CN111926027B - Phthalate ester hydrolase and preparation method and application thereof - Google Patents

Abstract

The invention discloses a phthalate ester hydrolase, a preparation method and application thereof, wherein the amino acid sequence of the phthalate ester hydrolase is shown as SEQ ID NO: 2, respectively. The novel PAEs hydrolase obtained by the invention can effectively degrade PAEs in a wide temperature (20-50 ℃) and pH (6.0-8.0) range, and has good temperature and pH adaptability; the enzyme has stronger thermal stability, and can still keep more than 90 percent of original activity after pre-incubation for 1h at 40 ℃; the enzyme has hydrolysis catalytic capability on PAEs with long and short side chains, and particularly has higher hydrolysis catalytic capability on short-chain PAEs.

Description

Phthalate ester hydrolase and preparation method and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a phthalate ester hydrolase as well as a preparation method and application thereof.

Background

Phthalic Acid Esters (PAEs) are typical organic plasticizers difficult to degrade and widely applied to various industrial products. As PAEs are free in plastics and other products, they are highly susceptible to transfer into the environment and are widely found in the atmosphere, water, soil and organisms over time. Most PAEs and their metabolites are considered endocrine disruptors and can cause cardiovascular disease, reproductive development toxicity and even cancer and other human health problems. Therefore, how to effectively control and eliminate the PAEs pollution in the environment becomes urgent.

Biodegradation is considered as an emerging technology for cleaning environment with high efficiency, safety and no secondary pollution. In recent years, researchers at home and abroad have made a lot of researches on biodegradation of organic pollutants, but researches on key enzymes in degradation pathways are still few. Compared with the method of directly utilizing microbial cells, the method of utilizing the biological enzyme method to purify pollutants has the advantages of high catalytic efficiency, strong specificity, wide application range to temperature, concentration and environment and the like, and the degrading enzyme is used as a natural protein, has no toxic or side effect, can be safely used for removing organic pollutants in various environments, and has wide application prospect.

In general, the process of microbial degradation of PAEs involves two steps: 1) PAEs are converted to phthalic acid by ester bond hydrolysis; 2) the catabolism of phthalic acid. In step one, esterase is considered to be a key enzyme for the degradation of the whole PAEs. In earlier studies, PAEs hydrolase was purified directly from cell extracts of degrading bacteria, but natural degrading strains generally produced small amounts of enzyme, and the isolation and purification of the enzyme was difficult and cost was too high to facilitate large-scale production and application of degrading enzymes (Rongma, Nippon, Munzhiji, Xumengqua. cloning of the antimicrobial peptide Cerropin B gene and construction of in vivo activity detection method in Zhejiang agricultural science 2003; 15(5): 0-279; Asher M, Khan SW, Bilal M. optimization of lignocelluloses producing enzyme by Pleurotus WC 888utili experimental yield-induced bacteria and bio-ethanol production.

In recent years, the cloning and identification of PAEs hydrolase genes based on the construction of DNA libraries of degrading bacteria, genome sequencing and metagenome mining have received much attention. However, only a small amount of PAEs hydrolase genes are cloned and identified so far, and the screened and cloned novel PAEs hydrolase gene provides richer gene resources for the directional modification of PAEs degrading engineering bacteria, and also provides theoretical and technical support for efficiently repairing polluted environment and guaranteeing human health.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a phthalate ester hydrolase as well as a preparation method and application thereof.

The first object of the present invention is to provide a phthalate hydrolase gene.

The second object of the present invention is to provide a phthalate ester hydrolase.

The third object of the present invention is to provide a recombinant vector.

The fourth purpose of the invention is to provide a recombinant engineering bacterium.

The fifth purpose of the invention is to provide the phthalate hydrolase gene, the phthalate hydrolase, the recombinant vector and/or the application of the recombinant engineering bacterium in degrading the phthalate.

The sixth object of the present invention is to provide a method for preparing the dicarboxylic ester hydrolase.

In order to achieve the purpose, the invention is realized by the following technical scheme:

the invention utilizes the constructed genome library of the strain Rhodococcus sp.2G to obtain a positive transformant with PAEs hydrolytic capability, and the positive transformant is subjected to sequencing and phylogenetic tree analysis to find that the positive transformant belongs to a novel ester hydrolase and is named as Hyd gene. And then a large amount of novel PAEs hydrolase with high activity is obtained by transforming and screening the recombinant engineering bacteria with high expression, and a foundation is laid for further theoretical and practical application development of the PAEs hydrolase.

Therefore, the invention claims a phthalate hydrolase gene, the nucleotide sequence of which is shown as SEQ ID NO: 1 is shown.

A phthalate ester hydrolase, the amino acid sequence of which is shown in SEQ ID NO: 2, respectively.

