CN114605559A

CN114605559A - Recombinant organophosphorus hydrolase and construction method and application thereof

Info

Publication number: CN114605559A
Application number: CN202210319448.4A
Authority: CN
Inventors: 高伏康; 汪进; 王丹; 周阳
Original assignee: Jiangsu University
Current assignee: Jiangsu University
Priority date: 2022-03-29
Filing date: 2022-03-29
Publication date: 2022-06-10
Anticipated expiration: 2042-03-29
Also published as: CN114605559B

Abstract

The invention provides a recombinant organophosphorus hydrolase and a construction method and application thereof, belonging to the technical field of biological engineering; in the invention, organophosphorus hydrolase OPH and RNP are connected through flexible rigid composite connecting peptide Linker to construct recombinant organophosphorus hydrolase which is marked as OPH-Linker-RNP; the recombinant organophosphorus hydrolase can be expressed in a prokaryotic expression system of escherichia coli, and can be self-purified with high efficiency and good stability.

Description

Recombinant organophosphorus hydrolase and construction method and application thereof

Technical Field

The invention belongs to the technical field of bioengineering, and particularly relates to a recombinant organophosphorus hydrolase and a construction method and application thereof.

Background

The organophosphorus compound is an artificially synthesized phosphorus-containing high-toxicity substance, comprises phosphate esters, phosphate thiol esters, phosphonic acid or aminophosphate esters, V and G type nerve agents and the like, and is widely applied to the agricultural, industrial and national defense fields of pesticides, flame retardants, plasticizers, chemical weapons and the like. Organophosphorus can irreversibly bind to acetylcholinesterase in insects and mammals, leading to nervous system disorders and death in humans. Due to the limited ability of nature to degrade such compounds, the large amount of organophosphorus compounds used gradually accumulates, causing serious food and environmental problems. Organophosphorus hydrolase (OPH) is an enzyme which uses an organophosphorus compound as a substrate, can efficiently hydrolyze P-O, P-S, P-F and P-CN in the organophosphorus compound, and the hydrolysis product is non-toxic. Therefore, the method for solving the problem of organic phosphorus compound pollution in the environment by using the OPH is an environment-friendly method. The OPH can safely and thoroughly remove the residual pesticide on agricultural products such as fresh vegetables, melons and fruits, is fundamentally different from the mode that chemical detergents on the market adopt chemical raw materials to remove the pesticide residues by a physical method, and also avoids the defects that the chemical detergents cannot completely remove the pesticide residues and can form secondary pollution.

The wide demand for OPH has made it an important research topic. Since the original OPH obtained from the natural world often does not have high activity or poor thermal stability, and in addition, separation and purification are difficult, the initial cost of production is increased, and the enzyme activity is also lost. So that practical use of the organophosphorus hydrolase is limited. The microorganism has multiple metabolic pathways and short growth period, so that the biodegradation mode has the advantages of high degradation efficiency, mild condition and low cost, and shows better application potential. The enzyme plays a main role in the process of degrading the organophosphorus pesticide by the microorganisms, OPH catalyzes the breakage of the vinegar, and the obtained low-toxicity product can be further metabolized into carbon dioxide and water by the microorganisms. The development of organophosphorus hydrolase with high temperature resistance and easy purification through enzymatic engineering has become one of the hot spots of research. Currently, immobilized metal ion affinity chromatography (IMAC) has become a common technique for separation, purification and immobilization of histidine-tag (His-tag) containing enzymes. The use of transition metal ions (Ni) in IMAC materials²⁺、Co²⁺、Cu² ⁺Etc.) and histidine residue in target protein to realize the separation of His-tag proteinAnd (4) purifying and immobilizing. However, the procedure is complicated, time consuming, inefficient, does not increase the thermostability of the enzyme and preparation of the IMAC chelating agent can affect metalloenzyme activity.

Disclosure of Invention

Aiming at some defects in the prior art, the invention provides a recombinant organophosphorus hydrolase and a construction method and application thereof. In the invention, organophosphorus hydrolase OPH and resin-mimetic protein (RNP) are connected through flexible-rigid composite connecting peptide Linker to construct recombinant organophosphorus hydrolase which is marked as OPH-Linker-RNP; the recombinant organophosphorus hydrolase can be expressed in an escherichia coli prokaryotic expression system, and can be self-purified efficiently and has good stability.

The invention firstly provides a recombinant organophosphorus hydrolase, which is marked as OPH-Linker-RNP, the amino acid sequence of the recombinant organophosphorus hydrolase is shown as SEQ ID NO. 1, and the corresponding nucleotide sequence is shown as SEQ ID NO. 2.

The invention also provides a construction method of the recombinant organophosphorus hydrolase, which comprises the following steps: the organophosphorus hydrolase of Flavobacterium (Flavobacterium) is connected with RNP through a Linker to obtain the recombinant organophosphorus hydrolase OPH-Linker-RNP.

Wherein, the amino acid sequence of the recombinant organophosphorus hydrolase is shown as SEQ ID NO. 3, and the corresponding nucleotide sequence is shown as SEQ ID NO. 4; the RNP (resin-mimetic protein, RNP) is an artificial polypeptide which is composed of 30 repetitive sequences of 12 peptides (PSSSYGAPGGGN) and simulates a resin protein, and the amino acid sequence of the artificial polypeptide is shown as SEQ ID NO. 5; the Linker is connecting peptide GGGGSGGGGSEAAAKEAAAKGGGGSGGGGS, and the nucleotide sequence of the Linker is shown in SEQ ID NO. 7.

The invention also provides a recombinant expression plasmid, which contains nucleotide for coding the recombinant organophosphorus hydrolase and is marked as pET22b (+) -OPH-Linker-RNP.

The invention also provides a recombinant bacterium, which comprises the recombinant expression plasmid.

The invention also provides a method for purifying the recombinant organophosphorus hydrolase, and the purification method is a salting-out heating method.

The invention also provides application of the recombinant organophosphorus hydrolase, the recombinant expression plasmid or the recombinant bacterium in degrading organophosphorus pesticides.

Compared with the prior art, the invention has the beneficial effects that:

in the invention, the OPH is connected with the RNP, so that the OPH has thermal stability, the protein can be purified by salting out and heating, and the complicated experimental process of affinity chromatography is avoided. The OPH can be purified by the characteristics, and the purification times and the recovery rates of the OPH can respectively reach 9.39 and 9.51 times and 81.12 percent and 79.23 percent at 70-80 ℃. In addition, the method can increase the stability of the OPH enzyme, and the OPH-Linker enzyme activity is only 28.81 percent at 60 ℃, but the OPH-Linker-RNP can still maintain 80.43 percent of activity; at 80 ℃, the OPH-Linker enzyme activity is only 8.81 percent, and the OPH-Linker-RNP can still maintain 59.56 percent of activity.

