CN110862974A - Mutant of organophosphorus hydrolase, expression vector, recombinant bacterium and application - Google Patents

Abstract

The invention provides a mutant, an expression vector, a recombinant bacterium and application of organophosphorus hydrolase, belonging to the technical field of genetic engineering and enzymology. Compared with the organophosphorus hydrolase, the mutant of the organophosphorus hydrolase provided by the invention improves the hydrolysis rate of the paraoxon compound.

Description

Mutant of organophosphorus hydrolase, expression vector, recombinant bacterium and application

Technical Field

The invention belongs to the technical field of genetic engineering and enzymology, and particularly relates to a mutant of organophosphorus hydrolase, an expression vector, a recombinant bacterium and application.

Background

Organophosphorus hydrolase (OPH) is widely used for biodegradation of Organophosphorus pesticide residues, and has great significance for environmental pollution remediation and human health guarantee. Organophosphorus hydrolase OPH is a typical phosphotriesterase that hydrolyzes many organophosphate triesters, thioesters, and fluorophosphates by hydrolyzing various phosphate bonds (P-O bonds, P-CN bonds, P-F bonds, and P-S bonds) of the ester bond of the dissociation group of a phosphorus atom and an electrophilic atom. The active center of OPH enzyme has three hydrophobic pockets which respectively act with three substituents of substrate molecules to influence the release rate of leaving groups and determine the specificity of the enzyme. The large (H254, H257 and L271) and small (M317, G60, I106, L303 and S308) pockets are important for the enzyme to recognize the hydrophobicity of the substrate side chains and the chirality of the central phosphorus atom; the pockets (W131, F132, F306, and Y309) then control the leaving group release.

The mechanism of OPH catalysis of paraoxon hydrolysis suggests that water molecules are activated to bridging hydroxyl at the metal center, the bridging hydroxyl attacks the central phosphorus atom of a substrate, and the catalysis initiation step has no relation with a leaving group²⁺Deprotonation of one water molecule, generation of bridging hydroxide and binuclear Zn²⁺With D301 coordinately bound, ② substrate bound to enzymeActive site for nucleophilic attack of phosphorus atom on substrate molecule by bridging hydroxide radical while obtaining H proton from D301, ③ β -Zn²⁺Polarising the phosphoryl oxygen to result in β -Zn²⁺The combination with hydroxyl is weakened, and the electron pushing effect of the phosphorus center is enhanced; cleavage of the substrate P-O bond, release of the leaving group (i.e.the first product P-nitrophenol), forming a complex of the enzyme with the second product, the enzyme-product complex consisting of a metal Zn²⁺Center stabilization, ④ proton migration to H254 through D301 and away from the active site of the enzyme, release of the second product, the active cavity returns to its original state and enters the next round of catalysis.

The biological enzyme is used as a biological catalyst, the specificity and the high efficiency are incomparable with other catalysts, the biological enzyme can specifically accelerate a series of biochemical reaction speeds, but due to the self-property limit, the activity of wild bacteria OPH for degrading organophosphorus pesticide is not high, the secretion expression quantity of the enzyme is not enough, the application environment is narrow, and the requirement of rapidly and efficiently degrading organophosphorus pesticide under various conditions cannot be met.

Disclosure of Invention

In view of the above, the present invention provides a mutant of organophosphorus hydrolase, an expression vector, a recombinant bacterium, and an application thereof, wherein the mutant of organophosphorus hydrolase provided by the present invention increases the hydrolysis rate of paraoxonium compounds compared with organophosphorus hydrolase.

In order to achieve the above purpose, the invention provides the following technical scheme:

the invention provides a mutant of organophosphorus hydrolase, wherein isoleucine at position 274 of the organophosphorus hydrolase is mutated into asparagine.

Preferably, the method further comprises the following steps: the 185 th lysine of the organophosphorus hydrolase is mutated into arginine.

Preferably, the amino acid sequence of the mutant is shown as SEQ ID No. 1.

Preferably, the nucleotide sequence of the gene encoding the mutant is shown as SEQ ID No. 2.

