CN112029698A

CN112029698A - Engineering bacterium for degrading organophosphorus pesticide and construction method thereof

Info

Publication number: CN112029698A
Application number: CN202010958992.4A
Authority: CN
Inventors: 杨超; 刘瑞华; 吴云波; 张伊婷; 霍凯悦
Original assignee: Nankai University
Current assignee: Nankai University
Priority date: 2020-09-14
Filing date: 2020-09-14
Publication date: 2020-12-04

Abstract

The invention provides an engineering bacterium for degrading organophosphorus pesticide and a construction method thereof, belonging to the technical field of microorganisms, and the engineering bacterium is obtained by inserting an mpd gene, an opd gene, a vgb gene and a gfp gene into a P.putida KT2440 host bacterium; the insertion sequence is mpd-opd-vgb-gfp. The engineering strain provided by the invention can normally grow under the culture condition and can stably express exogenous genes.

Description

Engineering bacterium for degrading organophosphorus pesticide and construction method thereof

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to an engineering bacterium for degrading organophosphorus pesticide and a construction method thereof.

Background

Residual pesticides in the environment can be disposed of by a variety of methods, among which bioremediation is safer and more effective. However, when a plurality of pesticides exist in the environment at the same time, a plurality of engineering strains are needed for degradation, and the strains cause resource competition, but may cause incomplete degradation and accumulation of intermediate product toxins. Plasmid-type expression and nicked insertion of foreign genes in many studies have resulted in inefficient and unstable expression of foreign genes by host strains.

Disclosure of Invention

In view of the above, the present invention aims to provide an engineering bacterium for degrading organophosphorus pesticides and a construction method thereof, and the engineering bacterium is constructed by traceless insertion, so that exogenous genes can be stably expressed.

In order to achieve the above purpose, the invention provides the following technical scheme:

the invention provides an engineering bacterium for degrading organophosphorus pesticide, which is obtained by inserting an mpd gene, an opd gene, a vgb gene and a gfp gene into a P.putida KT2440 host bacterium; the insertion sequence is mpd-opd-vgb-gfp.

The invention also provides a construction method of the engineering bacteria in the technical scheme, which comprises the following steps:

1) respectively carrying out first fusion on a constitutive promoter J23119 and an RBS (receptor binding site) with an mpd gene, an opd gene, a vgb gene and a gfp gene to obtain a first fusion product of the four genes;

the nucleotide sequence of the RBS is shown as SEQ ID No. 1;

2) carrying out second fusion on the first fusion products of the mpd and opd genes obtained in the step 1) and a lambda T0terminator respectively to obtain second fusion products of the two genes;

3) carrying out second fusion on the first fusion products of the vgb and gfp genes obtained in the step 1) and the upstream and downstream homology arms, carrying out third fusion on the second fusion products of the two genes obtained in the step 2) and the upstream and downstream homology arms to obtain expression cassettes of four genes, and respectively connecting the expression cassettes of the four genes to a suicide plasmid pKU with a reverse screening marker upp to obtain a targeting vector of the four genes;

4) chemically transforming the targeting vectors of the four genes obtained in the step 3) into E.coli Mach1-T1 competent cells, and extracting plasmids to obtain insertion vectors of the four genes;

5) inserting the insertion vectors of the four genes obtained in the step 4) into a P.putida KT2440 host bacterium, and culturing in a Kana-containing culture medium to obtain a single-exchange strain;

6) culturing the single exchange strain obtained in the step 5) in a culture medium to obtain a double exchange strain, wherein the double exchange strain is an engineering bacterium.

Preferably, the nucleotide sequence of the upstream primer used for the first fusion of the mpd gene in step 1) is shown as SEQ ID No.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 3;

the nucleotide sequence of an upstream primer used for the first fusion of the opd gene is shown as SEQ ID No.4, and the nucleotide sequence of a downstream primer is shown as SEQ ID No. 5;

the nucleotide sequence of an upstream primer used for carrying out first fusion on the vgb gene is shown as SEQ ID No.6, and the nucleotide sequence of a downstream primer is shown as SEQ ID No. 7;

the nucleotide sequence of an upstream primer used for the first fusion of the gfp gene is shown as SEQ ID No.8, and the nucleotide sequence of a downstream primer is shown as SEQ ID No. 9.

Preferably, the nucleotide sequence of the primer used for the second fusion of the mpd gene in the step 2) is shown as SEQ ID No. 10-12;

the nucleotide sequence of a primer used for the second fusion of the opd gene is shown as SEQ ID No. 13-15;

preferably, the nucleotide sequence of the primer used for the third fusion of the mpd gene in the step 3) is shown as SEQ ID No. 16-19;

the nucleotide sequence of a primer used for the third fusion of the opd gene is shown as SEQ ID No. 20-23;

the nucleotide sequence of a primer used for the second fusion of the vgb gene is shown as SEQ ID No. 24-27;

the nucleotide sequence of a primer used for the second fusion of the gfp gene is shown as SEQ ID No. 28-31.

Preferably, the nucleotide sequence of the expression cassette of the mpd gene in step 3) is shown as SEQ ID No. 32.

Preferably, the nucleotide sequence of the expression cassette of the opd gene in step 3) is shown as SEQ ID No. 33.

Preferably, the nucleotide sequence of the expression cassette of the vgb gene in the step 3) is shown as SEQ ID No. 34.

Preferably, the nucleotide sequence of the expression cassette of the gfp gene in step 3) is shown as SEQ ID No. 35.

Preferably, the conditions for the step 3) connection include: the reaction was carried out at 37 ℃ for 30min in a metal bath.

The invention has the beneficial effects that:

1. the invention designs and optimizes the exogenous gene expression cassette by using a synthetic biology method, places 4 exogenous genes mpd, opd, vgb and gfp with different sources under the control of a constitutive strong promoter J23119, and successfully constructs an insertion vector. By a gene traceless editing method, foreign genes are successfully inserted into a genome of P.putida KT2440, and construction of organophosphorus pesticides methyl parathion, chlorpyrifos, parathion and diazinon degrading strains KTU-MOVG is realized. The engineering strain can grow normally under the culture condition and can stably express exogenous genes.

2. The successful transcription of mpd, opd, vgb and gfp in a host strain is proved by RT-PCR.

3. The multiple organophosphorus pesticide degradation engineering strains constructed by the invention can effectively degrade 100mg/L methyl parathion, chlorpyrifos, parathion and diazinon in a shake flask, which indicates the successful expression of mpd and opd in P.putida KT 2440.

4. Western-Blot experiments and thallus color observation prove that the successful expression of vgb in P.putida KT2440 and the effective function of VHb protein in the engineering strain can be realized, and the oxygen uptake capacity of the strain is improved.

5. Confocal microscopy observations demonstrated successful expression of gfp in p.putida KT2440, allowing monitoring of the activity of the engineered strain.

Drawings

FIG. 1 is a schematic diagram of the construction of a targeting vector pKU-X;

FIG. 2 is a schematic diagram showing foreign gene insertion;

FIG. 3 is a PCR verification chart of exogenous gene insertion strain, wherein lane M is Marker III; 1-4 are respectively the full length of the mpd, opd, vgb and gfp insertion reading frames; the primers used for PCR amplification are Y-UF/Y-DR (Y is a target exogenous gene);

FIG. 4 is a graph showing the growth curves of KTU and KTU-MOVG in LB liquid medium;

FIG. 5 is a PCR verification diagram showing the stable existence of foreign genes, wherein lane M is Marker III; lanes 1-4 are full reading frame lengths for mpd, opd, vg b, gfp, respectively;

FIG. 6 shows RT-PCR verification of exogenous genes, where A-D are the transcription of mpd, opd, vgb and gfp, respectively; lane M is marker III; lanes 1-4 show the genomic DNA template, the reverse transcribed cDNA template, the mRNA template, and ddH₂O is a verification result of amplification of the template; the primers used for RT-PCR amplification are Y-F/Y-R (Y is a target exogenous gene);

FIG. 7A is a graph of the GC detection peak time for a methyl parathion standard; B. a standard curve of methyl parathion;

FIG. 8 is the degradation curve of the engineering strain KTU-MOVG to methyl parathion and the growth curve of the strain;

FIG. 9A is a graph of GC detection peak time for chlorpyrifos standard; B. a chlorpyrifos standard curve;

FIG. 10 is a graph showing the degradation curve of the engineered strain KTU-MOVG against chlorpyrifos and the growth curve of the strain;

FIG. 11A is a graph of the GC detection peak time for a parathion standard; B. a parathion standard curve;

FIG. 12 is a graph showing the degradation curve of the engineered strain KTU-MOVG against parathion and the growth curve of the strain;

FIG. 13A is a graph of GC detection peak times for diazinon standards; B. a diazinon standard curve;

FIG. 14 is a graph showing the degradation curve of the engineered strain KTU-MOVG for diazinon and the growth curve of the strain;

fig. 15 is a graph of VHb expression in p.pudida KT2440, results of coomassie brilliant blue staining; detecting VHb by Western-Blot, wherein a lane M is a protein Marker; lane 1 is cell lysate of KTU; lane 2 is cell lysate of KTU-MOVG;

FIG. 16 shows the expression of Vitroscilla hemoglobin in the engineered strain KTU-MOVG;

FIG. 17 is a confocal microscope showing green fluorescence of the engineered strain P.putida KTU-MOVG, A. intracellular green fluorescence; B. cell profile stained with FM 4-64; and C, fusing the A and the B.