The OPH-Linker-RNP recombinant organophosphorus hydrolase is constructed by a gene modification technology, compared with the organophosphorus hydrolase, the recombinant organophosphorus hydrolase has thermal stability, the target protein can be obtained only by simple processes such as salting out, heating, centrifuging and the like, and the method is simple and rapid and is superior to the traditional nickel column affinity chromatography purification mode in efficiency.

The recombinant OPH-Linker-RNP constructed by the invention can effectively work at a higher temperature (80 ℃) and is beneficial to improving the efficiency of an enzyme catalysis process. The fusion protein obtained by the invention is more suitable for the application of a biological catalysis process, can better meet the requirements of social production, and has wide market prospect.

Drawings

FIG. 1 is a schematic diagram of the construction of recombinant plasmid pET22b (+) OPH-Linker-RNP.

FIG. 2 is a SDS-PAGE graph of OPH-Linker-RNP induced expression and purification at 25 ℃; in the figure, M: standard protein molecular weight marker; 1: the crushed supernatant is induced and expressed by the empty vector; 2: OPH-Linker-RNP induces 0h to express the whole strain; 3: OPH-Linker-RNP enzyme induces for 8h to express the whole strain; 4: a precipitate containing OPH-Linker-RNP; 5: a supernatant solution containing OPH-Linker-RNP; 6: empty vector inductionExpressing the disrupted whole bacteria; 7-10: (NH)₄)₂SO₄Heating the purified supernatant at 50, 60, 70, 80 ℃.

FIG. 3 is a graph showing the OPH-Linker-RNP recovery rate and purification fold after heating at different temperatures.

FIG. 4 is a graph showing the thermal stability of OPH-Linker-RNP and OPH-Linker in example 4.

FIG. 5 is a graph showing the storage stability of OPH-Linker-RNP and OPH-Linker of example 4.

Detailed Description

The invention will be further described with reference to the following figures and specific examples, but the scope of the invention is not limited thereto.

The following examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially. The invention adopts the prior art in the field except for special notes.

Example 1: construction of recombinant expression plasmids

An OPH gene (GenBank accession number CM29593.1) from Flavobacterium (Flavobacterium) is taken as a template, and the OPH nucleotide sequence is synthesized by the Kyoto bioengineering (Shanghai) corporation, wherein the OPH gene nucleotide sequence is shown as SEQ ID NO. 4, and the coded amino acid sequence is shown as SEQ ID NO. 3. The 5 'end and the 3' end of the OPH gene sequence are respectively modified with EcoR I and Hind III to obtain OPH nucleotide sequences with EcoR I and Hind III cutting sites, and the OPH nucleotide sequences with the EcoR I and Hind III cutting sites which are synthesized by the whole gene are constructed on pET22b (+) (Novagen company, USA) plasmid and named as pET22b (+) -OPH.

The Linker-RNP nucleotide sequence is synthesized by the whole gene of the company Limited in the biological engineering (Shanghai), the amino acid sequence of RNP is shown as SEQ ID NO. 5, and the nucleotide sequence is shown as SEQ ID NO. 6. The Linker nucleotide sequence is shown in SEQ ID NO. 7. A Hind III site is present 5 'to the linker and an Xho I site is present 3' to the RNP. The Linker-RNP nucleotide sequence synthesized above was then constructed on PUC18 plasmid (Stratagene, La Jolla, Calif., USA), and the resulting recombinant plasmid was designated PUC18-Linker-RNP plasmid.

SEQ ID NO:3：

MQTRRVVLKSAAAAGTLLGGLAGCASVAGSIGTGDRINTVRGPITISEAGFTLTHEHICGSSAGFLRAWPEFFGSRKALAEKAVRGLRRARAAGVRTIVDVSTFDIGRDVSLLAEVSRAADVHIVAATGLWFDPPLSMRLRSVEELTQFFLREIQYGIEDTGIRAGIIKVATTGKATPFQELVLKAAARASLATGVPVTTHTAASQRDGEQQAAIFESEGLSPSRVCIGHSDDTDDLSYLTALAARGYLIGLDHIPHSAIGLEDNASASALLGIRSWQTRALLIKALIDQGYMKQILVSNDWLFGFSSYVTNIMDVMDRVNPDGMAFIPLRVIPFLREKGVPQETLAGITVTNPARFLSPTLRAS

SEQ ID NO:4：

ATGCAAACGAGAAGGGTTGTGCTCAAGTCTGCGGCCGCCGCAGGAACTCTGCTCGGCGGCCTGGCTGGGTGCGCGAGCGTGGCTGGATCGATCGGCACAGGCGATCGGATCAATACCGTGCGCGGTCCTATCACAATCTCTGAAGCGGGTTTCACACTGACTCACGAGCACATCTGCGGCAGCTCGGCAGGATTCTTGCGTGCTTGGCCAGAGTTCTTCGGTAGCCGCAAAGCTCTAGCGGAAAAGGCTGTGAGAGGATTGCGCCGCGCCAGAGCGGCTGGCGTGCGAACGATTGTCGATGTGTCGACTTTCGATATCGGTCGCGACGTCAGTTTATTGGCCGAGGTTTCGCGGGCTGCCGACGTTCATATCGTGGCGGCGACCGGCTTGTGGTTCGACCCGCCACTTTCGATGCGATTGAGGAGTGTAGAGGAACTCACACAGTTCTTCCTGCGTGAGATTCAATATGGCATCGAAGACACCGGAATTAGGGCGGGCATTATCAAGGTCGCGACCACAGGCAAGGCGACCCCCTTTCAGGAGTTAGTGTTAAAGGCGGCCGCCCGGGCCAGCTTGGCCACCGGTGTTCCGGTAACCACTCACACGGCAGCAAGTCAGCGCGATGGTGAGCAGCAGGCCGCCATTTTTGAGTCCGAAGGCTTGAGCCCCTCACGGGTTTGTATTGGTCACAGCGATGATACTGACGATTTGAGCTATCTCACCGCCCTCGCTGCGCGCGGATACCTCATCGGTCTAGACCACATCCCGCACAGTGCGATTGGTCTAGAAGATAATGCGAGTGCATCAGCCCTCCTGGGCATCCGTTCGTGGCAAACACGGGCTCTCTTGATCAAGGCGCTCATCGACCAAGGCTACATGAAACAAATCCTCGTTTCGAATGACTGGCTGTTCGGGTTTTCGAGCTATGTCACCAACATCATGGACGTGATGGATCGCGTGAACCCCGACGGGATGGCCTTCATTCCACTGAGAGTGATCCCATTCCTACGAGAGAAGGGCGTCCCACAGGAAACGCTGGCAGGCATCACTGTGACTAACCCGGCGCGGTTCTTGTCACCGACCTTGCGGGCGTCA