The invention also provides application of the mutant in the technical scheme in improving the hydrolysis rate of the paraoxonium compound.

The invention also provides an expression vector, and the gene coding the mutant of the technical scheme is inserted into a shuttle to obtain the expression vector.

Preferably, the shuttle comprises pMA 0911.

Preferably, the method for constructing the expression vector comprises:

1) adopting Nde I and EcoR I double enzyme digestion plasmid to obtain the gene coding the mutant of the technical proposal; the plasmid contains a gene for coding the mutant of the technical scheme;

2) adopting Nde I and EcoR I double enzymes to cut the shuttle body to obtain the enzyme cut shuttle body;

3) connecting the gene obtained in the step 2) with the enzyme digestion shuttle obtained in the step 2) to obtain an expression vector.

The invention also provides a recombinant bacterium, and the expression vector in the technical scheme is transformed into competent escherichia coli to obtain the recombinant bacterium.

The invention also provides application of the recombinant bacteria in the technical scheme in improving the hydrolysis rate of the paraoxonium compound.

The invention provides a mutant, an expression vector, a recombinant bacterium and application of organophosphorus hydrolase, wherein isoleucine at the 274 th site of the organophosphorus hydrolase is mutated into asparagine. Compared with the organophosphorus hydrolase, the mutant of the organophosphorus hydrolase provided by the invention improves the hydrolysis rate of the paraoxon compound. The mutant provided by the invention also comprises the mutation of the 185 th lysine of the organophosphorus hydrolase into arginine. Compared with the mutation at the 274 th position, the mutation at the 274 th position and the 185 th position further improve the hydrolysis rate of the paraoxon compound.

Drawings

FIG. 1 is an electrophoresis chart of SDS protein secreted and expressed by recombinant OPH enzyme, 1. protein low molecular weight Marker A. Escherichia coli expression total bacterial protein (OPH) B. Bacillus subtilis WB800 expression total bacterial protein (OPH) C.WB800 expression bacterial supernatant (OPH) D.WB800 expression bacterial precipitate (OPH) E. purified protein (OPH);

FIG. 2 is a standard curve of protein concentration by the Bradford method;

fig. 3 is a PNP standard curve.

Detailed Description

The invention provides a mutant of organophosphorus hydrolase, wherein isoleucine at position 274 of the organophosphorus hydrolase is mutated into asparagine.

In the present invention, the mutant of organophosphorus hydrolase preferably further comprises: the 185 th lysine of the organophosphorus hydrolase is mutated into arginine.

In the invention, the amino acid sequence of the mutant of the organophosphorus hydrolase mutated at the 274 th site and the 185 th site is shown as SEQ ID No.1, the nucleotide sequence of the gene for coding the mutant is shown as SEQ ID No.2, and the amino acid sequence is specifically as follows:

MQTRRVVLKSAAAAGTLLGGLAGCASVAGSIGTGDRINTVRGPITISEAGFTLTHEHICGSSAGFLRAWPEFFGSRKALAEKAVRGLRRARAAGVRTIVDVSTFDIGRDVSLLAEVSRAADVHIVAATGLWFDPPLSMRLRSVEELTQFFLREIQYGIEDTGIRAGIIKVATTGKATPFQELVLRAAARASLATGVPVTTHTAASQRDGEQQAAIFESEGLSPSRVCIGHSDDTDDLSYLTALAARGYLIGLDHIPHSAIGLEDNASASANLGIRSWQTRALLIKALIDQGYMKQILVSNDWLFGFSSYVTNIMDVMDRVNPDGMAFIPLRVIPFLREKGVPQETLAGITVTNPARFLSPTLRAS；

the nucleotide sequence is specifically as follows:

atgcaaacgagaagggttgtgctcaagtctgcggccgccgcaggaactctgctcggcggcctggctgggtgcgcgagcgtggctggatcgatcggcacaggcgatcggatcaataccgtgcgcggtcctatcacaatctctgaagcgggtttcacactgactcacgagcacatctgcggcagctcggcaggattcttgcgtgcttggccagagttcttcggtagccgcaaagctctagcggaaaaggctgtgagaggattgcgccgcgccagagcggctggcgtgcgaacgattgtcgatgtgtcgactttcgatatcggtcgcgacgtcagtttattggccgaggtttcgcgggctgccgacgttcatatcgtggcggcgaccggcttgtggttcgacccgccactttcgatgcgattgaggagtgtagaggaactcacacagttcttcctgcgtgagattcaatatggcatcgaagacaccggaattagggcgggcattatcaaggtcgcgaccacaggcaaggcgaccccctttcaggagttagtgttaagggcggccgcccgggccagcttggccaccggtgttccggtaaccactcacacggcagcaagtcagcgcgatggtgagcagcaggccgccatttttgagtccgaaggcttgagcccctcacgggtttgtattggtcacagcgatgatactgacgatttgagctatctcaccgccctcgctgcgcgcggatacctcatcggtctagaccacatcccgcacagtgcgattggtctagaagataatgcgagtgcatcagccctcctgggcaaccgttcgtggcaaacacgggctctcttga tcaaggcgct catcgaccaa ggctacatga aacaaatcct cgtttcgaatgactggctgttcgggttttcgagctatgtcaccaacatcatggacgtgatggatcgcgtgaaccccgacgggatggccttcattccactgagagtgatcccattcctacgagagaagggcgtcccacaggaaacgctggcaggcatcactgtgactaacccggcgcggttcttgtcaccgaccttgcgggcgtcatga。

the invention also provides application of the mutant in the technical scheme in improving the hydrolysis rate of the paraoxonium compound. In the present invention, the paraoxonium compound preferably comprises paraoxonium (formula C)₁₀-H₁₄-(NO)₆-P)。

The invention also provides an expression vector, and the gene coding the mutant of the technical scheme is inserted into a shuttle to obtain the expression vector.

In the invention, the shuttle preferably comprises pMA0911, and the pMA0911 is preferably E.coli-B.subtilis shuttle pMA0911 which can carry the target gene segment to realize the secretion expression in the bacillus subtilis cells.

In the present invention, the method for constructing the expression vector preferably comprises:

1) adopting Nde I and EcoR I double enzyme digestion plasmid to obtain the gene coding the mutant of the technical proposal; the plasmid contains a gene for coding the mutant of the technical scheme;

2) adopting Nde I and EcoR I double enzymes to cut the shuttle body to obtain the enzyme cut shuttle body;

3) connecting the gene obtained in the step 2) with the enzyme digestion shuttle obtained in the step 2) to obtain an expression vector.

The invention has no special limit to the type of the plasmid containing the gene for coding the mutant in the technical scheme, and the conventional plasmid is adopted to contain the gene, and the F OPH plasmid (obtained by separating and purifying broad-spectrum organophosphorus degrading bacteria (Flavobacterium sp.ATCC 27551)) is particularly preferred. The conditions for digesting the plasmid with Nde I and EcoR I are not particularly limited, and the conditions for digesting the plasmid with the above two enzymes are adopted. The conditions for cutting the shuttle body by NdeI and EcoRI double enzymes are not particularly limited, and the plasmid can be cut by the two enzymes. The invention has no special limitation on the connection condition of the obtained gene and the obtained enzyme digestion shuttle and can adopt the connection condition of the conventional gene and plasmid.

The invention also provides a recombinant bacterium, and the expression vector in the technical scheme is transformed into competent escherichia coli to obtain the recombinant bacterium. The method for transforming the expression vector into the competent escherichia coli is not particularly limited, and the method for transforming the conventional expression vector into the competent escherichia coli is adopted.

