-type thermophilic carboxylesterase SEQ ID NO: 3, respectively. The nucleotide sequence of the mutant of the present invention encodes a methionine-encoding codon at the 478-480 th nucleic acid, and the nucleotide sequence of the mutant of the present invention encodes a lysine-encoding codon at the 478-480 th nucleic acid, which may be AAA or AAG, for example. In some embodiments, the gene encoding the thermophilic carboxylesterase mutant Est₇₄₁The sequence of the nucleic acid of (a) is as shown in SEQ ID NO: 4, respectively.

The invention also provides an expression vector which comprises the coded thermophilic carboxylesterase mutant Est₇₄₁The nucleic acid of (1).

The invention also provides a host cell transformed or transfected with the expression vector.

The expression vector of the invention can be a shuttle vector which is preserved in escherichia coli and expresses protein in yeast. The skeleton vector of the expression vector is pPIC 9K. The escherichia coli is escherichia coli DH5 alpha, and the yeast is pichia pastoris.

The preparation method of the mutant comprises the following steps: the host cell of the present invention is cultured to induce the expression of the mutant.

In the preparation method of the invention, the inducer for induction is methanol. The culture medium for culturing is liquid BMGY medium.

The mutant Est of the invention₇₄₁The nucleic acid, the expression vector, the host cell or the product prepared by the preparation method are applied to degradation of ester substances.

In the present invention, the esters include C2 to C16 esters, including p-nitrophenyl acetate (C2), p-nitrophenyl butyrate (C4), p-nitrophenyl hexanoate (C6), p-nitrophenyl octanoate (C8), p-nitrophenyl decanoate (C10), p-nitrophenyl laurate (C12), p-nitrophenyl myristate (C14), and p-nitrophenyl palmitate (C16). The esters of the invention also include ester insecticides. For example, the esters include pyrethrins, pyrethroids, and malathion.

The invention also provides a product for degrading ester substances, which is characterized by comprising the mutant Est provided by the invention₇₄₁The nucleic acid, the expression vector, the host cell or the product prepared by the preparation method, and the application of the host cell or the product prepared by the preparation method in degradation of esters.

The product for degrading the ester substances is a microbial inoculum or an immobilized enzyme preparation. In the embodiment of the invention, the product for degrading the ester substances is a packed bed bioreactor. The reactor comprises a reactor filled with the mutant Est₇₄₁The double-layer sleeve is made of glass or polyvinyl chloride.

The invention also provides a method for degrading ester substances, which comprises the step of treating the ester substances with the product.

In some embodiments, the method for degrading ester substances comprises passing the pollutants through the packed bed bioreactor of the invention, and incubating and degrading at 60 ℃.

The invention provides a thermophilic carboxylesterase mutant, which is obtained by mutating thermophilic carboxylesterase of thermophilic bacillus wustitus, the optimum pH value of the mutant is 8.0, the optimum temperature is 60 ℃, the mutant has good thermal stability under the conditions of pH 8.0 and 70 ℃, and after incubation for 60 hours at 60 ℃, residual enzyme activity of about 40 percent is still remained. And the carboxylesterase is kept at 70 ℃ for 1h, the carboxylesterase still has good enzyme activity and is suitable for the requirement of industrial application, the expression enzyme activity of the mutant in yeast is 387U/mg, and the application space is wider.

Drawings

FIG. 1: protein electrophoresis pattern of induction expression of thermophilic bacillus wuchersonii carboxylesterase pichia KM71 recombinant bacteria under 1% methanol, wherein M is protein Marker, 1-2 is Est₇₄₁The third and fifth days of induction, 3-4 is Est_741MInduction on the third and fifth days;

FIG. 2 shows a standard curve for p-nitrophenol (p-NP);

FIG. 3 shows recombinant carboxylesterase Est₇₄₁And Est_741MThe optimum substrate of (4);

FIG. 4 shows recombinant carboxylesterase Est₇₄₁And Est_741MThe optimum temperature of (2);

FIG. 5 shows recombinant carboxylesterase Est₇₄₁And Est_741MThe optimum pH of (1);

FIG. 6 shows recombinant carboxylesterase Est₇₄₁And Est_741MTemperature resistance of (a);

FIG. 7 shows the chemical reagent versus recombinant carboxylesterase Est_741MThe influence of (a);

FIG. 8 shows a packed bed bioreactor for biodegradation of pesticides;

FIG. 9 shows a malathion standard curve;

FIG. 10 shows immobilized enzyme 1x-Est_741MThe degradation effect on the malathion is shown, wherein a is the content of the malathion measured by using malathion residual test paper; from left to right: malathion standard, 1x-Est_741MThe concentration of malathion in the catalytic reaction is 10mg/L, 20mg/L and 50mg/L, and the results are blank groups (without malathion), and b and c show that the immobilized enzyme 1x-Est is detected by HPLC_741MThe degradation effect on malathion is improved;

FIG. 11 shows the detection wavelength of bifenthrin, pictures after degradation reaction and HPLC detection results before and after reaction, wherein a shows UV-Vis absorption spectrum of bifenthrin, b shows the picture of solution change before and after biodegradation reaction of bifenthrin, c shows the HPLC detection sample after bifenthrin standard and river water are added with bifenthrin standard, and d shows immobilized enzyme 1x-Est_741MHPLC plots before and after degrading bifenthrin wastewater;

FIG. 12 shows immobilized enzyme 1x-Est_741MCan be repeatedly used.

Detailed Description

The invention provides a thermophilic carboxylesterase mutant and application thereof, and a person skilled in the art can use the content to realize the purpose by appropriately improving process parameters. It is specifically noted that all such substitutions and modifications will be apparent to those skilled in the art and are intended to be included herein. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations and modifications in the methods and applications disclosed herein, or appropriate variations and combinations thereof, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. With regard to definitions and terminology in this field, the expert may refer in particular to Current Protocols in Molecular Biology (Ausubel). Abbreviations for amino acid residues are standard 3-letter and/or 1-letter codes used in the art to refer to one of the 20 commonly used L-amino acids.