SEQ ID NO:5：

PSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGG NPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGN

SEQ ID NO:6：

CCGAGCAGCAGTTATGGCGCGCCGGGCGGTGGGAACCCAAGCAGTAGTTATGGCGCGCCGGGGGGCGGAAACCCTAGTAGCAGCTATGGCGCGCCGGGTGGAGGCAACCCCAGCAGCAGTTATGGCGCGCCGGGAGGTGGTAACCCCAGCAGTAGCTATGGCGCGCCGGGCGGTGGAAACCCGAGCAGCAGTTATGGCGCGCCGGGCGGTGGGAACCCAAGCAGTAGTTATGGCGCGCCGGGGGGCGGAAACCCTAGTAGCAGCTATGGCGCGCCGGGTGGAGGCAACCCCAGCAGCAGTTATGGCGCGCCGGGAGGTGGTAACCCCAGCAGTAGCTATGGCGCGCCGGGCGGTGGAAACCCGAGCAGCAGTTATGGCGCGCCGGGCGGTGGGAACCCAAGCAGTAGTTATGGCGCGCCGGGGGGCGGAAACCCTAGTAGCAGCTATGGCGCGCCGGGTGGAGGCAACCCCAGCAGCAGTTATGGCGCGCCGGGAGGTGGTAACCCCAGCAGTAGCTATGGCGCGCCGGGCGGTGGAAACCCGAGCAGCAGTTATGGCGCGCCGGGCGGTGGGAACCCAAGCAGTAGTTATGGCGCGCCGGGGGGCGGAAACCCTAGTAGCAGCTATGGCGCGCCGGGTGGAGGCAACCCCAGCAGCAGTTATGGCGCGCCGGGAGGTGGTAACCCCAGCAGTAGCTATGGCGCGCCGGGCGGTGGAAACCCGAGCAGCAGTTATGGCGCGCCGGGCGGTGGGAACCCAAGCAGTAGTTATGGCGCGCCGGGGGGCGGAAACCCTAGTAGCAGCTATGGCGCGCCGGGTGGAGGCAACCCCAGCAGCAGTTATGGCGCGCCGGGAGGTGGTAACCCCAGCAGTAGCTATGGCGCGCCGGGCGGTGGAAACCCGAGCAGCAGTTATGGCGCGCCGGGCGGTGGGAACCCAAGCAGTAGTTATGGCGCGCCGGGGGGCGGAAACCCTAGTAGCAGCTATGGCGCGCCGGGTGGAGGCAACCCCAGCAGCAGTTATGGCGCGCCGGGAGGTGGTAACCCCAGCAGTAGCTATGGCGCGCCGGGCGGTGGAAAC

SEQ ID NO:7：

GGCGGAGGTGGGAGCGGAGGTGGCGGGAGCGAAGCGGCAGCTAAGGAGGCGGCTGCCAAAGGCGGAGGTGGGAGCGGAGGTGGCGGGAGC

HindIII and Xho I were used to double cleave pET22b (+) -OPH and PUC18-Linker-RNP in the following systems:

Hind III：1μL；

Xho I：1μL；

10×Buffer：2μL；

PUC18-Linker-RNP or pET22b (+) -OPH: 5 mu L of the solution;

sterile water: make up to 20 μ L.

Adding the system into a centrifuge tube, mixing and uniformly mixing, and performing enzyme digestion at 37 ℃ for 2-3 h. Then, the Linker-RNP gene fragment and the linearized pET22b (+) -OPH are recovered according to a gel recovery kit (Takara Bio-engineering Co., Ltd.). The Linker-RNP gene fragment recovered from the gel was ligated with pET22b (+) -OPH by T4 ligase (Takara Shuzo Co., Ltd., Dalian). The connecting body is as follows:

10×T4 Ligase buffer：2μL；

pET22b (+) -OPH: depending on the concentration recovered;

PUC 18-Linker-RNP: depending on the concentration recovered;

T4 DNA Ligase(10U/μL)：1μL；

sterile water: make up to 20 μ L.

The ligation reaction is carried out for 18h in an incubator at 16 ℃, after the reaction is finished, a recombinant plasmid pET22b (+) -OPH-Linker-RNP is obtained, named OPH-Linker-RNP, the amino acid sequence of the OPH-Linker-RNP is shown as SEQ ID NO:1, the nucleotide sequence for coding the OPH-Linker-RNP is shown as SEQ ID NO:2, and the nucleotide sequence and the restriction enzyme sites are shown as FIG. 1.

SEQ ID NO:1：

MQTRRVVLKSAAAAGTLLGGLAGCASVAGSIGTGDRINTVRGPITISEAGFTLTHEHICGSSAGFLRAWPEFFGSRKALAEKAVRGLRRARAAGVRTIVDVSTFDIGRDVSLLAEVSRAADVHIVAATGLWFDPPLSMRLRSVEELTQFFLREIQYGIEDTGIRAGIIKVATTGKATPFQELVLKAAARASLATGVPVTTHTAASQRDGEQQAAIFESEGLSPSRVCIGHSDDTDDLSYLTALAARGYLIGLDHIPHSAIGLEDNASASALLGIRSWQTRALLIKALIDQGYMKQILVSNDWLFGFSSYVTNIMDVMDRVNPDGMAFIPLRVIPFLREKGVPQETLAGITVTNPARFLSPTLRASGGGGSGGGGSEAAAKEAAAKGGGGSGGGGSPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGNPSSSYGAPGGGN

SEQ ID NO:2

ATGCAAACGAGAAGGGTTGTGCTCAAGTCTGCGGCCGCCGCAGGAACTCTGCTCGGCGGCCTGGCTGGGTGCGCGAGCGTGGCTGGATCGATCGGCACAGGCGATCGGATCAATACCGTGCGCGGTCCTATCACAATCTCTGAAGCGGGTTTCACACTGACTCACGAGCACATCTGCGGCAGCTCGGCAGGATTCTTGCGTGCTTGGCCAGAGTTCTTCGGTAGCCGCAAAGCTCTAGCGGAAAAGGCTGTGAGAGGATTGCGCCGCGCCAGAGCGGCTGGCGTGCGAACGATTGTCGATGTGTCGACTTTCGATATCGGTCGCGACGTCAGTTTATTGGCCGAGGTTTCGCGGGCTGCCGACGTTCATATCGTGGCGGCGACCGGCTTGTGGTTCGACCCGCCACTTTCGATGCGATTGAGGAGTGTAGAGGAACTCACACAGTTCTTCCTGCGTGAGATTCAATATGGCATCGAAGACACCGGAATTAGGGCGGGCATTATCAAGGTCGCGACCACAGGCAAGGCGACCCCCTTTCAGGAGTTAGTGTTAAAGGCGGCCGCCCGGGCCAGCTTGGCCACCGGTGTTCCGGTAACCACTCACACGGCAGCAAGTCAGCGCGATGGTGAGCAGCAGGCCGCCATTTTTGAGTCCGAAGGCTTGAGCCCCTCACGGGTTTGTATTGGTCACAGCGATGATACTGACGATTTGAGCTATCTCACCGCCCTCGCTGCGCGCGGATACCTCATCGGTCTAGACCACATCCCGCACAGTGCGATTGGTCTAGAAGATAATGCGAGTGCATCAGCCCTCCTGGGCATCCGTTCGTGGCAAACACGGGCTCTCTTGATCAAGGCGCTCATCGACCAAGGCTACATGAAACAAATCCTCGTTTCGAATGACTGGCTGTTCGGGTTTTCGAGCTATGTCACCAACATCATGGACGTGATGGATCGCGTGAACCCCGACGGGATGGCCTTCATTCCACTGAGAGTGATCCCATTCCTACGAGAGAAGGGCGTCCCACAGGAAACGCTGGCAGGCATCACTGTGACTAACCCGGCGCGGTTCTTGTCACCGACCTTGCGGGCGTCAGGCGGAGGTGGGAGCGGAGGTGGCGGGAGCGAAGCGGCAGCTAAGGAGGCGGCTGCCAAAGGCGGAGGTGGGAGCGGAGGTGGCGGGAGCCCGAGCAGCAGTTATGGCGCGCCGGGCGGTGGGAACCCAAGCAGTAGTTATGGCGCGCCGGGGGGCGGAAACCCTAGTAGCAGCTATGGCGCGCCGGGTGGAGGCAACCCCAGCAGCAGTTATGGCGCGCCGGGAGGTGGTAACCCCAGCAGTAGCTATGGCGCGCCGGGCGGTGGAAACCCGAGCAGCAGTTATGGCGCGCCGGGCGGTGGGAACCCAAGCAGTAGTTATGGCGCGCCGGGGGGCGGAAACCCTAGTAGCAGCTATGGCGCGCCGGGTGGAGGCAACCCCAGCAGCAGTTATGGCGCGCCGGGAGGTGGTAACCCCAGCAGTAGCTATGGCGCGCCGGGCGGTGGAAACCCGAGCAGCAGTTATGGCGCGCCGGGCGGTGGGAACCCAAGCAGTAGTTATGGCGCGCCGGGGGGCGGAAACCCTAGTAGCAGCTATGGCGCGCCGGGTGGAGGCAACCCCAGCAGCAGTTATGGCGCGCCGGGAGGTGGTAACCCCAGCAGTAGCTATGGCGCGCCGGGCGGTGGAAACCCGAGCAGCAGTTATGGCGCGCCGGGCGGTGGGAACCCAAGCAGTAGTTATGGCGCGCCGGGGGGCGGAAACCCTAGTAGCAGCTATGGCGCGCCGGGTGGAGGCAACCCCAGCAGCAGTTATGGCGCGCCGGGAGGTGGTAACCCCAGCAGTAGCTATGGCGCGCCGGGCGGTGGAAACCCGAGCAGCAGTTATGGCGCGCCGGGCGGTGGGAACCCAAGCAGTAGTTATGGCGCGCCGGGGGGCGGAAACCCTAGTAGCAGCTATGGCGCGCCGGGTGGAGGCAACCCCAGCAGCAGTTATGGCGCGCCGGGAGGTGGTAACCCCAGCAGTAGCTATGGCGCGCCGGGCGGTGGAAACCCGAGCAGCAGTTATGGCGCGCCGGGCGGTGGGAACCCAAGCAGTAGTTATGGCGCGCCGGGGGGCGGAAACCCTAGTAGCAGCTATGGCGCGCCGGGTGGAGGCAACCCCAGCAGCAGTTATGGCGCGCCGGGAGGTGGTAACCCCAGCAGTAGCTATGGCGCGCCGGGCGGTGGAAAC

Example 2: escherichia coli for expanding culture and expression of OPH-Linker-RNP

(1) The recombinant plasmid pET22b (+) -OPH-Linker-RNP obtained in example 1 was transformed into E.coli BL21(DE3) competence using a standard heat shock method to obtain transformed recombinant E.coli BL21(DE 3). Then the recombinant Escherichia coli BL21(DE3) was transferred to a solid LB medium (agar powder 15g/L, tryptone 10g/L, yeast extract 5g/L, sodium chloride 10g/L, pH7.4) supplemented with 50. mu.g/mL kanamycin, and cultured overnight at 37 ℃ and then the individual colonies after overnight culture were transferred to 5mL of a liquid LB medium (tryptone 10g/L, yeast extract 5g/L, sodium chloride 10g/L, pH7.4) containing 50. mu.g/mL kanamycin and cultured overnight at 37 ℃ with a orbital shaker at 200rpm, followed by 3mL of overnight-cultured Escherichia coli BL21 inoculated in 300mL of a liquid LB medium containing 50. mu.g/mL kanamycin at 37 ℃ for 3 hours at 200rpm until the OD of Escherichia coli BL21₆₀₀To 0.4-0.6.

(2) The LB liquid medium containing recombinant E.coli BL21(DE3) obtained in step (1) was placed on ice for 20 minutes, to which isopropyl β -D-1-thiogalactopyranoside (IPTG) was added to a final concentration of 0.4mM, followed by shaking culture at 180rpm at 25 ℃ and 37 ℃ for 16-20 hours, respectively, to induce expression of recombinant organophosphorus hydrolase OPH-Linker-RNP. After induction expression, the liquid culture medium is centrifuged at 3000rpm and 4 ℃ for 20 minutes, the supernatant is discarded, cell precipitates cultured at different temperatures are obtained, and the cell precipitates are stored at-80 ℃ for later use.

(3) The cell pellets obtained in step (2) at the culture temperatures of 25 ℃ and 37 ℃ were thawed, resuspended in 10mL of Tris-HCl (50mM, pH 8.0), and centrifuged at 3000rpm for 20 minutes at 4 ℃ and the supernatant discarded, and the cells were collected and washed twice with 50mM Tris-HCl pH 8.0. Then, the cells were resuspended in 20mL of Tris-HCl buffer containing 1mM phenylmethylsulfonyl fluoride (PMSF, 200. mu.L) and subjected to ultrasonic lysis on ice for 30 minutes using an ultrasonic cell disruptor, followed by alternate sonication for 6s and intermittent cooling for 6s, and the whole reaction was allowed to proceed under an ice-water bath to obtain a lysate. After the completion of the sonication, the lysate was centrifuged at 14,000rpm for 30min at 4 ℃ to obtain the supernatant and the precipitate, the supernatant was transferred to a new EP tube, and the supernatant and the precipitate were stored.