The invention also provides application of the recombinant bacteria in the technical scheme in improving the hydrolysis rate of the paraoxonium compound. In the present invention, the Paraoxon-based compound preferably comprises Paraoxon (C)₁₀-H₁₄-(NO)₆-P)。

The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

Example 1

Organophosphorus hydrolase point mutation and secretory expression

(I) Point mutation related gene

Based on a data structure of Fs OPH (obtained by separating and purifying broad-spectrum organophosphorus degrading bacteria (Flavobacterium sp.ATCC 27551)), according to a hydrolysis mechanism of the Fs OPH, analyzing the influence of protein structure change on enzymatic hydrolysis efficiency, and changing a protein sequence and a three-dimensional structure by point mutation to change a base pair at a key position so as to obtain the organophosphorus hydrolase with higher hydrolytic activity. And obtaining the OPH gene segment containing K185R (arginine mutated from lysine at position 185) and I274N (asparagine mutated from isoleucine at position 274) mutation sites by adopting an overlapped PCR technology.

(II) designing expression system

The secretion expression bacteria select bacillus subtilis which is a new expression bacteria, the research is less at present in China, the secretion expression bacteria have strong protein secretion capacity, foreign proteins can be directly secreted into a culture medium, and the secretion expression bacteria have important significance on later-stage purification and activity maintenance of the proteins. In addition, the genetic background of the bacillus subtilis is clear, so that the modification of genetic engineering is facilitated; has no preference of the codon, has simple requirements on the culture medium, and can grow in high density in the culture medium with simpler nutrition.

The vector plasmid selects an E.coli-B.subtilis shuttle pMA0911, and the vector can carry a target gene segment to realize secretion expression in a bacillus subtilis cell. The pMA0911 shuttle base sequence was analyzed and the plasmid map is shown in FIG. 3, and NdeI and EcoRI sites were chosen for cleavage. NdeI is positioned at the 10 th site, EcoRI is positioned at the 111 th site, and both the NdeI and the EcoRI are unique enzyme cutting sites on a pMA0911 plasmid ring, are close in distance and do not contain key base sequences in the range, and are suitable for being used as sites for inserting an Fs OPH gene (SEQ ID No. 2).

1. Extraction of plasmid and Gene

Extraction of pMA0911 shuttle (commercially available) and Fs OPH gene plasmids was performed according to the plasmid miniprep extraction kit instructions.

2. Double digestion of plasmid and Gene

NdeI and EcoRI carry the Fs OPH gene plasmid and pMA0911 shuttle body by double digestion.

3. Construction of expression vectors

And recovering and purifying the target Fs OPH gene fragment and the E.coli-B.subtilis shuttle pMA0911 fragment by adopting an agarose gel recovery kit. The target Fs OPH gene is inserted into a shuttle pMA0911, and an expression vector pMA-p1 is constructed.

4. Transformation of competent e

The expression vector pMA-p1 was transferred to competent E.coli, spread on LB solid medium containing ampicillin, and cultured overnight in a 37 ℃ incubator. And selecting resistant transformants, and extracting plasmids after bacteria amplification.

Preparation and transformation of competent cells of subtilis

The Spizizen method for preparing and transforming the subtilis competent cells comprises the following specific operation steps:

① the WB800 single clone is selected and inoculated in 2mL SPI culture medium, and cultured in a constant temperature shaking table at 37 ℃ overnight;

② transfer 100. mu.L overnight cultures into 5mL SPI media, shake culture at 37 ℃ for 4h and then start OD detection₆₀₀. When OD is reached₆₀₀When the concentration is about 1.0, 200. mu.L of the culture broth is transferred to 2mL of SPII medium, and shake-cultured at 37 ℃ for 1.5h at 100 r/min.

③ mu.L of 100 XEGTA solution is added to the tube, and after the solution is accurately cultured in a shaker at 37 ℃ and 100r/min for 10min, 600 mu.L of the culture solution is dispensed into each 1.5mL centrifuge tube.

④ the target plasmid is added into the tube, and after being evenly sucked, the tube is put into a shaker at 37 ℃ and 100r/min for cultivation for 2 h.

⑤ after the culture, the bacterial liquid was collected by centrifugation at 4000r/min, a portion of the supernatant was discarded, 150. mu.L of the resuspended cells were spread on a selective plate containing kanamycin, and the cells were cultured overnight at 37 ℃.

6. Preservation and sequencing of recombinant bacteria

The obtained genetically engineered bacteria are inoculated in 10mL LB culture medium (containing 50 ug/mL kanamycin), cultured overnight at 37 ℃ and 200r/min, taken out and added with proper amount of glycerol to store bacteria, and subjected to gene sequencing verification experiment results.