The invention provides a thermophilic carboxylesterase from thermophilic bacillus wucherii, the amino acid sequence of which is as follows: MKIVPPKPFFFEAGERAALLLHGFTGNSADVRMLGRFLESKGYTCHAPIYKGHGVPPEELVRTGPDDWWQDVMNSYQFLKNKGYEKIAVAGLSLGGVFSLKLGYTVPIEGIVTMCAPMYVKSEETMYEGVLEYAREYKKREGKSAEQIEQEMERFKQTPMKTLKALQELIADVRAHLDLVYAPTFVVQARHDEMINPDSANIIYNEIESPVKRIKWYEQSGHVITLDQEKDQLHEDIYAFLESLDW (SEQ ID NO: 1).

Encoding the amino acid sequence of SEQ ID NO: 1, the nucleic acid sequence of the thermophilic carboxylesterase of the thermophilic bacillus wustitensis is as follows: atgaaaattgttccgccgaagccgtttttctttgaagccggggagcgggcggcgctgcttttgcacggattcactggcaattcggctgacgttcggatgctcgggcgattccttgaatcgaaaggctacacatgccatgccccgatttacaaagggcacggcgtgccgccggaagagctcgtccgcaccgggccggacgattggtggcaagacgttatgaacagctatcagtttttaaaaaacaaaggttacgaaaaaattgccgtggccgggttgtcgcttggaggggtattttcgttgaaattaggttacactgtacctatagaagggattgtgacgatgtgcgcgccgatgtatgtcaaaagcgaggaaacgatgtatgaaggcgtcctcgagtatgcgcgcgaatataaaaagcgggaaggaaaatcggccgaacaaatcgaacaggaaatggaacggttcaagcagacgccgatgaagacgttgaaagccttacaggagctcattgccgatgtgcgcgcccatcttgatttggtttatgcaccgacgttcgtcgtccaagcgcgccatgatgagatgatcaatcccgacagcgcgaacatcatttataacgaaattgaatcgccggtcaaacggatcaaatggtatgagcagtctggccatgtgattacgcttgatcaagaaaaagatcagctgcatgaagatatttatgcatttcttgaatcgttagattggtaa (SEQ ID NO: 2).

The invention provides a mutant with carboxylesterase activity, which is represented by SEQ ID NO: 1 to lysine, i.e. est_741MThe encoded amino acid sequence is: MKIVPPKPFFFEAGERAALLLHGFTGNSADVRMLGRFLESKGYTCHAPIYKGHGVPPEELVRTGPDDWWQDVMNSYQFLKNKGYEKIAVAGLSLGGVFSLKLGYTVPIEGIVTMCAPMYVKSEETMYEGVLEYAREYKKREGKSAEQIEQEMERFKQTPKKTLKALQELIADVRAHLDLVYAPTFVVQARHDEMINPDSANIIYNEIESPVKRIKWYEQSGHVITLDQEKDQLHEDIYAFLESLDW (SEQ ID NO: 3, denoted as Est)_741M)

Encoding the polypeptide of SEQ ID NO: 3, the nucleic acid sequence of the thermophilic carboxylesterase mutant of the thermophilic bacillus wustitensis is as follows: atgaaaattgttccgccgaagccgtttttctttgaagccggggagcgggcggcgctgcttttgcacggattcactggcaattcggctgacgttcggatgctcgggcgattccttgaatcgaaaggctacacatgccatgccccgatttacaaagggcacggcgtgccgccggaagagctcgtccgcaccgggccggacgattggtggcaagacgttatgaacagctatcagtttttaaaaaacaaaggttacgaaaaaattgccgtggccgggttgtcgcttggaggggtattttcgttgaaattaggttacactgtacctatagaagggattgtgtcgatgtgcgcgccgatgtatgtcaaaagcgaggaaacgatgtatgaaggcgtcctcgagtatgcgcgcgaatataaaaagcgggaaggaaaatcggccgaacaaatcgaacaggaaatggaacggttcaagcagacgccgaagaagacgttgaaagccttacaggagctcattgccgatgtgcgcgcccatcttgatttggtttatgcaccgacgttcgtcgtccaagcgcgccatgatgagatgatcaatcccgacagcgcgaacatcatttataacgaaattgaatcgccggtcaaacggatcaaatggtatgagcagtctggccatgtgattacgcttgatcaagaaaaagatcagctgcatgaagatatttatgcatttcttgaatcgttagattggtaa (SEQ ID NO: 4).

The invention clones and obtains a new thermostable carboxylesterase gene from Geobacillus uzenensis, discovers that an enzyme protein coded by the gene has excellent enzymological properties, and can be applied to production processes such as catalytic reaction of ester hydrolysis. Meanwhile, the engineering bacteria capable of expressing carboxylesterase in large quantity are successfully cloned, large-scale production of the carboxylesterase can be realized, and the method becomes the basis of subsequent industrial application.

In the process of degrading pesticides by microorganisms, the growth and metabolism of microorganisms are greatly influenced by the surrounding environment. This environmental impact can be eliminated if the degradation reaction can use the corresponding pesticide-degrading enzyme. In addition, the pesticide degrading enzyme has good environmental tolerance, high catalytic reaction efficiency, safe application and easy wide pesticide degradation. The mutant provided by the invention can effectively degrade bifenthrin.