In this example, in order to determine the form in which the expressed OPH-Linker-RNP exists, the above-obtained lysates, supernatants and pellets were subjected to SDS-PAGE analysis, and the results are shown in FIG. 2. FIG. 2 is a SDS-PAGE graph of OPH-Linker-RNP induced expression, and it can be seen from the graph that under the induction condition of 25 ℃, a band is obviously increased at the position of 75kDa of the target size in the supernatant of OPH-Linker-RNP, which indicates successful induction and obtains soluble recombinant OPH-Linker-RNP, so that the recombinant OPH-Linker-RNP exists in a soluble form.

Example 3: salting out and heating to purify OPH-Linker-RNP

In this example, OPH was purified by salting out heating, thereby confirming the purification performance and purification efficiency of OPH prepared in example 2. Adding appropriate amount of (NH) with concentration of 0.3-2.0M₄)₂SO₄Adding into 500 μ L of clarified sample lysate, standing at 4 deg.C for 30min to allow protein to precipitate sufficiently, centrifuging at 15000g for 30min, and dissolving precipitate in PBS solution again. Heating the solution dissolved in PBS on a magnetic stirring heater at 50, 60, 70 and 80 ℃ for 15min respectively, naturally cooling at room temperature, centrifuging at 4 ℃ and 15000g for 15min, and collecting supernatant to obtain soluble protein solution, namely target protein OPH-Linker-RNP. And carrying out SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) electrophoresis detection and subsequent enzyme activity detection on the purified sample.

FIG. 3 is a SDS-PAGE graph of resuspended PBS buffer heated at different temperatures (50, 60, 70, 80 ℃) for 15min, from which it can be seen that the purification effect is best at 70-80 ℃. FIG. 4 shows the recovery rate and the purification multiple of OPH-Linker-RNP heated for 15min at different temperatures, and the results show that the purification multiple and the recovery rate at 70-80 ℃ can reach 9.39 times, 9.51 times, 81.12% and 79.23% respectively, and further show that the purification effect at 70-80 ℃ is optimal. Compared with the purification of recombinant protein containing His label through Ni-NTA affinity, the method of the invention has the advantages that the protein purification multiple is equivalent, but the target protein can be obtained only through the simple purification process of salting out and heating, the operation is simple, the purification time is short, and the tedious experimental process of affinity chromatography is avoided.

Example 4: heat stability and storage stability test of OPH-Linker-RNP

One of the products of the OPH for hydrolyzing the organophosphorus compound absorbs nitrophenol at the position of 400nm, so the enzyme activity of the organophosphorus hydrolase is calculated by detecting the concentration of the nitrophenol of the hydrolysate by an absorbance method. OPH-Linker was obtained by the method of example 3, except that RNP was not added, and the same procedure was used as a control.

1 OPH enzyme activity unit (U) is defined as the amount of enzyme required to hydrolyze 1. mu. mol/L of paraoxon per minute. OPH hydrolyzes a substrate (paraoxon) to generate a byproduct p-nitrophenol (PNP) having a maximum light absorption at 400nm, and thus OPH is performed by measuring a change in an absorbance value in a reaction system. The determination method comprises the following steps: the change of the absorbance value of the enzyme activity reaction system within 2min is measured at 400nm on an ultraviolet visible spectrophotometer (Beckman DU-800).

The enzyme activity reaction system is as follows: 445. mu.L of 250mM CHES buffer (1.244 g CHES dissolved in 40mL sterile deionized water, pH9.0 adjusted with 1M NaOH, and 100mL of methanol added), 440. mu.L of sterile deionized water, 5. mu.L of 10mM CoCl ₂10. mu.L of paraoxon at a concentration of 20mM and 100. mu.L of an organophosphorus hydrolase solution, totaling 1000. mu.L.

Equal amounts of OPH-Linker-RNP and OPH-Linker were kept at different temperatures (20-80 ℃) for 30 minutes without reaction solution (containing only OPH-Linker-RNP or OPH-Linker solution without reaction solution). The enzyme was then transferred to room temperature to adjust the enzyme temperature and centrifuged at 12000rpm for 10 minutes to remove denatured and precipitated proteins. The OPH enzyme activity is determined according to the method, the highest point enzyme activity is taken as 100%, other enzyme activity values are compared with the highest point enzyme activity value, and curves of different temperatures to relative activity are drawn.

FIG. 4 is a graph showing the thermal stability of OPH-Linker-RNP and OPH-Linker, from which it can be seen that the relative enzyme activities of OPH-Linker-RNP and OPH-Linker at different temperatures. When the temperature is increased to 50 ℃, the OPH-Linker enzyme activity is only 44.68%, and the OPH-Linker-RNP can still maintain 82.20% of activity; at 60 ℃, the activity of OPH-Linker enzyme is only 28.81 percent, and OPH-Linker-RNP can still keep 80.43 percent of activity; at 80 ℃, the OPH-Linker enzyme activity is only 8.81 percent, and the OPH-Linker-RNP can still maintain 59.56 percent of activity. Therefore, the OPH-Linker-RNP prepared by the invention has good thermal stability.

The storage stability of OPH-Linker-RNP and OPH-Linker was also examined in this example. And (2) storing the OPH-Linker-RNP and the OPH-Linker enzyme at 25 ℃, detecting the enzyme activity according to the method in the embodiment 4 when storing for 0, 6, 12, 24, 36, 42 and 48 days respectively, comparing other enzyme activities with the highest point enzyme activity by taking the highest point enzyme activity as 100%, and simultaneously drawing a curve of time to relative enzyme activity.

FIG. 5 is a graph showing the storage stability of OPH-Linker-RNP and OPH-Linker, i.e., the relative enzyme activities of OPH-Linker-RNP and OPH-Linker, when stored for different days. It can be seen from the figure that the OPH-Linker-RNP enzyme activity is high at 25 ℃ and the OPH-Linker enzyme activity is high.

In conclusion, the OPH-Linker-RNP enzyme has significantly higher thermal and storage stability than OPH-Linker enzyme. The heat and storage stability of the modified OPH is obviously improved, and the OPH can be quickly and efficiently separated and purified by self. The result shows that the strategy can be widely applied to the improvement of enzymology properties, accelerates the application of the enzyme in OPH production and life, and has important social and economic significance.

Example 5: degradation effect of OPH-Linker-RNP on organic pesticide

And (3) measuring the degradation efficiency of the OPH-Linker-RNP to 3 common organophosphorus pesticides (methyl parathion, methylamine and chlorpyrifos). The assay was performed by adding 10uL of a stock solution (final concentration: 2mM) of a pesticide substrate and 1U of purified OPH-Linker-RNP to 990uL of Tris-HcL buffer (50mM, pH 7.0) and reacting at 30 ℃ for 30 min. And (3) diluting and filtering the reaction solution, and then carrying out high performance liquid chromatography detection.