Example 2

Activity measurement of recombinant organophosphorus hydrolase

The recombinant strain was inoculated into 30mL of TB expression medium and cultured under the same conditions for 72 hours with shaking at constant temperature. Centrifuging the fermentation liquor, taking the supernatant as a crude enzyme liquid, carrying out SDS-PAGE protein electrophoresis to identify the molecular weight of the enzyme produced by the recombinant bacteria, determining the protein concentration by Bradford, detecting the capability of the produced enzyme for degrading paraoxon by a p-nitrophenol method, and detecting the hydrolysis capability of the recombinant strain in the genetic engineering.

SDS-PAGE protein electrophoresis: mu.L of fermentation supernatant was taken, 10. mu.L of PMSF-containing 5 XSDS-PAGE loading buffer was added thereto, and after standing at room temperature for 30min, it was subjected to boiling water bath for 3-5 min. And (3) performing protein electrophoresis by using 5% of concentrated glue and 12% of separation glue under the conditions of voltage 120V and current 100mA, dyeing by using Coomassie brilliant blue R-250 after electrophoresis is finished to display protein bands, wherein the result is shown in figure 1, the molecular weight of the protein secreted by the expression bacteria is about 35KDa by comparing a protein Marker, the protein secretion capacity of WB800 expression recombinant bacteria is strongest, and the protein mainly exists in the supernatant of the bacteria and is consistent with the expected result.

Determination of protein concentration: the protein concentration was determined by the Bradford method.

And (3) drawing a protein concentration standard curve, namely preparing a 1mg/mL BSA standard protein solution. 0, 20. mu.L, 40. mu.L, 60. mu.L, 80. mu.L and 100. mu.L of the protein standard solution are respectively taken and then are supplemented to 1000. mu.L by deionized water. Then, 5mL of Coomassie brilliant blue G250 solution was added thereto, followed by color development with shaking. After reacting for 5min at room temperature, the absorbance A595 at 595nm of visible light is measured. A595 was plotted as the ordinate and BSA protein content as the abscissa to construct a standard curve as shown in FIG. 2.

And (3) measuring a sample, namely taking 100 mu L of prepared crude enzyme liquid (diluting according to actual conditions so as to keep protein concentrations of different samples consistent), supplementing a system to 1000 mu L of deionized water, adding 5mLG250 solution, and oscillating for color development. After 5min at room temperature, A595 was determined. The light absorption at 595nm of the sample was measured using the same treatment without the addition of the crude enzyme solution as a control. The sample protein concentration was determined according to the standard curve.

Detecting enzyme activity by a p-nitrophenol method: in the hydrolysis reaction of paraoxon, P-O bond is broken to generate PNP product. PNP has specific absorption peak at 405nm, and the light absorption value of the sample at 405nm is detected, so that the activity of the enzyme is calculated.

And (3) drawing a p-nitrophenol standard curve, weighing 10mg/mL PNP, sequentially diluting in half, and measuring the light absorption value at 405nm, wherein the standard curve is shown in figure 3.

Reaction system 1 mL: 100. mu.L of the crude enzyme solution was added to a solution containing 50. mu.L of 1mg/mL paraoxon and 850. mu.L of 50mmol/L Tris-Cl buffer (pH7.8) and reacted at room temperature for 10 min. The reaction was stopped by adding 1.0mL of 10% trichloroacetic acid, and 1.0mL of 10% Na was added₂CO₃The solution develops color. A405 was measured, and the enzyme activity was calculated, using the reaction without the addition of the enzyme solution as a control.

As a result, it was found that the rate of degradation of paraoxon by the organophosphorus hydrolase from 0.014mmol/min.mg to 0.916mmol/min.mg could be increased by mutating the positions 185 and 127 of the organophosphorus hydrolase at the same time.

Example 3

Isoleucine to asparagine mutation at position 274 of organophosphorus hydrolase (I274N), organophosphorus hydrolase point mutation and secretion expression, and recombinant organophosphorus hydrolase activity were determined as in examples 1 and 2.