Pesticide malathionDegradation experiments were performed: when the concentration of malathion is 20mg/L, the enzyme is immobilized at 1x-Est in 50U_741MAfter 40 minutes of reaction, the marathion removal was 95.8%. In addition, Est is a degradation reaction of pyrethroid pesticides_741MHas better degradation effect on bifenthrin. Subsequent use of immobilized enzyme 1x-Est with pesticide degradation capability_741MAnd processing bifenthrin in water through a packed bed reactor. Namely, a 10mL column packed bed reactor is used for treating 500mg/L bifenthrin wastewater. After the reaction conditions are optimized, the removal rate of bifenthrin reaches 90.4 percent. And after continuous reaction of 10 batches of bifenthrin pesticide degradation, immobilized 1x-Est_741M72% of the initial activity was retained. During the wastewater treatment process, the degradation of pesticides and the hydrolysis of oil in wastewater can be simultaneously realized. The continuous packed bed reactor is capable of efficiently treating wastewater and exhibits excellent performance in terms of high stability and simplified operation.

The test materials adopted by the invention are all common commercial products and can be purchased in the market. The invention is further illustrated by the following examples:

example 1 amplification of carboxylesterase and its mutant Gene

1.1 strains and cultivation thereof

The carboxylesterase gene disclosed by the invention is cloned from Bacillus thermophilus (Geobacillus uzenensis), can be directly purchased from German microorganism strain collection center, and has the strain number of DSMZ 23157. Therefore, the bacillus wustitis provided by the invention can be obtained through a commercial way, and can also be obtained through field collection and other ways.

Inoculating glycerol strain to No. 1 culture medium, culturing at 50 deg.C for 48 hr, and collecting thallus for genome extraction.

1.2 genome extraction

Refer to general bacterial genomic DNA Rapid extraction kit instructions.

1.3 amplification of the thermophilic Bacillus wustitus carboxylase Gene

Finding the carboxylesterase gene sequence of similar species of Bacillus wustitus on NCBI, designing primer, and PCR amplification with genome DNA as templateAnd sequencing the obtained PCR product. Sequencing results show that the nucleic acid fragment obtained by PCR amplification comprises a restriction enzyme site and a nucleotide sequence with SEQ ID NO: 3; SEQ ID NO: 3, and the nucleotide sequence is total 743bp and codes SEQ ID NO: 1, and 246 amino acid residues in total. The peptide having the sequence of SEQ ID NO: 3 is named as est₇₄₁. The peptide having SEQ ID NO: 3.

1.4 Synthesis of nucleic acid sequences encoding a thermophilic Bacillus wurtzitterii carboxylesterase mutant

Mutant Est_741MThe coding nucleic acid sequence of (a) is synthesized by Nanjing Kingsrei Biotech Co., Ltd, and the nucleic acid sequence is shown as SEQ ID NO: 4, and the coded amino acid sequence is shown as SEQ ID NO: 2, and 246 amino acid residues in total, wherein the amino acid at position 160 consists of the amino acid sequence shown as SEQ ID NO: 1 to lysine.

Example 2 construction and expression of recombinant expression vector of Pichia pastoris containing carboxylesterase and its mutant

2.1 recombinant expression vector pPIC9K-Est₇₄₁Construction of

Coli DH5 α host bacteria containing pPIC9K were extracted with axypep plasmid DNA extraction kit (see the description for the procedure), and the pPIC9K plasmid was digested with Not I and EcoR I (purchased from thermo), and the digested product was ligated with the gene fragment amplified in example 1 above under the action of T4 DNA ligase to obtain a recombinant plasmid, which was transformed into escherichia coli DH5 α (purchased from tiangen biochemical technology (beijing) limited), PCR-verified positive clones and sequenced, and the sequencing results were aligned and analyzed at NCBI to show that the obtained carboxylate gene DNA consisted of 741 nucleotides, with the sequence as shown in SEQ ID NO: 3, respectively. The DNA codes for 246 amino acids, and the sequence of the DNA is shown as SEQ ID NO: 1.

2.2 recombinant expression vector pPIC9K-Est_741MConstruction of

Recombinant expression vector pPIC9K-Est_741MSynthesized by Nanjing Kingsrei Biotech GmbH, Inc., in DaiEnterobacter DH5 alpha host.

2.3 Pichia pastoris expression System

pPIC9K-Est with Sal I₇₄₁Carrying out single enzyme digestion, transferring the linearized recombinant plasmid into pichia pastoris competent cells by an electrotransformation method, and screening by using G418 plates containing different concentration gradients. Selecting transformants grown on high concentration G418(4mg/mL) plates, inoculating into 250mL triangular flasks containing 25mL liquid BMGY medium, and culturing at 30 ℃ and 220r/min for 18 h; after centrifugation at 6000rpm and 4 ℃ for about 10min, collecting thalli, using a liquid BMMY culture medium containing 25mL, suspending the thalli in a 250mL triangular flask, and supplementing methanol every 24h at 30 ℃ at 220r/min in the culture process, wherein the final concentration of the methanol is 1% (v/v) in each supplementing; sampling every 24h while deleting the methanol induced expression, measuring the enzyme activity of the crude enzyme solution, centrifuging the fermentation liquor at 6000rpm for 10min when the enzyme activity reaches the maximum, collecting the supernatant and the thalli, and storing at-40 ℃.

pPIC9K-Est_741MThe yeast transformation and induction expression are the same as above.

FIG. 1: protein electrophoresis pattern of induction expression of thermophilic bacillus wuchersonii carboxylesterase pichia KM71 recombinant bacteria under 1% methanol, wherein M is protein Marker, 1-2 is Est₇₄₁Est 3-4 on the third and fifth days of induction_741MInduction on the third and fifth days.

EXAMPLE 3 carboxylesterase enzyme Activity assay

3.1 Standard Curve plotting

The p-nitrophenol stock solution prepared at a concentration of 50mM was diluted 10-fold and added to an Ep tube according to the following table system, and the absorbance was measured at 405 nm. At concentration and OD of p-nitrophenol (p-NP)₄₀₅Values were plotted as a standard curve. The results of the experiment are shown in FIG. 2.