A recombinant vector comprising said gene or said encoding gene.

A recombinant engineering bacterium contains the recombinant vector.

The phthalate hydrolase gene, the phthalate hydrolase, the recombinant vector and/or the recombinant engineering bacterium are/is applied to degrading the phthalate.

A preparation method of the dicarboxylic ester hydrolase comprises the following steps:

s1, culturing the recombinant engineering bacteria of claim 5 until the OD600 value of a bacterial liquid is 0.3-1.0, adding IPTG (isopropyl-beta-D-thiogalactoside) to 0.1-1.0 mM, and culturing at 15-30 ℃ for 15-24 h for induced expression;

s2, carrying out solid-liquid separation, and collecting thalli;

s3, resuspending the thalli, ultrasonically crushing the thalli, performing solid-liquid separation, and collecting a supernatant;

and S4, purifying the Ni-NTA affinity chromatography column.

Preferably, in step S1, when the recombinant engineered bacteria are cultured until the OD600 value of the bacterial liquid is 0.6, IPTG is added to 0.5mM, and the culture is carried out at 20 ℃.

Preferably, the specific method for purifying the Ni-NTA affinity chromatography column comprises the following steps: putting Ni-NTA resin into a balance column, and cleaning the balance column by using a Binding buffer with 2-8 times of the volume of a column bed at a flow rate of 2-10 mL/min; enabling the cell supernatant with 1-5 times of the volume of the column bed to flow into a column at the flow rate of 1-5 mL/min, and collecting the penetration liquid; then, cleaning the column by using a Binding buffer with 2-10 times of the volume of the column bed, wherein the flow rate is 2-10 mL/min; washing impurities by using a Wash buffer at the flow rate of 2-10 mL/min, collecting flow-through liquid, and repeating the process until the absorbance of the flow-through liquid is close to a baseline at 280 nm; and finally eluting the histidine-tagged protein on the column by using an Elution buffer at the flow rate of 1-5 mL/min, and collecting and storing the eluent.

More preferably, the specific method for purifying the Ni-NTA affinity chromatography column comprises the following steps: putting Ni-NTA resin into a balance column, and cleaning the balance column by using a Binding buffer with 5 times of the volume of a bed at the flow rate of 5 mL/min; loading the supernatant of the thallus with 2 times of the volume of the bed into a column at the flow rate of 2mL/min, and collecting the penetration liquid; then, using a Binding buffer with 5 times of the volume of the column bed to clean the column, wherein the flow rate is 5 mL/min; washing impurities by using a Wash buffer at the flow rate of 5mL/min, collecting flow-through liquid and repeating the process until the absorbance of the flow-through liquid is close to a baseline at 280 nm; and finally eluting the histidine-tagged protein on the column by using an Elution buffer at the flow rate of 2mL/min, and collecting and storing the eluate.

Preferably, the Binding buffer is 20-60 mM Tris, 200-500 mM NaCl, and pH 7-10.

More preferably, the Binding buffer is 50mM Tris, 300mM NaCl, pH 8.0.

Preferably, the Wash buffer is 20-60 mM Tris, 200-500 mM NaCl, 200-1000 mM imidazole, and pH 7-10.

More preferably, Wash buffer is 50mM Tris, 300mM NaCl, 500mM imidazole, pH 8.0.

Preferably, the Elution buffer is 20-60 mM Tris, 200-500 mM NaCl, 200-1000 mM imidazole, pH 7-10.

More preferably, the Elution buffer is 50mM Tris, 300mM NaCl, 500mM imidazole, pH 8.0.

Preferably, in step S3, the bacteria are resuspended in a disruption Buffer containing 0.5-4M Tris, 50-200 mM NaCl, 0.05-0.5 mM PMSF, 0.05-0.5% Triton X-100, pH 7-10.

More preferably, in step S3, the cells are resuspended in disruption Buffer, which is 1M Tris, 150mM NaCl, 0.2mM PMSF, 0.2% Triton X-100, pH 8.0.

Preferably, in step S3, the specific method for ultrasonically disrupting the bacteria is to perform a cycle of power 200-600W, 5-30 min, and ultrasonic pause of 1-5S and 2-10S.

More preferably, in step S3, the specific procedure of ultrasonic cell disruption is that the power is 400W, 20min, and the ultrasonic 2S pause is 6S, which is a cycle.

Compared with the prior art, the invention has the following beneficial effects:

the novel PAEs hydrolase obtained by the invention can effectively degrade PAEs in a wide temperature (20-50 ℃) and pH (6.0-8.0) range, and has good temperature and pH adaptability; the enzyme has stronger thermal stability, and can still keep more than 90 percent of original activity after pre-incubation for 1h at 40 ℃; the enzyme has hydrolytic catalytic capability on PAEs with long and short side chains, and particularly has higher hydrolytic catalytic capability on short-chain PAEs.