The HPLC analysis conditions of the methyl parathion are as follows: a C18 column; acetonitrile/water (70:30, v/v); 1.0 ml/min; 273 nm.

The methylamine HPLC analysis conditions are as follows: a C18 column; acetonitrile/water (70:30, v/v); 1.0 ml/min; 225 nm.

The chlorpyrifos HPLC analysis conditions are as follows: a C18 column; methanol/water (90:10, v/v); 1.0 ml/min; 230 nm.

The results show that the degradation rates of OPH-Linker-RNP on the tested methyl parathion, methylamine and chlorpyrifos are respectively 89.1%, 64.2% and 41.2%, which indicates that the OPH-Linker-RNP can degrade the tested organophosphorus pesticide.

The present invention is not limited to the above-described embodiments, and any obvious improvements, substitutions or modifications can be made by those skilled in the art without departing from the spirit of the present invention.

Sequence listing

<110> university of Jiangsu

<120> recombinant organophosphorus hydrolase, construction method and application thereof

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 755

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Gln Thr Arg Arg Val Val Leu Lys Ser Ala Ala Ala Ala Gly Thr

1 5 10 15

Leu Leu Gly Gly Leu Ala Gly Cys Ala Ser Val Ala Gly Ser Ile Gly

20 25 30

Thr Gly Asp Arg Ile Asn Thr Val Arg Gly Pro Ile Thr Ile Ser Glu

35 40 45

Ala Gly Phe Thr Leu Thr His Glu His Ile Cys Gly Ser Ser Ala Gly

50 55 60

Phe Leu Arg Ala Trp Pro Glu Phe Phe Gly Ser Arg Lys Ala Leu Ala

65 70 75 80

Glu Lys Ala Val Arg Gly Leu Arg Arg Ala Arg Ala Ala Gly Val Arg

85 90 95

Thr Ile Val Asp Val Ser Thr Phe Asp Ile Gly Arg Asp Val Ser Leu

100 105 110

Leu Ala Glu Val Ser Arg Ala Ala Asp Val His Ile Val Ala Ala Thr

115 120 125

Gly Leu Trp Phe Asp Pro Pro Leu Ser Met Arg Leu Arg Ser Val Glu

130 135 140

Glu Leu Thr Gln Phe Phe Leu Arg Glu Ile Gln Tyr Gly Ile Glu Asp

145 150 155 160

Thr Gly Ile Arg Ala Gly Ile Ile Lys Val Ala Thr Thr Gly Lys Ala

165 170 175

Thr Pro Phe Gln Glu Leu Val Leu Lys Ala Ala Ala Arg Ala Ser Leu

180 185 190

Ala Thr Gly Val Pro Val Thr Thr His Thr Ala Ala Ser Gln Arg Asp

195 200 205

Gly Glu Gln Gln Ala Ala Ile Phe Glu Ser Glu Gly Leu Ser Pro Ser

210 215 220

Arg Val Cys Ile Gly His Ser Asp Asp Thr Asp Asp Leu Ser Tyr Leu

225 230 235 240

Thr Ala Leu Ala Ala Arg Gly Tyr Leu Ile Gly Leu Asp His Ile Pro

245 250 255

His Ser Ala Ile Gly Leu Glu Asp Asn Ala Ser Ala Ser Ala Leu Leu

260 265 270

Gly Ile Arg Ser Trp Gln Thr Arg Ala Leu Leu Ile Lys Ala Leu Ile

275 280 285

Asp Gln Gly Tyr Met Lys Gln Ile Leu Val Ser Asn Asp Trp Leu Phe

290 295 300

Gly Phe Ser Ser Tyr Val Thr Asn Ile Met Asp Val Met Asp Arg Val

305 310 315 320

Asn Pro Asp Gly Met Ala Phe Ile Pro Leu Arg Val Ile Pro Phe Leu

325 330 335

Arg Glu Lys Gly Val Pro Gln Glu Thr Leu Ala Gly Ile Thr Val Thr

340 345 350

Asn Pro Ala Arg Phe Leu Ser Pro Thr Leu Arg Ala Ser Gly Gly Gly

355 360 365

Gly Ser Gly Gly Gly Gly Ser Glu Ala Ala Ala Lys Glu Ala Ala Ala

370 375 380

Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Pro Ser Ser Ser Tyr

385 390 395 400

Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro Gly

405 410 415

Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn Pro

420 425 430

Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser Tyr

435 440 445

Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro Gly

450 455 460

Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn Pro

465 470 475 480

Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser Tyr

485 490 495

Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro Gly

500 505 510

Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn Pro

515 520 525

Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser Tyr

530 535 540

Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro Gly

545 550 555 560

Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn Pro

565 570 575

Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser Tyr

580 585 590

Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro Gly

595 600 605

Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn Pro

610 615 620

Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser Tyr

625 630 635 640

Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro Gly

645 650 655

Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn Pro

660 665 670

Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser Tyr

675 680 685

Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro Gly

690 695 700

Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn Pro

705 710 715 720

Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser Tyr

725 730 735

Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro Gly

740 745 750

Gly Gly Asn

755

<210> 2

<211> 2265

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgcaaacga gaagggttgt gctcaagtct gcggccgccg caggaactct gctcggcggc 60