Reaction system:

serial number	5mM p-NP	Concentration of p-NP	50mM Tris-HCl buffer
				1	0	0	1000μL
2	1μL	5μM	999μL
				3	2μL	10μM	998μL
4	4μL	20μM	996μL
				5	6μL	30μM	994μL
6	8μL	40μM	992μL
				7	12μL	60μM	988μL

3.2 enzyme Activity assay

The carboxylesterase enzyme activity determination method is characterized in that the enzyme activity of the carboxylesterase is defined by hydrolyzing p-nitrophenol ester to generate a product p-nitrophenol (p-NP) which has an ultraviolet absorption peak (yellow) at 405nm and finally detecting the amount of the generated p-NP. 1 unit enzyme activity (U): the carboxylesterase required to produce 1. mu. moL of product p-NP per unit time. Solutions of each substrate (25mM) were prepared in 3: 1 by volume isopropanol dimethyl sulfoxide. And (3) determining an enzyme activity system: 2mL of EP tube, 900. mu.L of buffer, 20. mu.L of substrate solution were mixed, and 20. mu.L of the appropriate diluted carboxylesterase solution was added. Reacting for 5min under the condition of the optimal temperature of the enzyme, adding 1mL of 95% ethanol into the system to terminate the reaction, then measuring the light absorption value (405nm), and obtaining the enzyme activity by contrasting a standard curve (p-nitrophenol) (using a sample zero-setting spectrophotometer of a blank control test tube).

EXAMPLE 4 determination of the enzymatic Properties of the recombinant carboxylesterase

4.1 optimal reaction substrate assay: the optimum substrates were first determined by measuring the ability of carboxylesterases to hydrolyze various p-nitrophenol ester (C2-C16) substrates in phosphate buffer at pH 7.0, the test substrates including: p-nitrophenyl acetate (C2), p-nitrophenyl butyrate (C4), p-nitrophenyl hexanoate (C6), p-nitrophenyl octanoate (C8), p-nitrophenyl decanoate (C10), p-nitrophenyl laurate (C12), p-nitrophenyl myristate (C14), p-nitrophenyl palmitate (C16). Wherein the highest enzyme activity is set as 100%.

As shown in FIG. 4, Est was determined after purification₇₄₁And Est_741MThe results of the enzymology property show that Est₇₄₁And Est_741MThe most suitable substrates of (A) are p-nitrophenylhexanoate (C6), short-chain fatty acids, but mutated Est_741MThe enzyme activity is slightly improved.

4.2 determination of optimum reaction temperature: the optimum reaction temperature of carboxylesterase was determined by using Tris-HCl buffer (C6 as substrate) of pH 8.0 in a standard reaction system with a temperature gradient of 30-80 ℃ where the highest enzyme activity was set as 100%.

As shown in FIG. 5, it was revealed that recombinant carboxylesterase Est₇₄₁The optimal reaction temperature of (3) is 50 ℃, and the enzyme activity is still more than 80% under the condition of 60 ℃. Mutant Est_741MAlso has an optimum temperature of 60 ℃ in comparison with Est₇₄₁The optimum temperature of (2) is 10 ℃ higher, and the enzyme activity is still more than 80% under the condition of 70 ℃.

4.3 determination of optimum pH: the optimum pH was determined by measuring the enzyme activity at 50 ℃ with C6 as a substrate and in different buffers at pH 4.0 to 10.0 (pH 4.0-5.0: 50mM citrate buffer, pH 6.0-7.0: 50mM sodium phosphate buffer, pH 8.0 50mM Tris-hydrochloric acid buffer, pH 9.0-10.0: 50mM glycine-sodium hydroxide buffer), with the highest enzyme activity set at 100%.

As shown in FIG. 3, Est₇₄₁The optimum pH of (2) is 8.0, and the enzyme activity is greatly influenced when the pH is higher or lower. Est_741MThe optimum pH of (2) is the same as that of the wild type.

4.4 thermal stability analysis: the thermostability was assessed by incubating the enzyme at a temperature (50 ℃, 60 ℃, 70 ℃) for 60 hours to determine its residual enzyme activity. The enzyme activity of the control (enzyme before incubation) was 100% activity, and each group was assayed 3 times.

As shown in FIG. 6, Est₇₄₁After 60h incubation at 60 ℃ 41.8% of the residual enzyme activity remained, but when the temperature was 70 ℃, only 20% of the maximum enzyme activity was observed after 2h incubation. Purified Est was determined using the same treatment_741MThermal stability of (2). No major difference in enzyme activity was observed at 60 ℃ but at 70 ℃ with Est₇₄₁(1.3h) comparison, Est_741MTemperature resistance of (2) shows T_1/2The increase is 2.5 h. The thermal stability of the enzyme is shown to be excellent, and the enzyme meets the requirements of industrial application.

4.5 Effect of chemical Agents on Carboxylic esterase enzyme Activity

For practical applications, the effect of various surfactants and some chemicals on the carboxylesterase activity was also determined, and this study experimented with the addition of several typical chemicals (e.g., SDS, CTAB, Tween-20, Tween-80, TritonX-100, and the chelating agent EDTA) to the reaction system, incubation for 1 hour and determination of their effect on the carboxylesterase activity.

As shown in FIG. 7, the surfactants SDS and Tween20 had little effect on the carboxylesterase activity, CTAB and TritonX-100 reduced the enzyme activity, while EDTA improved the enzyme activity. These results indicate that the common chelating agent EDTA and the classical surfactant SDS have little effect on the enzymatic activity. The carboxylesterase is suitable for industrial applications and can be used as a substitute for chemical catalysts in wastewater treatment.

Example 5 degradation of pesticides by recombinant carboxylesterase

5.1 Experimental reagents

Several pesticide standards were purchased at the national center for standards, simulating different concentrations of pesticides polluting wastewater by adding different concentrations of commercially available pesticides to the domestic water. The malathion rapid test card was purchased from oasis food technology (Guangzhou) Inc. All other chemicals were analytically pure or HPLC pure and purchased from local markets.