FIG. 18 is a schematic diagram of the insertion of four gene expression cassettes of mpd, opd, vgb and gfp into the locus P.putida KT 2440.

Detailed Description

1) carrying out first fusion on constitutive promoters J23119 and RBS and mpd gene (accession number DQ677027), opd gene (accession number AJ421424.1), vgb gene (accession number AF292694) and gfp gene (accession number U57609) respectively to obtain a first fusion product of the four genes;

the nucleotide sequence of the RBS is shown as SEQ ID No. 1;

The constitutive promoter J23119 and RBS are respectively subjected to first fusion with the mpd gene, the opd gene, the vgb gene and the gfp gene to obtain a first fusion product of the four genes; the nucleotide sequence of the RBS is shown as SEQ ID No. 1.

In the present invention, the nucleotide sequence of the RBS suitable for p.putida KT2440 is shown in SEQ ID No.1, specifically as follows: 5'-GTAAGAGAGG-3' are provided.

In the invention, the mpd gene (methyl parathion hydrolase gene) is derived from Stenotrophoromonas sp.YC-1 and can degrade methyl parathion and chlorpyrifos. In the invention, the opd gene (organophosphorus hydrolase gene) is derived from Flavobacterium sp.MTCC 2495 and can degrade parathion. In the invention, the engineering bacteria can simultaneously degrade four organophosphorus pesticides of methyl parathion, chlorpyrifos, parathion and diazinon.

In the invention, the vgb gene (hemoglobin-encoding gene) is derived from Vitroscilla sp, so that the oxygen uptake capacity of the engineering strain is improved. In the invention, the gfp gene (green fluorescent protein coding gene) is inserted into the chromosome of the engineering bacteria, and the activity of the engineering bacteria in the environment is monitored.

In the invention, the nucleotide sequence of the upstream primer used for the first fusion of the mpd gene is shown as SEQ ID No.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 3.

SEQ ID No.2：

5’-CTACGTGTTCGACCTTTGACAGCTAGCTCAGTCCT-3’；

SEQ ID No.3：

5’-CTATCAACAGGAGTCTCACTTGGGGTTGACGACCG-3’。

In the invention, the nucleotide sequence of the upstream primer used for the first fusion of the opd gene is shown as SEQ ID No.4, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 5.

SEQ ID No.4：

5’-CCAGTCCATCCGCACTTGACAGCTAGCTCAGTCCT-3’；

SEQ ID No.5：

5’-CTATCAACAGGAGTCTCATGACGCCCGCAAGGTCG-3’。

In the invention, the nucleotide sequence of the upstream primer used for the first fusion of the vgb gene is shown as SEQ ID No.6, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 7.

SEQ ID No.6：

5’-AGTCCTAGGTATAATGCTAGCCGCAGTAAGAGAGGAATGTACACATGTTAGACCAGCAAACCAT-3’；

SEQ ID No.7：

5’-GCAACACTGTGGCGACTGGTTATTCAACCGCTTGA-3’。

In the invention, the nucleotide sequence of an upstream primer used for the first fusion of the gfp gene is shown as SEQ ID No.8, and the nucleotide sequence of a downstream primer is shown as SEQ ID No. 9.

SEQ ID No.8：

5’-AGTCCTAGGTATAATGCTAGCCGCAGTAAGAGAGGAATGTACACATGGTGAGCAAGGGCGAGGA-3’；

SEQ ID No.9：

5’-TCATCAGCAATGCGCCTGGTTACTTGTACAGCTCG-3’。

According to the invention, the obtained first fusion products of the four genes are respectively subjected to second fusion with the lambda T0terminator to obtain second fusion products of the four genes.

In the present invention, the λ T0terminator is a terminator.

In the invention, the nucleotide sequence of the primer used for the second fusion of the mpd gene is shown as SEQ ID No. 10-12,

SEQ ID No.10：5’-GTCAACCCCAAGTGAGACTCCTGTTGATAGATCCA-3’；

SEQ ID No.11：5’-GATGTAGGTGGACAGCTGGATTCTCACCAATAAAA-3’；

SEQ ID No.12：5’-TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGCCGCAGTAAGAGAGGAATGTACACATGGCCGCACCGCAGGTGCG-3’。

in the invention, the nucleotide sequence of the primer used for the second fusion of the opd gene is shown as SEQ ID No. 13-15,

SEQ ID No.13：5’-TTGCGGGCGTCATGAGACTCCTGTTGATAGATCCA-3’；

SEQ ID No.14：5’-ACGGGTTGCGTGGCGCTGGATTCTCACCAATAAAA-3’；

SEQ ID No.15：5’-TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGCCGCAGTAAGAGAGGAATGTACACATGCAAACGAGAAGGGTTGT-3’。

in the invention, the nucleotide sequence of the primer used for the third fusion of the mpd gene is shown as SEQ ID No. 16-19,

SEQ ID No.16：5’-CCGGGTACCGAGCTCGAATTCTCGGCACGCACCGTGCTGCG-3’；

SEQ ID No.17：5’-TGAGCTAGCTGTCAAAGGTCGAACACGTAGAACTT-3’；

SEQ ID No.18：5’-TTGGTGAGAATCCAGCTGTCCACCTACATCGATGC-3’；

SEQ ID No.19：5’-AAAACGACGGCCAGTGAATTCCGAACAGATGTGCCGAGCGG-3’。

in the invention, the nucleotide sequence of the primer used for the third fusion of the opd gene is shown as SEQ ID No. 20-23,

SEQ ID No.20：5′-CCGGGTACCGAGCTCGAATTCACACCACGCGCCTGCCGGCC-3’；

SEQ ID No.21：5’-TGAGCTAGCTGTCAAGTGCGGATGGACTGGTTGTC-3’；

SEQ ID No.22：5’-TTGGTGAGAATCCAGCGCCACGCAACCCGTACCGC-3’；

SEQ ID No.23：5’-AAAACGACGGCCAGTGAATTCCGTTCTTCCTGCAGGAACTT-3’。

in the invention, the nucleotide sequence of the primer used for the second fusion of the vgb gene is shown as SEQ ID No. 24-27,

SEQ ID No.24：5’-CCGGGTACCGAGCTCGAATTCTGCAGCACGGCGCGCTGATT-3’；

SEQ ID No.25：5’-TGAGCTAGCTGTCAAGCTTCCGTGGCCCGCATATC-3’；

SEQ ID No.26：5’-CGGTTGAATAACCAGTCGCCACAGTGTTGCTCGGC-3′；

SEQ ID No.27：5’-AAAACGACGGCCAGTGAATTCTCGACAGCCTGTTGCAACCG-3′。

in the invention, the nucleotide sequence of the primer used for the second fusion of the gfp gene is shown as SEQ ID No. 28-31,