Drawings

FIG. 1 shows the cleavage of Rhodococcus sp.2G genomic DNA.

FIG. 2 shows the screening of positive transformants.

FIG. 3 is the nucleic acid sequence of the Hyd gene, with the underlined part representing the ORF of the Hyd gene.

FIG. 4 is the deduced amino acid sequence of Hyd gene.

FIG. 5 shows the phylogenetic relationship of Hyd protease.

FIG. 6 is SDS-PAGE analysis of recombinant Hyd protein induction and purification; m1: protein molecular weight standards; 1: a purified recombinant protein; 2: e.coli BL21(DE3)/Hyd-pET28a whole cell protein after 0.5mM IPTG induction; 3: uninduced e.coli BL21(DE3)/Hyd-pET28a whole cell protein; 4: untransformed e.coli BL21(DE3) whole cell protein.

FIG. 7 is a graph of the effect of temperature (A) and pH (B) on recombinant Hyd enzyme activity, (C) residual enzyme activity measured after 60 min incubation of Hyd at different temperatures.

Detailed Description

The invention is described in further detail below with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.

EXAMPLE 1 cloning of PAEs hydrolase Gene

Firstly, extracting DNA of degrading bacteria

10 μ L of PAEs degrading bacterium Rhodococcus sp.2G (preservation name: Rhodococcus 2G, preservation number: CCTCC No. M2015056, preservation organization: China center for type culture preservation, preservation date: 2015, 1 month 22 days, preservation address: university of Wuhan, China) preserved in 50% glycerol was aspirated in a clean bench, inoculated in sterilized LB liquid medium, and cultured overnight in a constant temperature shaker at 37 ℃ at 150 rpm. Then taking a proper amount of turbid bacterial liquid for amplification culture, centrifuging at low temperature (4 ℃), collecting thalli, and extracting DNA.

Second, digestion of degrading bacteria DNA

The reaction solutions were added according to the enzyme digestion reaction system shown in Table 1, mixed well, and placed in a constant temperature water bath kettle at 37 ℃ for 20 min. After the reaction is finished, performing 1% agarose gel electrophoresis on all reaction products and photographing, wherein the result is shown in figure 1, cutting 1-3 Kb gel blocks according to the molecular weight standard of a DNA Marker, subpackaging in a 1.5mL centrifuge tube, and weighing the mass of the gel blocks. And then, recovering the DNA target fragment by using a gel recovery kit.

TABLE 1 Rhodococcus sp.2G genome DNA digestion system

Thirdly, transformation and extraction of pUC19 plasmid

The plasmid DNA pUC19 attached to the competent cell product was removed and dissolved in 10. mu.L of sterile water. Then, an appropriate amount of pUC19 DNA solution was taken and subjected to transformation experiment according to the instruction manual for competent cell products. After the transformation is successful, selecting blue transformants from the plate, inoculating the blue transformants into an LB liquid culture medium containing 100mg/mL Amp solution, placing the plate in a constant-temperature oscillator at 37 ℃ at 150r/min for overnight culture, and taking 2-3 mL of turbid bacterial liquid to extract plasmid DNA according to a plasmid extraction kit instruction manual.

Fourth, complete digestion of pUC19 plasmid

According to the system shown in Table 2, the components are mixed uniformly and put into a constant temperature water bath kettle at 37 ℃ for 3h, after the reaction is finished, 20 mu L of reaction terminating liquid is added to terminate the enzyme digestion reaction. The vector plasmid digestion product was electrophoresed in 1% agarose gel, and the gel block containing the linear vector was cut off for gel recovery experiments.

Table 2 pUC19 plasmid digestion reaction system:

penta, dephosphorylation of Linear vectors

In the process of connecting the DNA target fragment and the linear vector, in order to prevent the occurrence of the phenomenon of self-connection of the linear vector, which leads to the reduction of the connection efficiency and the reduction of the conversion rate, the linear cloning vector needs to be dephosphorized. The reaction system for dephosphorylation of the linear cloning vector is shown in Table 3.

Table 3 linear cloning vector dephosphorylation reaction system:

sixthly, ligation reaction and transformation of recombinant vector

The DNA target fragment recovered and ready for use in the previous step and the dephosphorylated linear cloning vector were mixed uniformly in a 0.5mL centrifuge tube according to the system shown in Table 4, and then placed in a low temperature ligation apparatus at 16 ℃ for ligation for 18 h. 10 μ L of the ligation product was used for transformation experiments according to the instruction manual for competent cell products.