5.2 other materials

The experiment adopted a column reactor, the reactor consisted of double-walled glass with a length of 10cm and an internal diameter of 1.0cm, a packed volume of 10mL, 0.22 μm filters installed at the inlet and outlet of the column, and all openings were closed with silicon tubes with cork stoppers. Transfer pump BT1002(LongerPump, baoding, china).

5.3 Experimental methods

5.3.1 arrangement of pesticide degradation reactor

The self-made small-sized column reactor consists of double-layer polyvinyl chloride tubes, and the volume is 10 mL. Adding proper amount of immobilized enzyme 1x-Est_741MPlaced in the reactor and passed through a transfer pump BT 1002. A certain rate (0.7mL/min) of substrate (e.g. p-nitrophenol hexanoate) incubated at 60 ℃ was pumped into the reactor to verify the feasibility of the reactor.

The type of reactor is selected taking into account the state of the enzyme used in the experiment, the nature of the enzyme, the reaction substrate, and the agricultural chemicalThe physicochemical properties of the drug, the conditions of the enzymatic reaction, the stability of the carboxylesterase, the operational requirements of the reaction, and the versatility and practicality of the application. In accordance with the results of the previous section, the catalytic properties of carboxylesterase on pesticides, and the morphology and properties of the immobilized enzyme, the classical PBR (packed bed reactor) was selected for this experiment. Immobilizing enzyme 1x-Est with a certain mass_741MLoading into designed column reactor, fixing both ends, screwing nut, and loading immobilized enzyme 1x-Est into column_741MAnd (3) carrying out moderate compaction to fix the immobilized enzyme therein for subsequent operation. Then the substrate to be reacted is conveyed by a pump and flows into the column reactor from bottom to top at a certain speed. The packed bed column reactor of this experiment was set up as shown in FIG. 8.

As shown in the apparatus sequence diagram of fig. 8, the specific operation steps are as follows:

1. substrate pretreatment: dissolving pesticide (commercially available or standard) in water, adding salt solution with certain concentration, adjusting pH to about 8.0, heating the baked cake, stirring for about 20min, and adjusting pH of the substrate solution to about 8.0.

2. The pretreated substrate (pesticide) solution is input into the immobilized enzyme 1x-Est by a constant-speed delivery pump_741MThe immobilized enzyme and the substrate are allowed to contact and react in the reactor for a sufficient period of time.

3. After the reaction is finished, collecting the treated liquid, and using a proper amount of buffer solution to ensure that the immobilized enzyme 1x-Est in the reactor is_741MThe reaction was continued for the next batch by washing 3 times and then repeating the above steps. The enzyme activity obtained in the first reaction was defined as 100%, and the reaction was repeated 10 times to test the number of times the immobilized enzyme could be reused.

5.3.2 1x-Est_741MDegradation of organophosphorus pesticide malathion

For the utilization of 1x-Est_741MThe enzymatic degradation of pesticides such as malathion has many advantages, which can be summarized as follows:

high specificity of enzyme catalytic reaction, can not be influenced slightlyThe method has the advantages of environmental conditions outside the biological growth and catalysis efficiency, low functional efficiency of a whole cell system under high salinity or dilution conditions without influence on enzyme basically, application to various environments with malnutrition which is not beneficial to microbial growth, no harm to the environment, no generation of toxic and harmful byproducts which are generated by microbial transformation, production of the enzyme microorganism un-engineered bacteria, high production speed, large-scale production, high economic benefit and capability of bearing various changes of wide temperature and pH microenvironment. These advantages are advantageous for the development of novel carboxylesterase Est₇₄₁Can be applied on an industrial scale. Meanwhile, the immobilized enzyme or soluble enzyme can eliminate the pollution of pesticides such as malathion and the like, and has great significance for restoring the ecological environment.

The degradation conditions of the organophosphorus pesticide malathion are as follows: placing the reaction system in a 10mL conical flask, adding immobilized enzyme 1x-Est_741MThe final concentration of the substrate malathion for the reaction was 10 to 50mg/L, and the reaction was carried out at 150rpm and 50 ℃ for 100 minutes, and a sample was taken at 20 minutes, and 3 experiments were repeated. The solution after completion of the reaction was extracted twice with n-hexane. After centrifugation at 12000 Xg for 10 minutes, the supernatant was transferred to a new EP tube, and n-hexane in the supernatant was evaporated and then redissolved with methanol. Standard malathion was treated the same way and used as a control. Results of HPLC were compared. The HPLC conditions for detecting the degradation effect of malathion were as follows: ZORBAX Eclipse XDB C18, column temperature 30 ℃, mobile phase: methanol to water was 68.5: 31.5(v/v) at a flow rate of 1.0 mL/min. The sample was filtered through a 0.45 μ tm filter, and the amount of sample was 20 μ L, with a detection wavelength of 220 nm.

5.3.3 1x-Est_741MFor degradation of pyrethroid pesticides

1x-Est_741MThree pyrethroid insecticides (fenvalerate, cypermethrin, and bifenthrin) were degraded for evaluation of 1x-Est_741MThe degradation capability of the pyrethroid pesticide. Degradation conditions of pyrethroids: first, a preliminary experiment was performed in a 10mL reaction system. Immobilizing enzyme 1x-Est_741MAdding into pesticide solution, and concentrating the substrateThe reaction was carried out at a concentration of 100 mg/mL and at 150rpm at 50 ℃ for 20 to 100 minutes, and samples were taken every 20 minutes. After adjusting the pH of the 1mol/L hydrochloric acid solution to 3.0, the lower organic phase was collected by extraction twice with an equal volume of dichloromethane. Then evaporating the dichloromethane at normal temperature, re-dissolving with a certain volume of methanol, and treating the wastewater sample containing bifenthrin by using the same treatment method. The liquid chromatography conditions were as follows: ZORBAX Eclipse XDB C18, column temperature 25 ℃, mobile phase: methanol to water was 80: 20(v/v) at a flow rate of 1.0 mL/min. The sample was filtered through a 0.45 μm filter, and the amount of sample was 20 μ L, and the detection wavelength was 206 nm.