SEQ ID No.28：5’-CCGGGTACCGAGCTCGAATTCCTGCCGAAGCTGCCATAGCC-3’；

SEQ ID No.29：5’-TGAGCTAGCTGTCAAGGCAGATCTGCATGTCCACC-3’；

SEQ ID No.30：5’-TGTACAAGTAACCAGGCGCATTGCTGATGACATTG-3’；

SEQ ID No.31：5’-AAAACGACGGCCAGTGAATTCACTGGCGAGGTGGTGTCGCA-3’。

in the invention, the nucleotide sequence of the expression cassette of the mpd gene is shown as SEQ ID No.32, specifically as follows, GTAAG AGAGG is an RBS sequence:

tcggcacgcaccgtgctgcgccaggccgtgcgccaaccgctgcacagcgccaagcatgtggctcactttggcctggagctgaagaacgtgttgctgggcaaatccagcctggccccggacagcgacgaccgtcgcttcaatgacccggcctggagcaacaacccgctgtaccgccgctacctgcaaacctacctggcctggcgcaaggagctgcaggactgggtgagcagcagcgacctgtccccccaggacatcagccgcggccagttcgtcatcaacctgatgaccgaggccatggcgccgaccaataccctgtccaacccggctgcggtcaaacgcttcttcgaaaccggcggcaagagcctgctcgatggcctgtccaacctggccaaggacatggtcaacaacggcggcatgcccagccaggtgaacatggatgccttcgaagtgggcaagaacctgggcaccagcgaaggcgcggtggtgtaccgcaacgatgtgctggaactgatccagtacagccccatcaccgagcaggtgcatgcccgtccgctgctggtggtgccaccgcagatcaacaagttctacgtgttcgacctttgacagctagctcagtcctaggtataatgctagccgcagtaagagaggaatgtacacatggccgcaccgcaggtgcgcacctcggcccccggctactaccggatgctgctgggcgacttcgaaatcaccgcgctgtcggacggcacggtggcgctgccggtcgacaagcggctgaaccagccggccccgaagacgcagagcgcgctggccaagtccttccagaaagcgccgctcgaaacctcggtcaccggttacctcgtcaacaccggctccaagctggtgctggtggacaccggcgcggccggcctgttcggccccaccctgggccggctggcggccaacctcaaggccgcaggctatcagcccgagcaggtcgacgagatctacatcacccacatgcaccccgaccacgtgggcggcttgatggtgggtgagcaactggcgttcccgaacgcggtggtgcgtgcggaccagaaagaagccgatttctggctcagccagaccaacctcgacaaggccccggacgacgagagcaaaggcttcttcaaaggcgccatggcctcgctgaacccctatgtgaaggccggcaagttcaagcctttctcggggaacaccgacctggtgcccggcatcaaagcgctggccagccacggccacaccccgggccacaccacctacgtggtcgaaagccaggggcaaaagctcgccctgctcggcgacctgatactcgtcgccgcggtgcagttcgacgaccccagcgtcacgacccagctcgacagcgacagcaagtccgtcgcggtggagcgcaagaaggccttcgcggatgccgccaagggcggctacctgatcgcggcgtcccacctgtcgttccccggcatcggccacatccgcgccgaaggcaagggctaccgtttcgtgccggtgaactactcggtcgtcaaccccaagtgagactcctgttgatagatccagtaatgacctcagaactccatctggatttgttcagaacgctcggttgccgccgggcgttttttattggtgagaatccagctgtccacctacatcgatgcgctgaaagaagccgtcgacgcggtgctgtcgattaccggcagcaaggacctgaacatgctcggcgcctgctccggtggcatcacttgtaccgcactggtgggccactatgccgccattggcgagaacaaggtcaacgccctgaccctgctggtcagcgtgctggacaccaccatggacaaccaggttgctttgtttgtcgacgagcagaccttggaggccgccaagcgccactcctatcaggcgggcgtgctggaaggcagcgaaatggccaaggtgttcgcctggatgcgccccaacgacctgatctggaactactgggtaaacaactacctgctcggcaatgagccccccgtgttcgacatcctgttctggaacaacgacaccacgcgcctgccggccgccttccacggcgacctgatcgaaatgttcaagagcaacccgctgacccgccccgacgccctggaagtgtgcggcaccgcgatcgacctgaaacaggtcaaatgcgacatctacagcctcgccggcaccaacgaccacatcaccccctggccgtcatgctaccgctcggcacatctgttcg。

in the invention, the nucleotide sequence of the expression cassette of the opd gene is shown as SEQ ID No.33, specifically as follows, GTAAG AGAGG is an RBS sequence:

acaccacgcgcctgccggccgccttccacggcgacctgatcgaaatgttcaagagcaacccgctgacccgccccgacgccctggaagtgtgcggcaccgcgatcgacctgaaacaggtcaaatgcgacatctacagcctcgccggcaccaacgaccacatcaccccctggccgtcatgctaccgctcggcacatctgttcggcggcaagatcgaattcgtactgtccaacagcgggcatatccagagcatcctcaacccgccgggcaacccgaaggcacgtttcatgaccggtgccgatcgcccgggtgacccggtggcctggcaggaaaatgccatcaagcatgcagactcctggtggttgcactggcagagttggctgggcgagcgtgccggcgcgctgaaaaaggcaccgacccgcctgggcaaccgtacctatgccgccggcgaagcctccccaggcacctacgttcacgagcgttgagttacagcgccgtggcggcctgcacggcgccacggtgtttacttcacccaagagtcacgtgcatgccgcaaccctatattttcaggaccgtcgagctggacaaccagtccatccgcacttgacagctagctcagtcctaggtataatgctagccgcagtaagagaggaatgtacacatgcaaacgagaagggttgtgctcaagtctgcggccgccgcaggaactctgctcggcggcctggctgggtgcgcgagcgtggctggatcgatcggcacaggcgatcggatcaataccgtgcgcggtcctatcacaatctctgaagcgggtttcacactgactcacgagcacatctgcggcagctcggcaggattcttgcgtgcttggccagagttcttcggtagccgcaaagctctagcggaaaaggctgtgagaggattgcgccgcgccagagcggctggcgtgcgaacgattgtcgatgtgtcgactttcgatatcggtcgcgacgtcagtttattggccgaggtttcgcgggctgccgacgttcatatcgtggcggcgaccggcttgtggttcgacccgccactttcgatgcgattgaggagtgtagaggaactcacacagttcttcctgcgtgagattcaatatggcatcgaagacaccggaattagggcgggcattatcaaggtcgcgaccacaggcaaggcgaccccctttcaggagttagtgttaaaggcggccgcccgggccagcttggccaccggtgttccggtaaccactcacacggcagcaagtcagcgcgatggtgagcagcaggccgccatttttgagtccgaaggcttgagcccctcacgggtttgtattggtcacagcgatgatactgacgatttgagctatctcaccgccctcgctgcgcgcggatacctcatcggtctagaccacatcccgcacagtgcgattggtctagaagataatgcgagtgcatcagccctcctgggcatccgttcgtggcaaacacgggctctcttgatcaaggcgctcatcgaccaaggctacatgaaacaaatcctcgtttcgaatgactggctgttcgggttttcgagctatgtcaccaacatcatggacgtgatggatcgcgtgaaccccgacgggatggccttcattccactgagagtgatcccattcctacgagagaagggcgtcccacaggaaacgctggcaggcatcactgtgactaacccggcgcggttcttgtcaccgaccttgcgggcgtcatgagactcctgttgatagatccagtaatgacctcagaactccatctggatttgttcagaacgctcggttgccgccgggcgttttttattggtgagaatccagcgccacgcaacccgtaccgcttccctgggctggccaagctgaccgcgcggatgctcgactacctcgactacggccaggtcaacgtcatcggcgtgtcctggggcggcgccctggcccagcagtttgctcacgattaccccgagcgctgcaagaagctggtgctggccgccaccgctgccggtgcggtaatggtgccaggcaagcccaaggtgctgtggatgatggccagcccccggcgttacgtgcagccatcgcatgtcatccgcattgcgccgatgatctatggcggcggcttccgacgtgaccccgacctggccatgcaccatgccgccaaggtgcgctccggcggcaagctgggctactactggcagctgttcgcagggctcggctggaccagcatccactggctgcacaagatccggcagcccaccctggtactggctggcgacgacgacccgttgatcccgctgatcaacatgcgcctgctggcctggcggattcccaatgcccagctacacattatcgacgacggccatctgttcctgatcacccgtgccgaagccgtcgccccgatcatcatgaagttcctgcaggaagaacg。

in the invention, the nucleotide sequence of the expression cassette of the vgb gene is shown as SEQ ID No.34, specifically as follows, GTAAGAGAGG is an RBS sequence:

tgcagcacggcgcgctgattgatcgagcccttgtcggtgatttcaccggcgtcgatcgacggcggctcggccagcagcgacagccattcgatacggctggcgttgccttgggcatcgcggttcaagcgctccagccagtcagcgaaccaactgcgcacggtgtcgttggccagcacccgcgcatcgctggcatcctctgccagcccggccaggcgccgacactcgggcagacgcgggaacaccagcaggcccaggcattcacggtccggcgcggtgaccacgatgtcctgtacgtaaggcgagccctccagcactgcgcggttgcgcagcggcccgacactgacgaataccccggacgaaagtttgaagtcctcagcgatacggccatcgaacatcaggccaagctcgggctgcctggcatcggccagcttcaacgcgtcgcccgaacagtagaagccctcctcgtcgaacgcctcggcggtctgctgcggcgagcgccagtagcccggcatgatatgcgggccacggaagcttgacagctagctcagtcctaggtataatgctagccgcagtaagagaggaatgtacacatgttagaccagcaaaccattaacatcatcaaagccactgttcctgtattgaaggagcatggcgttaccattaccacgactttttataaaaacttgtttgccaaacaccctgaagtacgtcctttgtttgatatgggtcgccaagaatctttggagcagcctaaggctttggcgatgacggtattggcggcagcgcaaaacattgaaaatttgccagctattttgcctgcggtcaaaaaaattgcagtcaaacattgtcaagcaggcgtggcagcagcgcattatccgattgtcggtcaagaattgttgggtgcgattaaagaagtattgggcgatgccgcaaccgatgacattttggacgcgtggggcaaggcttatggcgtgattgcagatgtgtttattcaagtggaagcagatttgtacgctcaagcggttgaataaccagtcgccacagtgttgctcggcaatgcggtccagccggtcccagacgctttgcgacaggcctgcggcggcaaagaagaacagcttgatgcgggcaaagaacacctcgcgtagcgcggggtcctgctccagtgccttgaccagttcctcccagcccttgggtacggtgaggtaggccgtgggggaaatctcgcgcagattgcgcaaggtctcggcgaagccttgcggggtcggcttgccggcgtccaggtagaaactgcccccgttgtaaagcacgatgccgaggttgtggctaccgccgaacgtgtggttccacggcagccagtccaccagcaccggcggctcctcggcgaacgtcggaaaagtctgcagaagcatctgctgattggcgcacagcatgcgctgggtggtgatcaccgccttgggcagcttggtcgagcccgaggtgaagaggaatttggcgatggtgtccggcccggtggcggcgaaagccgcatcggccgccgccaggtcacccggttgcaacaggctgtcga。

in the invention, the nucleotide sequence of the expression cassette of the gfp gene is shown as SEQ ID No.35, specifically as follows, GTAAGAGAGG is RBS sequence:

ctgccgaagctgccatagccgctggacttgaccccgccaaacggcatctgcgcttcatcgtgaacggtcgggccgttgatatggcagatacccgactccacccgttgggccaaggccagggcgcggctggtgtcgcggctgaaaatggccgatgacagaccgaactccgagtcgttggccagctgcagcaaggcttcgtcgccttcggcgcgcagtaccaccgccaccgggccgaaggactcctcgcggtacaggcgcatgctggcatcgacgttgtcgagcaaggtcggttgcaggatgctgccttccagctggccgccgctgaccaggcgcgcgcccttggccacggcatcgtcgatcagtgccttgatgcgctcgccggccgctgcgctgaccagcgagccgagcaccgaggtgctggcttgcggatcacctgcacgcagcccggcgatcttcaccgccagcttgtcgacgaaagcgtcggcaatacagctgtccaccacaaggcgctcggtggacatgcagatctgccttgacagctagctcagtcctaggtataatgctagccgcagtaagagaggaatgtacacatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaaccaggcgcattgctgatgacattgaccacgccgtcgccgatgcctgcatcgtgcagcacctggccgatcagccgatggaccgccgggctcagctccgaggccttgagcaccacggtgttgccgcaggccagcggcatggcaatggcacgcgtggccagtatcaccggggcgttccacggtgcgatgcccaacaccacgccgcagggcgcgcgcagggccattgcgaagctgccgggaacgtccgaggggatcacttcaccggtgatctgcgtggtcatggctgcagcctcgcgcagcatgttggcggccaacttcacgttgaagccataccagttggccatggccccggtttcaccggcggcggcgatgaactcggcggccctcgcctgcaacagatcagcgcctgccagcaagcggctgcgccgctcgcccggtgccagggcggcccaggccggaaacgccgcgctggcagcagccaccgcggcatcggcatcggccagtgtggcggcggcagcctgcgacaccacctcgccagt。

the technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

Example 1

2.1.1 strains, plasmids and primers

The strains, plasmids and primers used are shown in tables 1-4.

Strains, plasmids and primers used in Table 1

Strains, plasmids and primers used in Table 2

Strains, plasmids and primers used in Table 3

Strains, plasmids and primers used in Table 4

2.1.2 drugs and reagents drugs, reagents and kits used are shown in Table 5.

Drugs, reagents and kits for use in Table 5

2.1.3 instrumentation

The main instrumentation used: high-pressure steam sterilization pot, double vertical super clean bench, ultraviolet visible spectrophotometer, electric heating constant temperature incubator, etc.

2.1.4 culture media and solutions

2.1.4.1 culture medium

And (3) preparing the M9 inorganic salt culture medium, the LB liquid culture medium and the LB solid culture medium conventionally.

2.1.4.2 solution

Kanamycin sulfate (Kana) mother liquor (10 g/L): 0.1g kanamycin sulfate powder was weighed out and dissolved in 10mL distilled water sufficiently, filtered through a 0.22 μm filter for sterilization, and stored at-20 ℃ in the dark. The working concentration was 50. mu.g/mL.

5-fluorouracil (5-FU) mother liquor: 0.4g of 5-FU powder was weighed out and dissolved sufficiently in 20mL of DMSO to give a concentration of 20mg/L, and stored in a freezer at-20 ℃. The working concentration was 20. mu.g/mL.

1.0M Tris-HCl (pH 6.8): 121.1g Tris was weighed, dissolved well in deionized water and made to volume of 1L. The pH was adjusted to 6.8 using concentrated HCl. Sterilizing at 121 deg.C for 20min with high pressure steam, and storing at room temperature.

50 × TAE electrophoresis buffer: weighing Tris 242.0g and Na₂EDTA·2H₂Dissolving 37.2g of O in a beaker by using a proper amount of deionized water, adding 57.1mL of glacial acetic acid, fully stirring for dissolving, fixing the volume to 1.0L by using the deionized water, and storing at room temperature. When in use, the buffer solution is diluted to 1 XTAE buffer solution.

5 × Tris-Gly running buffer: weighing 15.1g of Tris, 94g of glycine and 5g of SDS, dissolving, and fixing the volume to 1L by using distilled water.

PB phosphate buffer (100 mL): na (Na)₂HPO₄·12H₂O 7.819g，NaH₂PO₄·2H₂O2.808 g, namely 0.1M, and the pH is adjusted to 7.0.

10% SDS: 5g SDS was weighed and made up to 50mL with deionized water. Storing at room temperature.

1.5M Tris-HCl (pH 8.8): 181.7g Tris was weighed and made up to 1L with deionized water. The pH was adjusted to 8.8 using concentrated HCl. Sterilizing with high pressure steam at 121 deg.C for 20 min. Storing at room temperature.

30% acrylamide (Acr/Bis): 10g of methylene bisacrylamide and 290g of acrylamide are weighed and the volume is made to 1L by using distilled water. Filtering with 0.45 μm filter membrane for sterilization, and storing at 4 deg.C in dark.

Coomassie brilliant blue solution: coomassie brilliant blue G250100 mg was weighed and dissolved in a suitable amount of distilled water. 50mL of 95% ethanol and 100mL of 85% phosphoric acid were added, and finally the volume was made to 1L using distilled water.

10% Ammonium Persulfate (APS): 0.1g of APS was weighed out and dissolved in 1mL of deionized water (note now ready for use).

Decolorizing buffer solution: 50mL of methanol and 7mL of glacial acetic acid were weighed and made up to 100mL with distilled water.

5 XSDS-PAGE Loading buffer: SDS 0.5g, bromophenol blue (BPB)25mg, 1.25mL of 1.0M Tris-HCl (pH 6.8), 2.5mL of glycerol, deionized water to 5mL, mixing, subpackaging to 500. mu.L/portion, and storing at room temperature.

And (3) membrane transfer buffer solution: 3.0g Tris and 14.4g glycine are weighed and dissolved by adding a proper amount of distilled water. 200mL of methanol was added and the volume was finally adjusted to 1L using distilled water.