TABLE 4 ligation reaction System

Seventh, screening of genomic library

An appropriate amount of the transformed culture was spread evenly on LB solid agar plates containing 200. mu.L of Amp (100mg/mL), and 24. mu.L of IPTG (200mg/mL) and 40. mu. L X-gal (200mg/mL) were added to the plates in this order, and the plates were spread evenly and slowly clockwise using a triangular bar. Then placing the flat plate upside down into a biochemical incubator with the temperature of 37 ℃ for overnight culture; using a sterilized probe, about 18000 growing white colonies were picked onto a new LB solid agar plate with Amp, and to the center of each colony, a solution of 3. mu. L X-captylate (100. mu. mol/L) was added in sequence. Then after the solution is naturally dried, placing the flat plate upside down into a biochemical incubator at the temperature of 37 ℃ for overnight culture; the next day, positive clones producing esterase hydrolysis circles (FIG. 2) were preserved and designated 2G-I, after which they were inoculated into MSM inorganic salt solid medium with 200mg/L DBP as a sole carbon source, and the growth of colonies was observed. The final results showed that a DBP clear hydrolysis circle was formed around the 2G-I colony, indicating that DBP in this region could be utilized by 2G-I hydrolysis.

Eighthly, extraction and sequencing analysis of recombinant plasmid

And (3) selecting a proper amount of the selected target clone, inoculating the selected target clone into an LB liquid culture medium, culturing until OD600 is equal to 0.6, extracting a recombinant plasmid, sending the recombinant plasmid to a company for sequencing, wherein the sequencing result shows that the total length of a DNA fragment inserted into a pUC19 vector is 1325bp, and the nucleotide sequence of the inserted gene fragment is 795bp (shown in SEQ ID NO: 1). The sequence of the gene fragment was analyzed using the bioinformatics software DNA Star, and the results are shown in FIGS. 3 and 4, the gene fragment encodes 264 amino acids (the amino acid sequence is shown in SEQ ID NO: 2), the predicted protein molecular weight is 28.70kDa, and the theoretical isoelectric point is 5.27. In addition, the DNA sequence of the gene fragment ORF is uploaded to an NCBI online website, and is subjected to sequence comparison with selected 8 bacterial lipid enzymes of different families and some reported PAEs hydrolase sequences to construct an adjacently connected phylogenetic tree. The results are shown in FIG. 5, where the Hyd protein does not belong to any of the previously defined esterase families and has no homology to the reported amino acid sequence of the PAE degrading hydrolase, but has the highly conserved catalytic motif GXSXG of the hydrolase. In conclusion, Hyd protease is a novel PAEs hydrolase.

Example 2 construction of recombinant Hyd Gene expression vector

PCR amplification of Hyd Gene

The base sequence prokaryotic expression primer of Hyd gene was designed using bioinformatics software DNA Star, and PCR amplification of Hyd gene was performed according to the system shown in Table 5. Wherein, the expression primer sequence of the Hyd gene is as follows: an upstream primer P-F: CGC (China Global positioning System)GGATCCGATCTTCTGCACACCCATCTG(BamHI)；The downstream primer P-R: CCCAAGCTTCTACACCATCCGGGCCACG(HindIII)。

Table 5 PCR amplification reaction system:

the PCR amplification procedure was as follows:

(1) pre-denaturation at 94 ℃ for 5min

(5) Extension at 72 ℃ for 10min

After the reaction, 5. mu.L of the amplified product was mixed with an appropriate amount of 6 Xstop reaction solution, and applied to 1% agarose gel for electrophoresis. Then according to the indication of a DNA Marker, cutting the gel to recover a target strip. The recovered product of the gum was stored at-20 ℃ for future use.

Second, extraction and double enzyme digestion of expression vector pET28a (+)

Appropriate amount of expression vector pET28a (+) was transformed into e.coli BL21(DE 3). The positive transformants on the kanamycin-resistant plate were selected, inoculated into LB liquid medium (containing 30. mu.g/mL kanamycin at the final concentration), cultured overnight in a constant temperature shaker at 37 ℃ and 150r/min, and 2-3 mL of turbid bacterial liquid was taken to extract pET28a (+) plasmid according to the manual of plasmid extraction kit. The extracted pET28a (+) expression vector DNA was then double-digested with the endonucleases BamH I, Hind III. The specific enzyme digestion reaction system is as follows:

Table 6 double enzyme digestion system:

placing the reaction system in a constant-temperature water bath kettle at the temperature of 37 ℃, after water bath for 30min, adding 10 x of termination reaction liquid to terminate the enzyme digestion reaction. Then loading the mixture to 1% agarose gel for electrophoresis detection, and cutting and recovering the enzyme digestion product of the pET28a (+) expression vector according to the molecular weight standard of a DNA Marker.