The results were: I274N increased the rate of hydrolysis of paraoxon from 0.014mmol/min.mg to 0.395 mmol/min.mg.

Comparative example 1

The mutation of lysine at position 185 of the organophosphorus hydrolase to arginine (K185R), the point mutation and secretory expression of the organophosphorus hydrolase, and the activity of the recombinant organophosphorus hydrolase were determined in the same manner as in examples 1 and 2.

The results were: the mutation of K185R alone reduces the ability of organophosphorus hydrolase to hydrolyze paraoxon, from 0.014mmol/min.mg, which was not mutated, to 0.007 mmol/min.mg.

As can be seen from the above examples and comparative examples, the simultaneous mutation of the 185 th amino acid and the 274 th amino acid of the organophosphorus hydrolase or the single mutation of the 274 th amino acid of the organophosphorus hydrolase increases the hydrolysis rate of the organophosphorus hydrolase on the organophosphorus compounds, and the single mutation of the 185 th amino acid of the organophosphorus hydrolase reduces the enzymatic activity of the organophosphorus hydrolase, even does not have the enzymatic activity.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> Clarity City Sanda New technology Ltd

<120> mutant of organophosphorus hydrolase, expression vector, recombinant bacterium and application

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>365

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>1

Met Gln Thr Arg Arg Val Val Leu Lys Ser Ala Ala Ala Ala Gly Thr

1 5 10 15

Leu Leu Gly Gly Leu Ala Gly Cys Ala Ser Val Ala Gly Ser Ile Gly

20 25 30

Thr Gly Asp Arg Ile Asn Thr Val Arg Gly Pro Ile Thr Ile Ser Glu

35 40 45

Ala Gly Phe Thr Leu Thr His Glu His Ile Cys Gly Ser Ser Ala Gly

50 55 60

Phe Leu Arg Ala Trp Pro Glu Phe Phe Gly Ser Arg Lys Ala Leu Ala

65 70 75 80

Glu Lys Ala Val Arg Gly Leu Arg Arg Ala Arg Ala Ala Gly Val Arg

85 90 95

Thr Ile Val Asp Val Ser Thr Phe Asp Ile Gly Arg Asp Val Ser Leu

100 105 110

Leu Ala Glu Val Ser Arg Ala Ala Asp Val His Ile Val Ala Ala Thr

115 120 125

Gly Leu Trp Phe Asp Pro Pro Leu Ser Met Arg Leu Arg Ser Val Glu

130 135 140

Glu Leu Thr Gln Phe Phe Leu Arg Glu Ile Gln Tyr Gly Ile Glu Asp

145 150 155 160

Thr Gly Ile Arg Ala Gly Ile Ile Lys Val Ala Thr Thr Gly Lys Ala

165 170 175

Thr Pro Phe Gln Glu Leu Val Leu Arg Ala Ala Ala Arg Ala Ser Leu

180 185 190

Ala Thr Gly Val Pro Val Thr Thr His Thr Ala Ala Ser Gln Arg Asp

195 200 205

Gly Glu Gln Gln Ala Ala Ile Phe Glu Ser Glu Gly Leu Ser Pro Ser

210 215 220

Arg Val Cys Ile Gly His Ser Asp Asp Thr Asp Asp Leu Ser Tyr Leu

225 230 235 240

Thr Ala Leu Ala Ala Arg Gly Tyr Leu Ile Gly Leu Asp His Ile Pro

245 250 255

His Ser Ala Ile Gly Leu Glu Asp Asn Ala Ser Ala Ser Ala Asn Leu

260 265 270

Gly Ile Arg Ser Trp Gln Thr Arg Ala Leu Leu Ile Lys Ala Leu Ile

275 280 285

Asp Gln Gly Tyr Met Lys Gln Ile Leu Val Ser Asn Asp Trp Leu Phe

290 295 300

Gly Phe Ser Ser Tyr Val Thr Asn Ile Met Asp Val Met Asp Arg Val

305 310 315 320

Asn Pro Asp Gly Met Ala Phe Ile Pro Leu Arg Val Ile Pro Phe Leu

325 330 335