PBS phosphate buffer: KCl 0.2g/L, NaCl 8.0g/L, KH₂PO₄ 0.272g/L，Na₂HPO₄·12H₂O3.58 g/L, and the pH is adjusted to 7.4.

PBST buffer: 1mL of Tween 20 was added to 1L of PBS buffer.

4-hydroxyethyl piperazine ethanesulfonic acid (HEPES): 0.7149g HEPES was weighed and dissolved in 1L distilled water to prepare a 3mmol/L solution, the pH was adjusted to 7.0, sterilized by autoclaving at 121 ℃ for 20min, and cooled to 4 ℃ for further use.

5% of skimmed milk powder: 5g of skim milk powder was weighed into 100mL of PBST buffer and dissolved well.

Methyl parathion mother liquor: weighing 10mg of methyl parathion standard substance, fully dissolving the methyl parathion standard substance in 1mL of chromatographic grade methanol, preparing mother liquor with the concentration of 10g/L, sealing and keeping at 4 ℃ for later use.

Chlorpyrifos mother liquor: weighing 10mg of chlorpyrifos standard substance, fully dissolving in 1mL of chromatographic grade methanol, preparing a mother solution with the concentration of 10g/L, sealing and keeping at 4 ℃ for later use.

Parathion mother liquor: weighing 10mg of parathion standard substance, fully dissolving the parathion standard substance in 1mL of chromatographic grade methanol, preparing mother liquor with the concentration of 10g/L, sealing and keeping at 4 ℃ for later use.

The method comprises the following specific steps:

2.2.1 bacterial genome extraction

1. Single colonies were picked from the streaked plates, inoculated in 5mL of LB liquid medium containing the corresponding antibiotic, and cultured overnight at 30 ℃.

2. The bacteria were taken overnight at approximately 4mL (106 and 108 cells), centrifuged at 7500rm for 10min, and the supernatant discarded.

3. Add 180. mu.L Buffer GTL to the pellet and vortex to resuspend the cells thoroughly.

4. Adding 20 mu L of protease K, mixing evenly by vortex, incubating for about 30min at 56 ℃ until the thalli are completely cracked, and inverting the centrifugal tube or shaking at intervals to disperse the thalli.

5. Vortex for 15s, adding 200 mu L Buffer GL, and fully and uniformly mixing by vortex; add 200. mu.L of absolute ethanol, vortex, shake and mix well.

6. Adding all the solution including the precipitate obtained in the step 5 into Spin Column DM, centrifuging at 4 ℃ and 8000r/m for 1min, removing waste liquid, and placing the Spin Column DM back into the Collection Tube.

7. Adding 500 μ L Buffer GW1 into Spin Column DM, centrifuging at 4 deg.C and 8000r/m for 1min, discarding waste liquid, and placing Spin Column DM back into Collection Tube.

8. Adding 500 μ L buffer GW2 into Spin Column DM, centrifuging at 4 deg.C and 14000r/m for 1min, discarding the waste liquid, and placing the Spin Column DM back into the Collection Tube.

And (3) carrying out air separation at 14000r/m for 2min at 9.4 ℃, transferring the Spin Column DM into a new centrifuge tube, and standing at room temperature for 8-10min to completely dry the residual Buffer GW2 in the adsorbing material.

10. Dripping 200 μ L buffer GE into the middle part of Spin Column DM membrane, standing at room temperature for 1-5min, centrifuging at 4 deg.C and 8000r/m for 1min, collecting the solution in centrifuge tube, and storing at-20 deg.C.

2.2.2 E.coli plasmid DNA extraction

The P.putida KT2440 genome is extracted by using a bacterial genome DNA extraction kit produced by Kangji biological Limited, and the specific operation steps are as follows:

coli plasmid DNA was extracted using a plasmid extraction kit. The Axygen mini-prepare plasmid extraction kit comprises the following specific operation steps:

before use, RNase A was added to Buffer S1, mixed well and stored at 4 ℃. The Buffer W2 concentrate was added with the specified volume of absolute ethanol.

1. About 4mL of a culture solution cultured overnight in LB medium was centrifuged at 12000r/m at 4 ℃ for 1min, and the supernatant was discarded.

2. 250 μ L of Buffer S1 was added to suspend the bacterial pellet evenly.

3. 250 mu L of Buffer S2 is added, and the mixture is gently and fully turned up and down for 4 to 6 times, so that the thalli are fully and uniformly mixed to form a transparent solution.

4. Add 350. mu.L Buffer S3, mix gently and thoroughly by tumbling up and down 6-8 times, centrifuge at 12000r/m for 10min at 4 ℃.

5. The supernatant was carefully aspirated and transferred in its entirety to a preparation tube, centrifuged at 12000r/m for 1min at 4 ℃ and the filtrate discarded.

6. The preparation tube was put back into the centrifuge tube, 500. mu.L of Buffer W1 was added, centrifugation was carried out at 12000r/m at 4 ℃ for 1min, and the filtrate was discarded.

7. The preparation tube was put back into the centrifuge tube, 700. mu.L of Buffer W2 was added, centrifugation was carried out at 12000r/m at 4 ℃ for 1min, and the filtrate was discarded.

8. And 7, repeating the step 7 and discarding the filtrate.

9. The empty tube of the preparation tube is put back into a 2mL centrifuge tube and centrifuged at 12000r/m for 2min at 4 ℃.

10. Transferring the preparation tube to a new EP tube, standing at room temperature for 8-10min, suspending and dripping 60-80 μ L Eluent in the center of the preparation tube film, and standing at room temperature for 2 min. Centrifuging at 12000r/m for 1min at 4 ℃.

2.2.3 DNA fragment recovery

The DNA fragment is recovered by using an Edela (Aidlab) agarose gel purification recovery kit, and the specific operation steps are as follows:

1. placing the adsorption column EC in a collection tube in advance, adding 100 μ L of equilibrium solution, standing for a period of time, centrifuging at 4 deg.C and 12000r/m for 1min, and discarding the filtrate.

2. The agarose gel containing the target band DNA fragment was cut under a long-wave ultraviolet lamp to obtain a gel having a smaller volume as better.

3. The excised gel containing the DNA band was placed in a clean 1.5mL centrifuge tube and weighed.

4. 3 times volume of sol solution DD was added.

5. Placing the centrifuge tube with the sol solution in a 56 deg.C water bath for about 10min (or until the sol is completely dissolved), and shaking or shaking with vortex every 2-3min to help accelerate dissolution.

6. Adding all the solution obtained in step 5 into an adsorption column EC, standing at room temperature for about 2min, centrifuging at 4 deg.C and 12000r/m for 30s^-1And min, pouring the waste liquid in the collecting pipe.

7. Adding a rinsing solution WB 600 microliter added with absolute ethyl alcohol, centrifuging at 4 ℃ and 12000r/m for 30s^-1min, discarding the filtrate.

8. Repeat step 7 once.

9. And (4) putting the adsorption column EC back into the collection tube again, centrifuging at 4 ℃ and 12000r/m for 2min, putting the adsorption column EC into a new EP tube, and standing at room temperature for 8-10min to dry the residual anhydrous ethanol.

10. 50 mu L of EB elution buffer solution preheated in advance is suspended and dripped in the middle of the membrane of the adsorption column EC, and the mixture is placed for about 2min at room temperature and centrifuged for 1min at 12000r/m at 4 ℃. The resulting DNA fragment was stored at-20 ℃.

2.2.4 DNA fragment amplification

The amplification of the DNA fragment was carried out using the high fidelity polymerase Phanta series. The usual PCR reaction system is as follows:

TABLE 6 conventional PCR reaction System

2X Phanta DNA polymerase	25.0μL
		Template	5.0μL
XPrimer-F	2.0μL
		XPrimer-R	2.0μL
ddH₂O	Up to 50.0μL

The PCR program was set up as follows:

TABLE 7 common PCR program settings

Detection of DNA fragments was performed using a conventional Taq DNA polymerase series. The usual PCR reaction system is as follows:

TABLE 8 common PCR reaction System

The PCR program was set up as follows:

TABLE 9 PCR program settings

2.2.5 construction of Gene insertion vector pKU-X

The construction process of the foreign gene insertion vector is shown in FIG. 1.

The exogenous genes are mpd, opd, vgb and gfp. The foreign gene X expression cassette with upstream and downstream homology arms of the insertion site, promoter, RBS and terminator was obtained by fusion PCR.