5.3.4 treatment of wastewater containing bifenthrin with a reactor

Weighing a proper amount of bifenthrin, respectively dissolving the bifenthrin into 100mL of tap water and river water, placing the bifenthrin into a beaker or a conical flask, adjusting the final concentration of the bifenthrin to be 500mg/mL, and adjusting the pH to be about 8.0 (comparing with a standard product to judge the reliability of an experimental analysis method). The reacted bottle is placed in a thermostat water bath kettle at 50 ℃, and is conveyed by a pump to a kettle filled with 2.5g of immobilized enzyme 1x-Est_741MFinally, the solution is collected for detection. After the wastewater solution from the outlet of the reactor was introduced into the collection pipe, 10mL of the wastewater treatment solution was collected as one reaction batch, and then the next reaction was performed. The enzyme activity determined by the first batch of reaction is 100 percent, and the immobilized enzyme 1x-Est after each batch of reaction is determined_741MCatalytic activity, whereby 1x-Est in the reactor was evaluated_741MThe degradation ability and the stability of repeated operation.

5.4 Experimental results and discussion

5.4.1 1x-Est_741MEffect on malathion degradation

Although malathion is widely used due to its good physicochemical properties, its large-scale production and large-scale use pose a threat to the environment, and it also pollutes water, air and even soil. Malathion is also detected in general river water environments, and the concentration range is 0.001-0.6 mg/L, which also has influence on the survival of organisms. When the content of malathion is 0.06ppb, the malathion has a strong toxicity to existing freshwater fishes and some invertebrate fishes, and the toxicity of malathion is hereditary and has a serious damage to tissues and DNA of fishes. In addition, malathion pollution can also harm human health, and reports that under a certain malathion concentration, the malathion can cause oxidative stress reaction of human livers and has toxic effect on tissues and cells, and the malathion pollution environment can change cell proliferation and influence human hormones.

In order to study the concentration of malathion on 1x-Est_741MThe influence of degradation effect, the reaction is firstly carried out in a 10mL flask, and malathion with the final concentration of 10-50mg/L is added in a reaction system. As TLC is more complicated for the steps of the malathion color development method, the standard malathion solution is adopted in the experiment, the result is finally preliminarily detected by using convenient and visible malathion residual test paper sold on the market, and the result is further verified by HPLC (high performance liquid chromatography), and a standard curve of the malathion is shown in the following figure 9.

The test paper for the degradation results is shown as a in fig. 10, and the malathion standard shows no color on the test paper, indicating that malathion is present and the concentration of the pesticide exceeds 1mg/L (the concentration of the actually added malathion standard is 10 mg/L). 1x-Est_741MThe residual concentration of the malathion after reaction can be observed primarily by testing the intensity of the color of the test paper card, and the darkest blue is a blank group without the malathion in the system. When the concentration of the malathion is 20mg/L, the degradation effect is the best: the reaction temperature is 60 ℃, and the enzyme is immobilized at 1x-Est in 50U_741MAfter 40 minutes of reaction, the maximum removal of malathion was 95.8%. This indicates Est_741MHas the capability of degrading organophosphorus pesticide malathion. In addition, b and c in FIG. 10 confirmed the carboxylesterase Est by determining the peak time of malathion at 6.2 minutes by HPLC and performing quantitative analysis₇₄₁Can degrade malathion.

This experiment tested 1x-Est at 60 ℃ and pH 8.0_741MProbably because the enzyme activity is lost after the immobilization, the degradation efficiency is not as good as that of free enzyme Est_741MThe effect of (2) is good. Carboxylesterase Est_741MFor degradation of pesticidesThe conditions are simple and mild. Compared with the reaction condition of free enzyme, the immobilized enzyme 1x-Est_741MCan be recycled, improves the tolerance of the enzyme and reduces the use cost of the enzyme. The carboxylesterase 1x-Est_741MThe removal rate of the marathon reaches 95.8 percent. Thus, the biocatalyst 1x-Est of this experiment_741MCan be applied in the environment polluted by malathion on a large scale.

5.4.2 1x-Est_741MEffect on the degradation of bifenthrin

First, we chose to use the immobilized enzyme 1x-Est in a 10mL reaction system with a stoppered conical flask_741MThe hydrolysis rates for 3 pesticides (bifenthrin, fenvalerate and fenpropathrin) were tested. 1x-Est was found_741MBifenthrin, then fenpropathrin, then fenvalerate can be efficiently degraded (table 1). Due to carboxylesterase 1x-Est_741MThe degradation efficiency of the two following pesticides is low, the experiment is mainly aimed at optimizing the degradation condition of bifenthrin, and a packed bed reactor is designed to treat wastewater containing bifenthrin.