ctggctgggt gcgcgagcgt ggctggatcg atcggcacag gcgatcggat caataccgtg 120

cgcggtccta tcacaatctc tgaagcgggt ttcacactga ctcacgagca catctgcggc 180

agctcggcag gattcttgcg tgcttggcca gagttcttcg gtagccgcaa agctctagcg 240

gaaaaggctg tgagaggatt gcgccgcgcc agagcggctg gcgtgcgaac gattgtcgat 300

gtgtcgactt tcgatatcgg tcgcgacgtc agtttattgg ccgaggtttc gcgggctgcc 360

gacgttcata tcgtggcggc gaccggcttg tggttcgacc cgccactttc gatgcgattg 420

aggagtgtag aggaactcac acagttcttc ctgcgtgaga ttcaatatgg catcgaagac 480

accggaatta gggcgggcat tatcaaggtc gcgaccacag gcaaggcgac cccctttcag 540

gagttagtgt taaaggcggc cgcccgggcc agcttggcca ccggtgttcc ggtaaccact 600

cacacggcag caagtcagcg cgatggtgag cagcaggccg ccatttttga gtccgaaggc 660

ttgagcccct cacgggtttg tattggtcac agcgatgata ctgacgattt gagctatctc 720

accgccctcg ctgcgcgcgg atacctcatc ggtctagacc acatcccgca cagtgcgatt 780

ggtctagaag ataatgcgag tgcatcagcc ctcctgggca tccgttcgtg gcaaacacgg 840

gctctcttga tcaaggcgct catcgaccaa ggctacatga aacaaatcct cgtttcgaat 900

gactggctgt tcgggttttc gagctatgtc accaacatca tggacgtgat ggatcgcgtg 960

aaccccgacg ggatggcctt cattccactg agagtgatcc cattcctacg agagaagggc 1020

gtcccacagg aaacgctggc aggcatcact gtgactaacc cggcgcggtt cttgtcaccg 1080

accttgcggg cgtcaggcgg aggtgggagc ggaggtggcg ggagcgaagc ggcagctaag 1140

gaggcggctg ccaaaggcgg aggtgggagc ggaggtggcg ggagcccgag cagcagttat 1200

ggcgcgccgg gcggtgggaa cccaagcagt agttatggcg cgccgggggg cggaaaccct 1260

agtagcagct atggcgcgcc gggtggaggc aaccccagca gcagttatgg cgcgccggga 1320

ggtggtaacc ccagcagtag ctatggcgcg ccgggcggtg gaaacccgag cagcagttat 1380

ggcgcgccgg gcggtgggaa cccaagcagt agttatggcg cgccgggggg cggaaaccct 1440

agtagcagct atggcgcgcc gggtggaggc aaccccagca gcagttatgg cgcgccggga 1500

ggtggtaacc ccagcagtag ctatggcgcg ccgggcggtg gaaacccgag cagcagttat 1560

ggcgcgccgg gcggtgggaa cccaagcagt agttatggcg cgccgggggg cggaaaccct 1620

agtagcagct atggcgcgcc gggtggaggc aaccccagca gcagttatgg cgcgccggga 1680

ggtggtaacc ccagcagtag ctatggcgcg ccgggcggtg gaaacccgag cagcagttat 1740

ggcgcgccgg gcggtgggaa cccaagcagt agttatggcg cgccgggggg cggaaaccct 1800

agtagcagct atggcgcgcc gggtggaggc aaccccagca gcagttatgg cgcgccggga 1860

ggtggtaacc ccagcagtag ctatggcgcg ccgggcggtg gaaacccgag cagcagttat 1920

ggcgcgccgg gcggtgggaa cccaagcagt agttatggcg cgccgggggg cggaaaccct 1980

agtagcagct atggcgcgcc gggtggaggc aaccccagca gcagttatgg cgcgccggga 2040

ggtggtaacc ccagcagtag ctatggcgcg ccgggcggtg gaaacccgag cagcagttat 2100

ggcgcgccgg gcggtgggaa cccaagcagt agttatggcg cgccgggggg cggaaaccct 2160

agtagcagct atggcgcgcc gggtggaggc aaccccagca gcagttatgg cgcgccggga 2220

ggtggtaacc ccagcagtag ctatggcgcg ccgggcggtg gaaac 2265

<210> 3

<211> 365

<212> PRT

<213> Flavobacterium (Flavobacterium)

<400> 3

Met Gln Thr Arg Arg Val Val Leu Lys Ser Ala Ala Ala Ala Gly Thr

1 5 10 15

Leu Leu Gly Gly Leu Ala Gly Cys Ala Ser Val Ala Gly Ser Ile Gly

20 25 30

Thr Gly Asp Arg Ile Asn Thr Val Arg Gly Pro Ile Thr Ile Ser Glu

35 40 45

Ala Gly Phe Thr Leu Thr His Glu His Ile Cys Gly Ser Ser Ala Gly

50 55 60

Phe Leu Arg Ala Trp Pro Glu Phe Phe Gly Ser Arg Lys Ala Leu Ala

65 70 75 80

Glu Lys Ala Val Arg Gly Leu Arg Arg Ala Arg Ala Ala Gly Val Arg

85 90 95

Thr Ile Val Asp Val Ser Thr Phe Asp Ile Gly Arg Asp Val Ser Leu

100 105 110

Leu Ala Glu Val Ser Arg Ala Ala Asp Val His Ile Val Ala Ala Thr

115 120 125

Gly Leu Trp Phe Asp Pro Pro Leu Ser Met Arg Leu Arg Ser Val Glu

130 135 140

Glu Leu Thr Gln Phe Phe Leu Arg Glu Ile Gln Tyr Gly Ile Glu Asp

145 150 155 160

Thr Gly Ile Arg Ala Gly Ile Ile Lys Val Ala Thr Thr Gly Lys Ala

165 170 175

Thr Pro Phe Gln Glu Leu Val Leu Lys Ala Ala Ala Arg Ala Ser Leu

180 185 190

Ala Thr Gly Val Pro Val Thr Thr His Thr Ala Ala Ser Gln Arg Asp

195 200 205

Gly Glu Gln Gln Ala Ala Ile Phe Glu Ser Glu Gly Leu Ser Pro Ser

210 215 220

Arg Val Cys Ile Gly His Ser Asp Asp Thr Asp Asp Leu Ser Tyr Leu

225 230 235 240

Thr Ala Leu Ala Ala Arg Gly Tyr Leu Ile Gly Leu Asp His Ile Pro

245 250 255

His Ser Ala Ile Gly Leu Glu Asp Asn Ala Ser Ala Ser Ala Leu Leu

260 265 270

Gly Ile Arg Ser Trp Gln Thr Arg Ala Leu Leu Ile Lys Ala Leu Ile

275 280 285

Asp Gln Gly Tyr Met Lys Gln Ile Leu Val Ser Asn Asp Trp Leu Phe

290 295 300

Gly Phe Ser Ser Tyr Val Thr Asn Ile Met Asp Val Met Asp Arg Val

305 310 315 320

Asn Pro Asp Gly Met Ala Phe Ile Pro Leu Arg Val Ile Pro Phe Leu

325 330 335

Arg Glu Lys Gly Val Pro Gln Glu Thr Leu Ala Gly Ile Thr Val Thr

340 345 350

Asn Pro Ala Arg Phe Leu Ser Pro Thr Leu Arg Ala Ser

355 360 365

<210> 4

<211> 1095

<212> DNA

<213> Flavobacterium (Flavobacterium)