Using KTU genome DNA as a template, using high-fidelity Phanta enzyme to perform PCR amplification on upstream and downstream homologous arms of an insertion site, wherein the primers are respectively X-UF, X-UR, X-DF and X-DR, and constructing a gene insertion vector by using a homologous recombination method in a later period, so that when designing the primers, 15bp sequences homologous with the to-be-connected site of the vector are respectively floated at the 5' ends of an upstream primer (X-UF) of the upstream homologous arm and a downstream primer (X-DR) of the downstream homologous arm. In this chapter, the constitutive promoter J23119 and a ribosome binding site (5'-GTAAGAGAGG-3') for P.putida KT2440 were used, and the promoter and RBS fragments were designed into primers for fusion PCR, P + X-F, due to the short length of the fragment. Similarly, the high fidelity Phanta series enzyme is used for amplifying the exogenous gene and the terminator, and the primers of the exogenous gene are X-F and X-R respectively. A terminator is inserted at the end of the exogenous gene to terminate transcription, and the test selects a lambda T0terminator which is adapted to P.putida KT2440, and the primers are X-T0-F and X-T0-R respectively.

And (3) recovering the PCR amplification product by using an Aidlab agarose gel purification recovery kit, wherein the specific operation steps are shown in 2.2.3. And (4) detecting the concentration of the recovered samples, and performing fusion PCR on the fragments by using the samples as templates.

Firstly, fusing the promoter, RBS and exogenous gene to obtain X-1, wherein the fusion system is as follows:

TABLE 10 fusion system

2X Phanta DNA polymerase	25.0μL
		Exogenous gene	2.0μL
P+X-F	2.0μL
		X-R	2.0μL
ddH₂O	Up to 50.0μL

Recovering and quantifying the fusion product, and fusing the fusion product with a purified lambda T0terminator to obtain X-2, wherein the fusion system is as follows:

TABLE 11 fusion system

Recovering and quantifying the fusion product, and fusing the fusion product with the purified upstream and downstream homology arms to obtain an X expression cassette, wherein the fusion system is as follows:

TABLE 12 fusion system

2X Phanta DNA polymerase	25.0μL
		Upstream homology arm segment	2.0μL
X-2	2.0μL
		Downstream homology arm segment	2.0μL
X-UF	2.0μL
		X-DR	2.0μL
ddH₂O	Up to 50.0μL

And connecting the X expression cassette with correct sequencing verification to the suicide plasmid pKU with the reverse screening marker upp by a homologous recombination method (the suicide plasmid pKU is subjected to enzyme digestion in advance), and constructing a targeting vector pKU-X capable of inserting the foreign gene.

The enzyme digestion system is as follows:

TABLE 13 enzyme digestion System

And (3) placing the enzyme digestion system in a metal bath at 37 ℃ for incubation for 45min, detecting the enzyme digestion fragments by using 0.8% agarose gel electrophoresis, and performing gel cutting recovery on the target fragments after detection is error-free. The recovered fusion DNA fragment and the linearized pKU vector were quantified using a microanalyzer for nucleic acid protein, followed by recombinant ligation reaction. And (3) placing the recombinant system in a metal bath at 37 ℃ for reaction for 30min, then placing the recombinant system on ice for 5min to finish the reaction, and immediately carrying out next-step conversion and subsequent detection on the obtained connection reaction system.

The connection system is transformed into E.coli Mach1-T1 competent cells by a chemical transformation method to construct an insertion vector, and the specific operation steps are as follows:

1. e.coli Mach1-T1 competent cells, stored at-80 ℃, were thawed on ice.

2. The ligation product was added to 50. mu.L of competent cells under sterile conditions, gently whipped and mixed, and allowed to stand on ice for 30 min.

3. Quickly transferring to 42 deg.C, heat-shocking for 45-90s, and standing on ice for 2 min.

4. Adding 1mL LB liquid medium into EP tube under aseptic condition, mixing, placing in 37 deg.C shaking table, and recovering and culturing at 180r/min for 1.5 h.

5. Taking out the EP tube, centrifuging at 4 deg.C and 6000r/m for 5min, and aseptically discarding the supernatant.

6. The bottom cells were suspended in 100. mu.L of LB liquid medium and plated on LB plates containing 50. mu.g/mL Kana, followed by overnight culture at 37 ℃.

7. Transformants were picked and verified by PCR and restriction. And (4) selecting positive transformants, extracting plasmids by using a plasmid extraction kit (the specific operation method is shown in 2.2.2), and sending the plasmids to a company for sequencing verification. The plasmid was stored at-20 ℃ and the subsequent insertion experiments were performed after correct sequencing.

2.2.6 P.putida KT2440 Strain competent preparation and transformation

1. P.putida KT2440, preserved with glycerol at-80 ℃ was streaked on LB plates supplemented with 5-FU and cultured overnight at 30 ℃.

2. Selecting single colony, inoculating in 5mL LB liquid culture medium, culturing at 30 deg.C for 12h at 180r/min, and adding 5-FU antibiotic in test tube to avoid contamination of bacteria.

3. The cultured liquid was transferred to a 500mL Erlenmeyer flask containing 100mL of LB liquid medium at an inoculum size of 1%, cultured at 30 ℃ for 2-4 hours until OD600 became 0.6 at 180r/min, transferred to ice, stopped growing by ice-cooling for 20min, and pre-chilled in ice using a sterilized 50mL centrifuge tube and 3mM/L HEPES.

4. The culture medium was aseptically transferred to a pre-cooled 50mL centrifuge tube, centrifuged at 5000r/m for 10min at 4 ℃ and the supernatant discarded.

5. The cells were resuspended and washed with an appropriate amount of precooled HEPES, centrifuged at 5000r/m for 10min at 4 ℃ and the supernatant discarded.

6. And (5) repeating the step.

7. The centrifuged cells were resuspended in 1mL of precooled HEPES and 50. mu.L of the suspension was dispensed per tube and immediately used for the electroporation experiments.

8. Taking out the 1mm electric rotary cup soaked in 75% alcohol, cleaning with distilled water, reversing to an ultra-clean bench ultraviolet lamp, air-drying, sterilizing, and pre-cooling on ice.

9. After 5. mu.L of the insertion vector was mixed with 50. mu.L of the prepared competent cells thoroughly and gently, the mixture was added to the above electric cuvette and subjected to 1200V for 5ms electric shock.

10. Immediately after electric shock, 1mL of normal temperature LB liquid medium was added and resuscitated in a shaker at 30 ℃ at 180r/min for 2 h.

11. The EP tube was removed, centrifuged at 6000 rpm for 5min, the supernatant was discarded aseptically, and about 100. mu.L of the supernatant was retained in the EP tube for resuspension of the cells, which were plated on an LB screen plate containing Kana.

2.2.7 construction of P.putida KT2440 engineering Strain

pK18mobsacB as a suicide plasmid cannot replicate autonomously after entering the host cell P.putida KT 2440. In strains containing upp, uracil phosphotransferase encoded by upp utilizes 5-FU to produce 5-fluorouracil monophosphate, which is metabolized to 5-fluorodeoxyuracil monophosphate, which strongly inhibits thymidylate synthase activity, thereby inhibiting cell growth; in the strain without upp gene, 5-FU has no inhibiting effect on it, and the strain can survive. By combining the two characteristics, the traceless insertion operation can be carried out in the upp-deleted P.putida KT2440 strain, and the principle of the exogenous gene insertion is shown in figure 2. The specific steps of the strain construction are as follows:

1. the constructed insert vector was electroporated into P.putida KT2440, and the recombinants were spread on LB plates containing 50 ng/. mu.L Kana and cultured overnight at 30 ℃ in an inverted state.

2. Picking single bacteria on the plate, dropping the single bacteria into LB liquid culture medium containing Kana, culturing for 12h at 180r/min and 30 ℃ in a shaking table, and detecting single exchange strains through PCR.

3. The strain which has undergone single exchange is transferred into a fresh LB test tube without antibiotic with the inoculation amount of 1 percent, and is cultured for 24 hours in a shaking table at 30 ℃ at 180r/min, so that double exchange occurs.

4. The culture is appropriately culturedMultiple (typically 10)³) Diluted, then spread on LB plates containing 5-FU, and cultured in an inverted state in an incubator at 30 ℃.

5. The single colony growing out is picked into an LB test tube containing 20 ng/mu L of 5-FU, cultured in a shaker at 30 ℃ for one night at 180r/min, and whether the strain is a double-exchange strain is detected by PCR.