TABLE 11 x-Est_741MSubstrate specificity of

For further practical application, 10mL of packed bed column reactor is used in the experiment for degrading bifenthrin, common wastewater conditions are simulated firstly, bifenthrin with a certain concentration is added into water, and 1x-Est is tested_741MThe degradation ability of the pyrethroid pesticide wastewater is shown in the result of figure 11. In the reactor, the bifenthrin solution as the substrate flows through the membrane from top to bottom of the reactor and is mixed with the immobilized enzyme 1x-Est_741MAnd (4) reacting. The results showed that 2.5g of immobilized enzyme 1x-Est was used_741MThe mixture was charged into a 10mL column reactor, and the final concentration of bifenthrin was 500 mg/L. Reaction conditions are as follows: the reaction temperature is 60 ℃, the pump speed is 0.7mL/min (optimization data not shown), and the bifenthrin detection method is established in the experiment. The results were measured as in FIG. 11, showing that the maximum absorption wavelength of bifenthrin is around 220am, indicating that the bifenthrin content can be detected by the absorbance at 220 nm. (b) Shows the change of the clarity before and after the degradation of the wastewater and shows 1x-Est_741MFor wastewater treatment, the solution becomes clear and possibly other fatty substances are also degraded. (c) The result of HPLC detection after the same treatment of the standard or the wastewater added with bifenthrin shows that the peak time of bifenthrin is about 3.5min, which proves that the detection method established by the experiment has reliability. The final degradation result is shown in the figure, after the reactor treatment, 1x-Est_741MThe degradation rate of the waste water containing bifenthrin reaches 90.4 percent.

The catalytic stability of the resin and the regeneration conditions of the resin are crucial in the continuous catalytic reaction, and the application of the resin catalyst to the continuous production of biodiesel has good effects, but the operation stability of the reactor and the regeneration of the resin are not ideal in many researches. In this study, the immobilized enzyme 1x-Est was studied using a laboratory scale reactor (packed bed reactor) with biocatalyst_741MThe performance of treating bifenthrin wastewater, and the degradation reaction of bifenthrin are continuously carried out in PBR. In the operation process, after a batch of treatment liquid at the outlet of the reactor is introduced into the collecting tube, the detection of the result is carried out after the end of each reaction (namely, one column volume of the treatment liquid is collected), and in order to further verify the accuracy of the detection result, an experiment of the accuracy of the bifenthrin analysis method is also carried out, which shows that the recovered result is between 86% and 92%, and the reliability is high.

TABLE 2 Experimental results on the accuracy of bifenthrin analysis method

Actual dock: adding a certain amount of bifenthrin standard sample to a bifenthrin suspension sample in missible oil with the known content of 20%; the Theoretical dosag: bifenthrin standard sample (treated the same).

The research preliminarily solves the problem of how to apply the developed novel carboxylesterase to actual production efficiently and widely. As shown in figure 12, after 10 batches of continuous reaction of bifenthrin pesticide degradation, the immobilized 1x-Est_741MHas high operation stability and maintains 72 percent of initial activity.

1x-Est_741MCan exert advantages in the recycling of waste water treatment. The results show that PBR (packed bed reactor) contributes to the degradation of bifenthrin in wastewater and has good running stability. Meanwhile, in the wastewater treatment process, the degradation of pesticides and the hydrolysis of oil in wastewater can be simultaneously realized. The treated solution became clear and no surface oil slick appeared.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that it is obvious to those skilled in the art that various modifications and improvements can be made without departing from the principle of the present invention, and these modifications and improvements should also be considered as the protection scope of the present invention.

Sequence listing

<110> Shanghai Weigao medical technology development Co., Ltd

<120> thermophilic carboxylesterase mutant and application thereof

<130> MP22011512

<150> 202210282464.0

<151> 2022-03-22

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 246

<212> PRT

<213> Bacillus wuchersonii thermophilus (Geobacillus uzenensis)

<400> 1

Met Lys Ile Val Pro Pro Lys Pro Phe Phe Phe Glu Ala Gly Glu Arg

1 5 10 15

Ala Ala Leu Leu Leu His Gly Phe Thr Gly Asn Ser Ala Asp Val Arg

20 25 30

Met Leu Gly Arg Phe Leu Glu Ser Lys Gly Tyr Thr Cys His Ala Pro

35 40 45

Ile Tyr Lys Gly His Gly Val Pro Pro Glu Glu Leu Val Arg Thr Gly

50 55 60

Pro Asp Asp Trp Trp Gln Asp Val Met Asn Ser Tyr Gln Phe Leu Lys

65 70 75 80

Asn Lys Gly Tyr Glu Lys Ile Ala Val Ala Gly Leu Ser Leu Gly Gly

85 90 95

Val Phe Ser Leu Lys Leu Gly Tyr Thr Val Pro Ile Glu Gly Ile Val

100 105 110

Thr Met Cys Ala Pro Met Tyr Val Lys Ser Glu Glu Thr Met Tyr Glu

115 120 125

Gly Val Leu Glu Tyr Ala Arg Glu Tyr Lys Lys Arg Glu Gly Lys Ser

130 135 140

Ala Glu Gln Ile Glu Gln Glu Met Glu Arg Phe Lys Gln Thr Pro Met

145 150 155 160

Lys Thr Leu Lys Ala Leu Gln Glu Leu Ile Ala Asp Val Arg Ala His

165 170 175

Leu Asp Leu Val Tyr Ala Pro Thr Phe Val Val Gln Ala Arg His Asp

180 185 190

Glu Met Ile Asn Pro Asp Ser Ala Asn Ile Ile Tyr Asn Glu Ile Glu

195 200 205

Ser Pro Val Lys Arg Ile Lys Trp Tyr Glu Gln Ser Gly His Val Ile

210 215 220

Thr Leu Asp Gln Glu Lys Asp Gln Leu His Glu Asp Ile Tyr Ala Phe

225 230 235 240

Leu Glu Ser Leu Asp Trp

245

<210> 2

<211> 741

<212> DNA

<213> Bacillus wucheri thermophilus (Geobacillus uzenensis)