Arg Glu Lys Gly Val Pro Gln Glu Thr Leu Ala Gly Ile Thr Val Thr

340 345 350

Asn Pro Ala Arg Phe Leu Ser Pro Thr Leu Arg Ala Ser

355 360 365

<210>2

<211>1098

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

atgcaaacga gaagggttgt gctcaagtct gcggccgccg caggaactct gctcggcggc 60

ctggctgggt gcgcgagcgt ggctggatcg atcggcacag gcgatcggat caataccgtg 120

cgcggtccta tcacaatctc tgaagcgggt ttcacactga ctcacgagca catctgcggc 180

agctcggcag gattcttgcg tgcttggcca gagttcttcg gtagccgcaa agctctagcg 240

gaaaaggctg tgagaggatt gcgccgcgcc agagcggctg gcgtgcgaac gattgtcgat 300

gtgtcgactt tcgatatcgg tcgcgacgtc agtttattgg ccgaggtttc gcgggctgcc 360

gacgttcata tcgtggcggc gaccggcttg tggttcgacc cgccactttc gatgcgattg 420

aggagtgtag aggaactcac acagttcttc ctgcgtgaga ttcaatatgg catcgaagac 480

accggaatta gggcgggcat tatcaaggtc gcgaccacag gcaaggcgac cccctttcag 540

gagttagtgt taagggcggc cgcccgggcc agcttggcca ccggtgttcc ggtaaccact 600

cacacggcag caagtcagcg cgatggtgag cagcaggccg ccatttttga gtccgaaggc 660

ttgagcccct cacgggtttg tattggtcac agcgatgata ctgacgattt gagctatctc 720

accgccctcg ctgcgcgcgg atacctcatc ggtctagacc acatcccgca cagtgcgatt 780

ggtctagaag ataatgcgag tgcatcagcc ctcctgggca accgttcgtg gcaaacacgg 840

gctctcttga tcaaggcgct catcgaccaa ggctacatga aacaaatcct cgtttcgaat 900

gactggctgt tcgggttttc gagctatgtc accaacatca tggacgtgat ggatcgcgtg 960

aaccccgacg ggatggcctt cattccactg agagtgatcc cattcctacg agagaagggc 1020

gtcccacagg aaacgctggc aggcatcact gtgactaacc cggcgcggtt cttgtcaccg 1080

accttgcggg cgtcatga 1098

Claims (10)

1. An organophosphorus hydrolase mutant, wherein isoleucine at position 274 of the organophosphorus hydrolase is mutated to asparagine.

2. The mutant according to claim 1, further comprising: the 185 th lysine of the organophosphorus hydrolase is mutated into arginine.

3. The mutant according to claim 2, wherein the amino acid sequence of the mutant is shown as SEQ ID No. 1.

4. The mutant according to claim 2 or 3, wherein the nucleotide sequence of the gene encoding the mutant is shown in SEQ ID No. 2.

5. Use of the mutant of any one of claims 2 to 4 to increase the rate of hydrolysis of a paraoxonium compound.

6. An expression vector, wherein a gene encoding the mutant according to claim 4 is inserted into a shuttle to obtain an expression vector.

7. The expression vector of claim 6, wherein the shuttle comprises pMA 0911.

8. The expression vector according to claim 5 or 6, wherein the expression vector is constructed by a method comprising:

1) obtaining a gene encoding the mutant of claim 4 by digesting the plasmid with Nde I and EcoR I; the plasmid contains a gene encoding the mutant of claim 4;

2) adopting Nde I and EcoR I double enzymes to cut the shuttle body to obtain the enzyme cut shuttle body;

3) connecting the gene obtained in the step 2) with the enzyme digestion shuttle obtained in the step 2) to obtain an expression vector.

9. A recombinant bacterium obtained by transforming the expression vector according to any one of claims 6 to 8 into a competent Escherichia coli.

10. The use of the recombinant bacterium of claim 9 to increase the rate of hydrolysis of paraoxon compounds.

Images