Three, double enzyme digestion of Hyd gene PCR product

Taking a proper amount of Hyd gene PCR amplification product, carrying out double enzyme digestion on the amplification product by using endonucleases BamH I and Hind III, wherein the specific enzyme digestion reaction system is as follows:

TABLE 7 digestion reaction System for PCR products

Placing the reaction system in a constant-temperature water bath kettle at the temperature of 37 ℃, after water bath for 30min, adding 10 multiplied by termination reaction liquid to terminate the enzyme digestion reaction, and then loading the reaction system on 1% agarose gel for electrophoresis detection. According to the molecular weight standard of DNA Marker, the target fragment of double enzyme digestion is cut into gel and recovered

Fourthly, connection and transformation

Connecting a proper amount of recovered product of the Hyd gene to a pET28a (+) expression vector, wherein the specific connection reaction system is as follows:

TABLE 8 ligation reaction System

The components in the reaction system are uniformly mixed and then placed in a low-temperature connector for connection for 18 hours at the temperature of 16 ℃. The ligated pET28a-Hyd recombinant plasmid was stored at 4 ℃ for subsequent transformation.

Example 3 inducible expression and purification of recombinant Hyd Gene

First, induced expression of recombinant Hyd gene

Transforming E.coli BL21(DE3) strain with proper amount of recombinant expression vector plasmid DNA, and culturing at 37 deg.c overnight; randomly picking a single colony of an expression strain BL21(DE3) in a test tube containing 10mL of LB liquid medium (containing 30. mu.g/mL kanamycin at a final concentration), and culturing overnight in a shaker at 37 ℃ and 220 rpm; respectively inoculating the overnight cultured bacterial liquid into 10mL LB liquid culture medium according to the proportion of 1:100, adding (containing 30 mu g/mL kanamycin at the final concentration), and culturing at 37 ℃ and 220rpm for about 3 h; when the OD600 value of the bacterial liquid reaches about 0.6, IPTG with the final concentration of 0.5mM is respectively added, and the mixture is placed in a shaking table with the temperature of 20 ℃ and the rpm of 220 for induction overnight; the bacterial cells collected by centrifugation were dissolved in a disruption Buffer (1M Tris, 150mM NaCl, 0.2mM PMSF, 0.2% Triton X-100, pH 8.0), and the cells were sonicated in an ice bath at 400W for 20min (sonication 2S, pause 6S for one cycle). After the ultrasonic treatment is finished, centrifuging at 12000r/min for 20min at the temperature of 4 ℃, and taking supernatant for further purification.

Secondly, purifying the recombinant Hyd protein

Taking 5mL of Ni-NTA resin to the equilibrium column, and washing the equilibrium column with Binding buffer (50mM Tris, 300mM NaCl, pH 8.0) with 5 times of bed volume at the flow rate of 5 mL/min; the supernatant of the cells was applied to the column at 2 bed volumes at a flow rate of 2mL/min, and the permeate was collected. The column was then washed with a Binding buffer at 5 bed volumes and a flow rate of 5 mL/min. The following Wash was performed using a Wash buffer (50mM Tris, 300mM NaCl, 500mM imidazole, pH 8.0) at a flow rate of 5mL/min, and flow-through was collected and the process repeated until the flow-through absorbance approached baseline at 280 nm. Finally, the histidine-tagged protein on the column was eluted with an Elution buffer (50mM Tris, 300mM NaCl, 500mM imidazole, pH 8.0) at a flow rate of 2mL/min, and the eluate was collected and stored.

A suitable amount of the purified protein sample was used for SDS-PAGE detection, and the detection results are shown in FIG. 6. The remaining part was dialyzed into 10mmol/L Tris-HCl (pH 7.5) solution overnight at 4 ℃ and, after completion of dialysis, concentrated with PEG20000, filtered through a 0.45-. mu.m membrane filter and dispensed into 1.5mL centrifuge tubes and stored at-20 ℃.

Example 4 recombinant Hyd protease Properties

Method for determining activity of recombinant Hyd protease

1. Degradation of DBP by recombinant Hyd protease

Sequentially adding 10mmol/L Tris-HCl reaction buffer solution, substrate DBP solution (100mg/L, methanol as a solvent) and Hyd protein solution into a glass sample injection bottle with the volume of 10mL according to a reaction system shown in Table 9, uniformly mixing, putting the glass sample injection bottle into a constant-temperature water bath kettle, reacting for 5min at a constant temperature, and adding 100 mu L TCA (1mol/L) solution to terminate the reaction after the reaction is finished. Blank control is the added Hyd purified protein solution subjected to boiling inactivation at 100 ℃.