6. The PCR products of the positive strains with double crossover were sent to the company for further validation by sequencing.

Chromosomal gene sequence after insertion of foreign gene: wherein PP _3356, PP _3357, PP _5003 and PP _5004 are insertion sites of genes.

Homology arm、Promoter、RBS、Terminator、CDS(vgb)、CDS(gfp)、CDS(mpd)、CDS(opd)

PP_3356(SEQ ID No.36)：

tcaaggccgcaccttggcgtgcaatgcgtcggggtcttcgccacggtacagcgcctcgacctgagcggcgcgccgctgcagcacggcgcgctgattgatcgagcccttgtcggtgatttcaccggcgtcgatcgacggcggctc ggccagcagcgacagccattcgatacggctggcgttgccttgggcatcgcggttcaagcgctccagccagtcagcg aaccaactgcgcacggtgtcgttggccagcacccgcgcatcgctggcatcctctgccagcccggccaggcgccgac actcgggcagacgcgggaacaccagcaggcccaggcattcacggtccggcgcggtgaccacgatgtcctgtacgta aggcgagccctccagcactgcgcggttgcgcagcggcccgacactgacgaataccccggacgaaagtttgaagtcc tcagcgatacggccatcgaacatcaggccaagctcgggctgcctggcatcggccagcttcaacgcgtcgcccgaac agtagaagccctcctcgtcgaacgcctcggcggtctgctgcggcgagcgccagtagcccggcatgatatgcgggcc acggaagcttgacagctagctcagtcctaggtataatgctagccgcagtaagagaggaatgtacacatgttagaccagcaaaccattaacatcatcaaagccactgttcctgtattgaaggagcatggcgttaccattaccacgactttttataaaaacttgtttgccaaacaccctgaagtacgtcctttgtttgatatgggtcgccaagaatctttggagcagcctaaggctttggcgatgacggtattggcggcagcgcaaaacattgaaaatttgccagctattttgcctgcggtcaaaaaaattgcagtcaaacattgtcaagcaggcgtggcagcagcgcattatccgattgtcggtcaagaattgttgggtgcgattaaagaagtattgggcgatgccgcaaccgatgacattttggacgcgtggggcaaggcttatggcgtgattgcagatgtgtttattcaagtggaagcagatttgtacgctcaagcggttgaataaccagtcgccacagtgttgctcggca atgcggtccagccggtcccagacgctttgcgacaggcctgcggcggcaaagaagaacagcttgatgcgggcaaaga acacctcgcgtagcgcggggtcctgctccagtgccttgaccagttcctcccagcccttgggtacggtgaggtaggc cgtgggggaaatctcgcgcagattgcgcaaggtctcggcgaagccttgcggggtcggcttgccggcgtccaggtag aaactgcccccgttgtaaagcacgatgccgaggttgtggctaccgccgaacgtgtggttccacggcagccagtcca ccagcaccggcggctcctcggcgaacgtcggaaaagtctgcagaagcatctgctgattggcgcacagcatgcgctg ggtggtgatcaccgccttgggcagcttggtcgagcccgaggtgaagaggaatttggcgatggtgtccggcccggtg gcggcgaaagccgcatcggccgccgccaggtcacccggttgcaacaggctgtcgaagcttatatgggggcgacctgcgacctggccacgcacgctgatcacgccgaccgaatcgtccagcaccgcctcgaaggcgcgctggaacggctggctgtcgctgacgaagaccactccgggggtgagcacctcgcagacatggcgcaacttggcgaagtcttgcgacaacagcgcgtaggccggcgacaccgggcaataggcaataccggcatacatggcgccgagggcgatttgcaggtgttcgatgtcgttgccggaaagcagcgccagcgggcgctcggcactgaggcccagtcctagcaagttggcggcgatggtgcgcacatcggcgagcatctgcacgtagctgatcgaacgccaggcaccgtctgcctggcgtgccgcgatgaaagtggtgtccgggcgcacctgggcccaatgcaccaggcgctcgagcaggcgcgccggcagcggcgccagtggctcgacaggttgcatgcgcagcacgtcgtcgacgtgactgacctgcacctggggatgcccgatggccacctggcggtagcgcggacgttggccagggtcggtcgaccctgagcgggcttcgttattcacgcaggttgctccttgttcttgttgtacatcctgccgccgcccgatatgacggggcggcggtcatcttgccggaggtctgggcctgccgcggctagatgggatagtgacgcgggccgtgctggagggtgacccagcgcaactgggtgaactgatcgatggccgtgcggctgccgaagctgccatagccgc tggacttgaccccgccaaacggcatctgcgcttcatcgtgaacggtcgggccgttgatatggcagatacccgactc cacccgttgggccaaggccagggcgcggctggtgtcgcggctgaaaatggccgatgacagaccgaactccgagtcg ttggccagctgcagcaaggcttcgtcgccttcggcgcgcagtaccaccgccaccgggccgaaggactcctcgcggt acaggcgcatgctggcatcgacgttgtcgagcaaggtcggttgcaggatgctgccttccagctggccgccgctgac caggcgcgcgcccttggccacggcatcgtcgatcagtgccttgatgcgctcgccggccgctgcgctgaccagcgag ccgagcaccgaggtgctggcttgcggatcacctgcacgcagcccggcgatcttcaccgccagcttgtcgacgaaag cgtcggcaatacagctgtccaccacaaggcgctcggtggacatgcagatctgccttgacagctagctcagtcctaggtataatgctagccgcagtaagagaggaatgtacacatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaaccaggcgcattgctgatgacattgaccacgccgtcgccgatgcctgcatcgtgcagcacctggccgatcagccgatggac cgccgggctcagctccgaggccttgagcaccacggtgttgccgcaggccagcggcatggcaatggcacgcgtggcc agtatcaccggggcgttccacggtgcgatgcccaacaccacgccgcagggcgcgcgcagggccattgcgaagctgc cgggaacgtccgaggggatcacttcaccggtgatctgcgtggtcatggctgcagcctcgcgcagcatgttggcggccaacttcacgttgaagccataccagttggccatggccccggtttcaccggcggcggcgatgaactcggcggccctc gcctgcaacagatcagcgcctgccagcaagcggctgcgccgctcgcccggtgccagggcggcccaggccggaaacg ccgcgctggcagcagccaccgcggcatcggcatcggccagtgtggcggcggcagcctgcgacaccacctcgccagtcaccgggttacagcgctcgaaggttcgtccatcgctggcggggcgcgactgcccgccaatcagcaaaggcacctgcaacat

PP_5003(SEQ ID No.37):