<400> 4

atgcaaacga gaagggttgt gctcaagtct gcggccgccg caggaactct gctcggcggc 60

ctggctgggt gcgcgagcgt ggctggatcg atcggcacag gcgatcggat caataccgtg 120

cgcggtccta tcacaatctc tgaagcgggt ttcacactga ctcacgagca catctgcggc 180

agctcggcag gattcttgcg tgcttggcca gagttcttcg gtagccgcaa agctctagcg 240

gaaaaggctg tgagaggatt gcgccgcgcc agagcggctg gcgtgcgaac gattgtcgat 300

gtgtcgactt tcgatatcgg tcgcgacgtc agtttattgg ccgaggtttc gcgggctgcc 360

gacgttcata tcgtggcggc gaccggcttg tggttcgacc cgccactttc gatgcgattg 420

aggagtgtag aggaactcac acagttcttc ctgcgtgaga ttcaatatgg catcgaagac 480

accggaatta gggcgggcat tatcaaggtc gcgaccacag gcaaggcgac cccctttcag 540

gagttagtgt taaaggcggc cgcccgggcc agcttggcca ccggtgttcc ggtaaccact 600

cacacggcag caagtcagcg cgatggtgag cagcaggccg ccatttttga gtccgaaggc 660

ttgagcccct cacgggtttg tattggtcac agcgatgata ctgacgattt gagctatctc 720

accgccctcg ctgcgcgcgg atacctcatc ggtctagacc acatcccgca cagtgcgatt 780

ggtctagaag ataatgcgag tgcatcagcc ctcctgggca tccgttcgtg gcaaacacgg 840

gctctcttga tcaaggcgct catcgaccaa ggctacatga aacaaatcct cgtttcgaat 900

gactggctgt tcgggttttc gagctatgtc accaacatca tggacgtgat ggatcgcgtg 960

aaccccgacg ggatggcctt cattccactg agagtgatcc cattcctacg agagaagggc 1020

gtcccacagg aaacgctggc aggcatcact gtgactaacc cggcgcggtt cttgtcaccg 1080

accttgcggg cgtca 1095

<210> 5

<211> 360

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Pro Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser

1 5 10 15

Tyr Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro

20 25 30

Gly Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn

35 40 45

Pro Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser

50 55 60

Tyr Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro

65 70 75 80

Gly Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn

85 90 95

Pro Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser

100 105 110

Tyr Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro

115 120 125

Gly Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn

130 135 140

Pro Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser

145 150 155 160

Tyr Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro

165 170 175

Gly Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn

180 185 190

Pro Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser

195 200 205

Tyr Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro

210 215 220

Gly Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn

225 230 235 240

Pro Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser

245 250 255

Tyr Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro

260 265 270

Gly Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn

275 280 285

Pro Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser

290 295 300

Tyr Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro

305 310 315 320

Gly Gly Gly Asn Pro Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn

325 330 335

Pro Ser Ser Ser Tyr Gly Ala Pro Gly Gly Gly Asn Pro Ser Ser Ser

340 345 350

Tyr Gly Ala Pro Gly Gly Gly Asn

355 360

<210> 6

<211> 1080

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ccgagcagca gttatggcgc gccgggcggt gggaacccaa gcagtagtta tggcgcgccg 60

gggggcggaa accctagtag cagctatggc gcgccgggtg gaggcaaccc cagcagcagt 120

tatggcgcgc cgggaggtgg taaccccagc agtagctatg gcgcgccggg cggtggaaac 180

ccgagcagca gttatggcgc gccgggcggt gggaacccaa gcagtagtta tggcgcgccg 240

gggggcggaa accctagtag cagctatggc gcgccgggtg gaggcaaccc cagcagcagt 300

tatggcgcgc cgggaggtgg taaccccagc agtagctatg gcgcgccggg cggtggaaac 360

ccgagcagca gttatggcgc gccgggcggt gggaacccaa gcagtagtta tggcgcgccg 420

gggggcggaa accctagtag cagctatggc gcgccgggtg gaggcaaccc cagcagcagt 480

tatggcgcgc cgggaggtgg taaccccagc agtagctatg gcgcgccggg cggtggaaac 540

ccgagcagca gttatggcgc gccgggcggt gggaacccaa gcagtagtta tggcgcgccg 600

gggggcggaa accctagtag cagctatggc gcgccgggtg gaggcaaccc cagcagcagt 660

tatggcgcgc cgggaggtgg taaccccagc agtagctatg gcgcgccggg cggtggaaac 720

ccgagcagca gttatggcgc gccgggcggt gggaacccaa gcagtagtta tggcgcgccg 780

gggggcggaa accctagtag cagctatggc gcgccgggtg gaggcaaccc cagcagcagt 840

tatggcgcgc cgggaggtgg taaccccagc agtagctatg gcgcgccggg cggtggaaac 900

ccgagcagca gttatggcgc gccgggcggt gggaacccaa gcagtagtta tggcgcgccg 960

gggggcggaa accctagtag cagctatggc gcgccgggtg gaggcaaccc cagcagcagt 1020

tatggcgcgc cgggaggtgg taaccccagc agtagctatg gcgcgccggg cggtggaaac 1080

<210> 7

<211> 90

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ggcggaggtg ggagcggagg tggcgggagc gaagcggcag ctaaggaggc ggctgccaaa 60

ggcggaggtg ggagcggagg tggcgggagc 90

Claims

1. The recombinant organophosphorus hydrolase is characterized in that the recombinant organophosphorus hydrolase is marked as OPH-Linker-RNP, the amino acid sequence of the recombinant organophosphorus hydrolase is shown as SEQ ID NO. 1, and the nucleotide sequence for coding the recombinant organophosphorus hydrolase is shown as SEQ ID NO. 2.

2. The method for constructing a recombinant organophosphorus hydrolase according to claim 1, which comprises:

and (3) connecting the organophosphorus hydrolase OPH with the resinol mimic protein RNP through a connector to obtain the recombinant organophosphorus hydrolase OPH-connector-RNP.

3. The method for constructing recombinant organophosphorus hydrolase according to claim 2, wherein the amino acid sequence of organophosphorus hydrolase OPH is represented by SEQ ID NO. 3, and the nucleotide sequence encoding the organophosphorus hydrolase OPH is represented by SEQ ID NO. 4.

4. The method for constructing recombinant organophosphorus hydrolase according to claim 2, wherein said RNP is an artificial polypeptide which mimics a resin protein and is composed of 30 repetitive sequences of 12 peptides, and the amino acid sequence of said artificial polypeptide is represented by SEQ ID NO. 5.

5. The construction method of the recombinant organophosphorus hydrolase according to claim 2, wherein the Linker is connecting peptide GGGGSGGGGSEAAAKEAAAKGGGGSGGGGS, and the nucleotide sequence of the Linker is shown in SEQ ID NO. 7.

6. A recombinant expression plasmid comprising a nucleotide encoding the recombinant organophosphorous hydrolase according to claim 1.

7. A recombinant bacterium comprising the recombinant expression plasmid of claim 6.

8. The use of the recombinant organophosphorus hydrolase according to claim 1, the recombinant expression plasmid according to claim 6 or the recombinant bacterium according to claim 7 for degrading organophosphorus pesticides.