TABLE 9 Hyd protein degradation substrate experiment reaction System

2. Method for extracting PAEs (polycyclic aromatic hydrocarbons) in reaction liquid of degradation experiment

5mL of methanol is added into a glass sample injection bottle after the degradation experiment reaction is finished, the glass sample injection bottle is sealed and placed in a constant temperature oscillator, and oscillation is carried out for 10min at the room temperature at the oscillation speed of 120 r/min. The glass vial was then removed and the entire solution in the vial was transferred and passed over anhydrous Na having a length of 18cm ₂SO₄Drying at 400 deg.C, collecting in a heart-shaped bottle. The glass vials were then washed twice in the same manner. Then, the liquid collected in the heart-shaped flask was rotary evaporated to near dry state by using a rotary evaporator, and the heart-shaped flask was washed 3 times with 9mL of methanol (chromatographic grade), and the washing solution was sequentially transferred to a 10mL volumetric flask, and finally the volume was adjusted to 10 mL. The liquid in the 2mL volumetric flask is filtered by a 0.45 mu m filter membrane, and the filtrate is collected in a brown sample bottle and is stored in a refrigerator at 4 ℃ in a sealing way for detection. The enzyme activity units are defined as: the amount of enzyme required to hydrolyze 1. mu. mol of PAEs per minute at 37 ℃.

3. Determination of PAEs by GC-MS

PAEs in the solution to be detected is analyzed by a gas chromatography-mass spectrometry (GC-MS) instrument, a chromatographic column is a DB-5MS quartz capillary column (30m multiplied by 0.25mm multiplied by 0.25 mu m), and carrier gas is high-purity helium (He). Initial pressure 33.6kPa, flow rate 1.0 mL/min; no-flow split sampling with a sampling amount of 1.0 μ L is adopted. Temperature rising procedure: the initial temperature is 100 ℃, and the temperature is kept for 2 min; then raising the temperature to 130 ℃ at the speed of 15 ℃/min; then, the temperature was raised to 280 ℃ at a rate of 30 ℃/min and held for 5 min. The temperature of the ion source is 220 ℃, and the temperature of the injection port is 250 ℃; the ion source used in mass spectrometry is an electron impact source (EI), and an ion monitoring mode (SIM) is selected for scanning, and the ionization energy is 70 eV.

Second, influence of temperature on recombinant Hyd enzyme Activity

1. Experimental methods

According to the Hyd protein degradation substrate experiment reaction system shown in Table 9, all solutions were mixed uniformly and placed in water baths of 20, 25, 30, 37, 40, 45, 50, 55, and 60 ℃ respectively for 5min at constant temperature. Each treatment is repeated for 3 times, after the reaction is finished, 100 mu L of TCA (1mol/L) solution is added to stop the reaction, and the respective enzyme activity at different temperatures is calculated according to the method for extracting and detecting PAEs, wherein the temperature treatment with the highest enzyme activity is taken as 100%, and the influence of the temperature on the enzyme activity of Hyd hydrolase is analyzed by using the relative enzyme activity.

2. Results of the experiment

As shown in fig. 7A, the activity of Hyd degrading enzyme gradually increases with the increase of temperature, the activity of degrading enzyme reaches the highest peak at 37 ℃, then the activity of degrading enzyme starts to decrease with the increase of temperature, and the relative enzyme activity is only 18% when the temperature increases to 60 ℃. Therefore, it can be seen from the figure that the optimal reaction temperature of the Hyd degrading enzyme is 37 ℃, and DBP can be effectively degraded within the range of 20-50 ℃. The bacteria have good temperature adaptability.

Third, the influence of pH on the activity of recombinant Hyd enzyme

According to the Hyd protein degradation substrate experiment reaction system in Table 9, the pH values of 10mMol/L Tris-HCl reaction buffer solution are respectively adjusted to 4.0, 5.0, 6.0, 6.5, 7.0, 7.5, 8.0, 9.0 and 10.0, then DBP standard mother liquor and Hyd hydrolase solution are sequentially added, and after uniform mixing, the mixture is placed in a water bath at 37 ℃ for reaction for 5 min. And each treatment is repeated for 3 times, after the reaction is finished, 100 mu L of TCA (1mol/L) solution is added to stop the reaction, DBP in the reaction system is extracted and detected, respective enzyme activity under different pH values is calculated, the pH value treatment with the highest enzyme activity is taken as 100%, and the influence of the pH value on the enzyme activity of Hyd hydrolase is analyzed by using relative enzyme activity.

As shown in FIG. 7B, when the pH was in the range of 4.0 to 7.5, the Hyd-degrading enzyme activity gradually increased with the increase in pH, while when the pH was in the range of 7.5 to 8.0, the Hyd-degrading enzyme activity gradually decreased with the increase in pH. Therefore, the optimal pH value of the Hyd degrading enzyme reaction is 7.5, the pH value is in the range of 6.0-8.0, the relative enzyme activity of the Hyd degrading enzyme is high and exceeds 65%, and the Hyd degrading enzyme has strong pH adaptability and huge actual application potential.