<400> 2

atgaaaattg ttccgccgaa gccgtttttc tttgaagccg gggagcgggc ggcgctgctt 60

ttgcacggat tcactggcaa ttcggctgac gttcggatgc tcgggcgatt ccttgaatcg 120

aaaggctaca catgccatgc cccgatttac aaagggcacg gcgtgccgcc ggaagagctc 180

gtccgcaccg ggccggacga ttggtggcaa gacgttatga acagctatca gtttttaaaa 240

aacaaaggtt acgaaaaaat tgccgtggcc gggttgtcgc ttggaggggt attttcgttg 300

aaattaggtt acactgtacc tatagaaggg attgtgacga tgtgcgcgcc gatgtatgtc 360

aaaagcgagg aaacgatgta tgaaggcgtc ctcgagtatg cgcgcgaata taaaaagcgg 420

gaaggaaaat cggccgaaca aatcgaacag gaaatggaac ggttcaagca gacgccgatg 480

aagacgttga aagccttaca ggagctcatt gccgatgtgc gcgcccatct tgatttggtt 540

tatgcaccga cgttcgtcgt ccaagcgcgc catgatgaga tgatcaatcc cgacagcgcg 600

aacatcattt ataacgaaat tgaatcgccg gtcaaacgga tcaaatggta tgagcagtct 660

ggccatgtga ttacgcttga tcaagaaaaa gatcagctgc atgaagatat ttatgcattt 720

cttgaatcgt tagattggta a 741

<210> 3

<211> 246

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Lys Ile Val Pro Pro Lys Pro Phe Phe Phe Glu Ala Gly Glu Arg

1 5 10 15

Ala Ala Leu Leu Leu His Gly Phe Thr Gly Asn Ser Ala Asp Val Arg

20 25 30

Met Leu Gly Arg Phe Leu Glu Ser Lys Gly Tyr Thr Cys His Ala Pro

35 40 45

Ile Tyr Lys Gly His Gly Val Pro Pro Glu Glu Leu Val Arg Thr Gly

50 55 60

Pro Asp Asp Trp Trp Gln Asp Val Met Asn Ser Tyr Gln Phe Leu Lys

65 70 75 80

Asn Lys Gly Tyr Glu Lys Ile Ala Val Ala Gly Leu Ser Leu Gly Gly

85 90 95

Val Phe Ser Leu Lys Leu Gly Tyr Thr Val Pro Ile Glu Gly Ile Val

100 105 110

Thr Met Cys Ala Pro Met Tyr Val Lys Ser Glu Glu Thr Met Tyr Glu

115 120 125

Gly Val Leu Glu Tyr Ala Arg Glu Tyr Lys Lys Arg Glu Gly Lys Ser

130 135 140

Ala Glu Gln Ile Glu Gln Glu Met Glu Arg Phe Lys Gln Thr Pro Lys

145 150 155 160

Lys Thr Leu Lys Ala Leu Gln Glu Leu Ile Ala Asp Val Arg Ala His

165 170 175

Leu Asp Leu Val Tyr Ala Pro Thr Phe Val Val Gln Ala Arg His Asp

180 185 190

Glu Met Ile Asn Pro Asp Ser Ala Asn Ile Ile Tyr Asn Glu Ile Glu

195 200 205

Ser Pro Val Lys Arg Ile Lys Trp Tyr Glu Gln Ser Gly His Val Ile

210 215 220

Thr Leu Asp Gln Glu Lys Asp Gln Leu His Glu Asp Ile Tyr Ala Phe

225 230 235 240

Leu Glu Ser Leu Asp Trp

245

<210> 4

<211> 741

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgaaaattg ttccgccgaa gccgtttttc tttgaagccg gggagcgggc ggcgctgctt 60

ttgcacggat tcactggcaa ttcggctgac gttcggatgc tcgggcgatt ccttgaatcg 120

aaaggctaca catgccatgc cccgatttac aaagggcacg gcgtgccgcc ggaagagctc 180

gtccgcaccg ggccggacga ttggtggcaa gacgttatga acagctatca gtttttaaaa 240

aacaaaggtt acgaaaaaat tgccgtggcc gggttgtcgc ttggaggggt attttcgttg 300

aaattaggtt acactgtacc tatagaaggg attgtgtcga tgtgcgcgcc gatgtatgtc 360

aaaagcgagg aaacgatgta tgaaggcgtc ctcgagtatg cgcgcgaata taaaaagcgg 420

gaaggaaaat cggccgaaca aatcgaacag gaaatggaac ggttcaagca gacgccgaag 480

aagacgttga aagccttaca ggagctcatt gccgatgtgc gcgcccatct tgatttggtt 540

tatgcaccga cgttcgtcgt ccaagcgcgc catgatgaga tgatcaatcc cgacagcgcg 600

aacatcattt ataacgaaat tgaatcgccg gtcaaacgga tcaaatggta tgagcagtct 660

ggccatgtga ttacgcttga tcaagaaaaa gatcagctgc atgaagatat ttatgcattt 720

cttgaatcgt tagattggta a 741

Claims (10)

1. A thermophilic carboxylesterase mutant characterised in that it has a sequence as set out in SEQ ID NO: 1 to lysine in the amino acid sequence of the wild-type thermophilic carboxylesterase of formula 1.

2. A nucleic acid encoding the mutant of claim 1.

3. The nucleic acid of claim 1, having a nucleic acid sequence as set forth in SEQ ID NO: 4, respectively.

4. An expression vector comprising the nucleic acid of claim 2 or 3.

5. A host cell transformed or transfected with the expression vector of claim 4.

6. A method for preparing the mutant of claim 1, comprising: culturing the host cell of claim 4, and inducing expression of the mutant.

7. Use of the mutant according to claim 1, the nucleic acid according to claim 2 or 3, the expression vector according to claim 4, the host cell according to claim 5 or the product of the preparation process according to claim 6 for the degradation of esters.

8. Use according to claim 7, characterized in that the esters comprise pyrethrins, pyrethroids and malathion.

9. A product for degrading esters, comprising the mutant of claim 1, the nucleic acid of claim 2 or 3, the expression vector of claim 4, the host cell of claim 5 or the product obtained by the method of claim 6.

10. A method of degrading esters comprising treating with the product of claim 9.

Images