Fourth, detection of thermal stability

Appropriate amounts of Hyd protein were incubated in water baths of 40, 50, 60, 65 ℃ respectively in advance, and the enzyme activity of the incubated protein at each temperature was measured at time points of 2, 5, 10, 20, 30, 45, 60 minutes as described above. Incubation at each temperature was performed in triplicate and blanked with no enzyme added.

The result is shown in FIG. 7C, the enzyme has quite stable activity under the condition of incubation at 40 ℃, and can still maintain more than 90% of the original activity after incubation for 1 h; however, when incubated at a temperature above 60 ℃, the enzyme activity decreased rapidly and after 20min, only less than 40% of the initial activity remained.

Fifthly, determining enzyme reaction kinetic parameters of the recombinant Hyd protease for degrading various PAEs

The degradation capacity of the recombinant Hyd protease was determined separately for different substrates (DMP, DEP, BBP, DBP, DnP, DEHP, DINP) at different initial concentrations (0.1-10 mM) according to the method described above. The inverse of the initial degradation speed of PAEs to the inverse of the substrate concentration is used as a Linweaver-Burk diagram to calculate the K of the enzyme on PAEs_mAnd V_max。k_catCan be calculated by the following formula:

k_cat＝V_max/[E]

[E] is the concentration of the enzyme in the reaction system.

The results are shown in table 10, and the recombinant Hyd protease not only has hydrolysis effect on short-chain PAEs, but also can hydrolyze long-chain PAEs; compared with long-chain PAEs, the Km value of the enzyme is lower, and the Vmax and the Kcat/Km value are higher when the enzyme hydrolyzes short-chain PAEs, which indicates that the enzyme has higher hydrolysis efficiency on the short-chain PAEs.

TABLE 10 reaction kinetics parameters of recombinant Hyd hydrolase on different substrates

Sequence listing

<110> river-south university

<120> phthalate ester hydrolytic enzyme, preparation method and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 795

<212> DNA

<213> Rhodococcus sp. 2G

<400> 1

gtggtcggcg tgagtgccac ggatcttctg cacacccatc tgttcggccc cgtcgacgga 60

ccggaggtcc tcgccctgca cggactcacc ggtcacggcc gacgctggcg gaacctcggc 120

gaacgacacc tgccccacct gcggttcgtc gctccggacc tccggggtca cggccggtcg 180

ccgtggactc ccccgtggtc gttcgaggcg cacatcgccg acctgaaggc cgtgctggac 240

gcacacacca ccggtcccgt caccgtggtg ggccactcct tcggtggtgc cctcgcgctg 300

catctcgccg ccgcggtgcc cgacagggtg cgggcgctgg tactcctcga tccggcgatc 360

ggcctcccgg ccgaccggat gctcgagatc gccgacctca ccctccacaa ccccgactac 420

acggacgagg cggaggcgcg ggccgagaag gtccacggcg actggggcga ggtggccccc 480

gagttgctcg acgaagagat cgccgagcac ctcgtcgaac tcgactcggg gcgtgtcaac 540

tggcggatct gcgtacctgc gctggtgacc tcgtgggggg agctggcccg cggacccgtc 600

ctgccgccgg ccggtatccc gacgatcttc gtgcaggccg ggaaggtgca acccccgtac 660

accacgtcaa atttccgtcg cgacctggcg gaacgactcg gcgacgacct gaccctgctc 720

gagttcgact gcgaccacat gatcgaccag gcgcgtcccg ccgagaccgc cgaactcgtg 780

gcccggatgg tgtag 795

<210> 2

<211> 264

<212> PRT

<213> Rhodococcus sp. 2G

<400> 2

Val Val Gly Val Ser Ala Thr Asp Leu Leu His Thr His Leu Phe Gly

1 5 10 15

Pro Val Asp Gly Pro Glu Val Leu Ala Leu His Gly Leu Thr Gly His

20 25 30

Gly Arg Arg Trp Arg Asn Leu Gly Glu Arg His Leu Pro His Leu Arg

35 40 45

Phe Val Ala Pro Asp Leu Arg Gly His Gly Arg Ser Pro Trp Thr Pro

50 55 60

Pro Trp Ser Phe Glu Ala His Ile Ala Asp Leu Lys Ala Val Leu Asp

65 70 75 80

Ala His Thr Thr Gly Pro Val Thr Val Val Gly His Ser Phe Gly Gly

85 90 95

Ala Leu Ala Leu His Leu Ala Ala Ala Val Pro Asp Arg Val Arg Ala

100 105 110

Leu Val Leu Leu Asp Pro Ala Ile Gly Leu Pro Ala Asp Arg Met Leu

115 120 125

Glu Ile Ala Asp Leu Thr Leu His Asn Pro Asp Tyr Thr Asp Glu Ala

130 135 140

Glu Ala Arg Ala Glu Lys Val His Gly Asp Trp Gly Glu Val Ala Pro

145 150 155 160

Glu Leu Leu Asp Glu Glu Ile Ala Glu His Leu Val Glu Leu Asp Ser

165 170 175

Gly Arg Val Asn Trp Arg Ile Cys Val Pro Ala Leu Val Thr Ser Trp

180 185 190

Gly Glu Leu Ala Arg Gly Pro Val Leu Pro Pro Ala Gly Ile Pro Thr

195 200 205

Ile Phe Val Gln Ala Gly Lys Val Gln Pro Pro Tyr Thr Thr Ser Asn

210 215 220

Phe Arg Arg Asp Leu Ala Glu Arg Leu Gly Asp Asp Leu Thr Leu Leu

225 230 235 240

Glu Phe Asp Cys Asp His Met Ile Asp Gln Ala Arg Pro Ala Glu Thr

245 250 255

Ala Glu Leu Val Ala Arg Met Val

260

Claims (6)

1. The application of the phthalate hydrolase gene in degrading diformates is characterized in that the nucleotide sequence of the phthalate hydrolase gene is shown as SEQ ID NO: 1, and the dicarboxylic acid ester is DMP or DEP.

2. The application of the phthalate ester hydrolase in degrading the diformate is characterized in that the amino acid sequence of the phthalate ester hydrolase is shown as SEQ ID NO: 2, the dicarboxylic acid ester is DMP or DEP.

3. The use according to claim 2, wherein the method for the preparation of the phthalate ester hydrolytic enzyme comprises the steps of:

s1, culturing the recombinant engineering bacteria until the OD600 value of the bacterial liquid is 0.3-1.0, adding IPTG (isopropyl-beta-D-thiogalactoside) to 0.1-1.0 mM, culturing at 15-30 ℃ for 15-24 h, and carrying out induced expression to obtain the recombinant engineering bacteria after induced expression, wherein the recombinant engineering bacteria can express amino acid sequences such as SEQ ID NO: 2, a phthalate ester hydrolase;

s2, carrying out solid-liquid separation on the recombinant engineering bacteria subjected to induced expression obtained in the step S1, and collecting thalli;

S3, resuspending the thalli obtained in the step S2, ultrasonically crushing the thalli, performing solid-liquid separation, and collecting a supernatant;

s4, purifying the supernatant obtained by S3 by using a Ni-NTA affinity chromatography column;

in the step S4, putting Ni-NTA resin into a balance column, and cleaning the balance column by using a Binding buffer with the volume 2-8 times of the bed volume, wherein the flow rate is 2-10 mL/min; then, loading the thallus supernatant obtained in the step S3 on a column by 1-5 times of the volume of a column bed at a flow speed of 1-5 mL/min, and collecting penetration liquid; then, cleaning the column by using a Binding buffer with 2-10 times of the volume of the bed, wherein the flow rate is 2-10 mL/min; washing impurities by using a Wash buffer at the flow speed of 2-10 mL/min, collecting flow-through liquid, and repeating the process until the absorbance of the flow-through liquid reaches a baseline at 280 nm; finally eluting the histidine-tagged protein on the column by using an Elution buffer at the flow rate of 1-5 mL/min, and collecting and storing the eluate;

in step S3, resuspending the bacteria with a crushing Buffer, wherein the crushing Buffer is 0.5-4M Tris, 50-200 mM NaCl, 0.05-0.5 mM PMSF, 0.05-0.5% Triton X-100, and the pH is 7-10;

in step S3, the specific method for ultrasonically crushing the thalli is that the power is 200-600W, 5-30 min, and the ultrasonic is suspended for 1-5S and 2-10S, which is a cycle.

4. The use of claim 3, wherein when the recombinant engineered bacteria are cultured until the OD600 value of the bacterial liquid is 0.6, IPTG is added to 0.5mM, and the culture is carried out at 20 ℃.

5. The application of a recombinant vector in degrading diformate is characterized in that the recombinant vector contains a nucleotide sequence shown as SEQ ID NO: 1, wherein the dicarboxylate is DMP or DEP.

6. The application of the recombinant engineering bacteria in degrading the diformate is characterized in that the recombinant engineering bacteria can express the amino acid sequence shown as SEQ ID NO: 2 and the phthalate ester hydrolase is DMP or DEP.

Images