atgagtaacaagaacaacgatgagctacagcggcaggcctcggaaaacaccctggggctgaacccggtcatcggcatccgccgcaaggacctgttgagctcggcacgcaccgtgctgcgccaggccgtgcgccaaccgctgcac agcgccaagcatgtggctcactttggcctggagctgaagaacgtgttgctgggcaaatccagcctggccccggaca gcgacgaccgtcgcttcaatgacccggcctggagcaacaacccgctgtaccgccgctacctgcaaacctacctggc ctggcgcaaggagctgcaggactgggtgagcagcagcgacctgtccccccaggacatcagccgcggccagttcgtc atcaacctgatgaccgaggccatggcgccgaccaataccctgtccaacccggctgcggtcaaacgcttcttcgaaa ccggcggcaagagcctgctcgatggcctgtccaacctggccaaggacatggtcaacaacggcggcatgcccagcca ggtgaacatggatgccttcgaagtgggcaagaacctgggcaccagcgaaggcgcggtggtgtaccgcaacgatgtg ctggaactgatccagtacagccccatcaccgagcaggtgcatgcccgtccgctgctggtggtgccaccgcagatca acaagttctacgtgttcgacctttgacagctagctcagtcctaggtataatgctagccgcagtaagagaggaatgtacacatggccgcaccgcaggtgcgcacctcggcccccggctactaccggatgctgctgggcgacttcgaaatcaccgcgctgtcggacggcacggtggcgctgccggtcgacaagcggctgaaccagccggccccgaagacgcagagcgcgctggccaagtccttccagaaagcgccgctcgaaacctcggtcaccggttacctcgtcaacaccggctccaagctggtgctggtggacaccggcgcggccggcctgttcggccccaccctgggccggctggcggccaacctcaaggccgcaggctatcagcccgagcaggtcgacgagatctacatcacccacatgcaccccgaccacgtgggcggcttgatggtgggtgagcaactggcgttcccgaacgcggtggtgcgtgcggaccagaaagaagccgatttctggctcagccagaccaacctcgacaaggccccggacgacgagagcaaaggcttcttcaaaggcgccatggcctcgctgaacccctatgtgaaggccggcaagttcaagcctttctcggggaacaccgacctggtgcccggcatcaaagcgctggccagccacggccacaccccgggccacaccacctacgtggtcgaaagccaggggcaaaagctcgccctgctcggcgacctgatactcgtcgccgcggtgcagttcgacgaccccagcgtcacgacccagctcgacagcgacagcaagtccgtcgcggtggagcgcaagaaggccttcgcggatgccgccaagggcggctacctgatcgcggcgtcccacctgtcgttccccggcatcggccacatccgcgccgaaggcaagggctaccgtttcgtgccggtgaactactcggtcgtcaaccccaagtgagactcctgttgatagatccagtaatgacctcagaactccatctggatttgttcagaacgctcggttgccgccgggcgttttttattggtgagaatccagctgtccacctacatcgatgcgctgaaagaagccgtcgacgcggtgctgtcgattaccggcagcaagg acctgaacatgctcggcgcctgctccggtggcatcacttgtaccgcactggtgggccactatgccgccattggcga gaacaaggtcaacgccctgaccctgctggtcagcgtgctggacaccaccatggacaaccaggttgctttgtttgtc gacgagcagaccttggaggccgccaagcgccactcctatcaggcgggcgtgctggaaggcagcgaaatggccaagg tgttcgcctggatgcgccccaacgacctgatctggaactactgggtaaacaactacctgctcggcaatgagccccc cgtgttcgacatcctgttctggaacaacgacaccacgcgcctgccggccgccttccacggcgacctgatcgaaatg ttcaagagcaacccgctgacccgccccgacgccctggaagtgtgcggcaccgcgatcgacctgaaacaggtcaaat gcgacatctacagcctcgccggcaccaacgaccacatcaccccctggccgtcatgctaccgctcggcacatctgtt cggcggcaagatcgaattcgtactgtccaacagcgggcatatccagagcatcctcaacccgccgggcaacccgaag gcacgtttcatgaccggtgccgatcgcccgggtgacccggtggcctggcaggaaaatgccatcaagcatgcagact cctggtggttgcactggcagagttggctgggcgagcgtgccggcgcgctgaaaaaggcaccgacccgcctgggcaa ccgtacctatgccgccggcgaagcctccccaggcacctacgttcacgagcgttgagttacagcgccgtggcggcct gcacggcgccacggtgtttacttcacccaagagtcacgtgcatgccgcaaccctatattttcaggaccgtcgagct ggacaaccagtccatccgcacttgacagctagctcagtcctaggtataatgctagccgcagtaagagaggaatgtacacatgcaaacgagaagggttgtgctcaagtctgcggccgccgcaggaactctgctcggcggcctggctgggtgcgcgagcgtggctggatcgatcggcacaggcgatcggatcaataccgtgcgcggtcctatcacaatctctgaagcgggtttcacactgactcacgagcacatctgcggcagctcggcaggattcttgcgtgcttggccagagttcttcggtagccgcaaagctctagcggaaaaggctgtgagaggattgcgccgcgccagagcggctggcgtgcgaacgattgtcgatgtgtcgactttcgatatcggtcgcgacgtcagtttattggccgaggtttcgcgggctgccgacgttcatatcgtggcggcgaccggcttgtggttcgacccgccactttcgatgcgattgaggagtgtagaggaactcacacagttcttcctgcgtgagattcaatatggcatcgaagacaccggaattagggcgggcattatcaaggtcgcgaccacaggcaaggcgaccccctttcaggagttagtgttaaaggcggccgcccgggccagcttggccaccggtgttccggtaaccactcacacggcagcaagtcagcgcgatggtgagcagcaggccgccatttttgagtccgaaggcttgagcccctcacgggtttgtattggtcacagcgatgatactgacgatttgagctatctcaccgccctcgctgcgcgcggatacctcatcggtctagaccacatcccgcacagtgcgattggtctagaagataatgcgagtgcatcagccctcctgggcatccgttcgtggcaaacacgggctctcttgatcaaggcgctcatcgaccaaggctacatgaaacaaatcctcgtttcgaatgactggctgttcgggttttcgagctatgtcaccaacatcatggacgtgatggatcgcgtgaaccccgacgggatggccttcattccactgagagtgatcccattcctacgagagaagggcgtcccacaggaaacgctggcaggcatcactgtgactaacccggcgcggttcttgtcaccgaccttgcgggcgtcatgagactcctgttgatagatccagtaatgacctcagaactccatctggatttgttcagaacgctcggttgccgccgggcgttttttattggtgagaatccagcgccacgcaacccgta ccgcttccctgggctggccaagctgaccgcgcggatgctcgactacctcgactacggccaggtcaacgtcatcggc gtgtcctggggcggcgccctggcccagcagtttgctcacgattaccccgagcgctgcaagaagctggtgctggccgccaccgctgccggtgcggtaatggtgccaggcaagcccaaggtgctgtggatgatggccagcccccggcgttacgt gcagccatcgcatgtcatccgcattgcgccgatgatctatggcggcggcttccgacgtgaccccgacctggccatg caccatgccgccaaggtgcgctccggcggcaagctgggctactactggcagctgttcgcagggctcggctggaccagcatccactggctgcacaagatccggcagcccaccctggtactggctggcgacgacgacccgttgatcccgctgat caacatgcgcctgctggcctggcggattcccaatgcccagctacacattatcgacgacggccatctgttcctgatc acccgtgccgaagccgtcgccccgatcatcatgaagttcctgcaggaagaacgtcagcgtgcggtcatgcatccccgtccggcctcgggggggtga

the order of insertion of the four expression cassettes:

mpd、opd、vgb、gfp。

2.2.8 determination of growth curves of the engineered Strain

1. Respectively streaking the engineering modified strain and the wild strain inserted with a plurality of exogenous genes on an LB solid plate containing 5-FU, culturing overnight, selecting a single colony, inoculating into an LB liquid culture test tube containing corresponding resistance, and culturing at 180r/min and 30 ℃ for 12 h.

2. Inoculating a proper amount of the bacterial liquid into a 100mLLB liquid culture medium, enabling the initial inoculation amount to be OD600 to be 0.05, arranging three groups in parallel, culturing at 180r/min and 30 ℃ for 48 h.

3. Sampling at regular intervals, measuring the light absorption value under 600nm by using an ultraviolet spectrophotometer, and measuring the growth conditions of the engineering modified strain and the wild strain.

2.2.9 genetic stability test of engineered Strain

In the experiment, the wild strain is subjected to plasmid introduction and chromosome modification, and in order to verify the genetic stability of the modified strain, the following operations are carried out:

1. the engineering strain is streaked, a single colony is selected and inoculated into an LB liquid culture medium containing specific antibiotics, and the culture is carried out at 180r/min and 30 ℃ for 12 h.

2. Taking a proper amount of culture for PCR detection, streaking the culture on an LB plate with corresponding resistance by using an inoculating loop, and carrying out inverted culture at 30 ℃ for 12 h. Single colonies were picked up in the same manner, inoculated into resistant LB liquid medium, cultured at 30 ℃ for 12 hours at 180 r/min.

3. Repeating the step 2 for 50 times, and performing PCR amplification verification on streaking bacteria at each time.

2.2.10 RNA extraction, reverse transcription and RT-PCR of engineered strains

The RNA of the P.putida KT2440 engineered strain is extracted by using a bacterial RNA extraction kit of Kangji century company, and the specific operation steps are as follows:

1. the engineering bacteria liquid cultured overnight is collected, about 1mL, centrifuged at 12000r/m for 2min at 4 ℃, and the supernatant is discarded.

2. An appropriate amount of Lysozyme was added to the buffer TE in advance to a concentration of 400. mu.g/mL, and mixed well. The cells were resuspended in 100. mu.L of mixed buffer TE and incubated at room temperature for 5-10 min.

3. Adding beta-mercaptoethanol into RL Buffer in advance, mixing uniformly, adding 350 mu L of RL Buffer into the resuspended bacterial liquid in the last step, and shaking uniformly and fully. Adding all the obtained liquid into a FL filtration column, centrifuging at 12000r/m for 2min, and collecting filtrate.

4. Adding 250 mu L of absolute ethyl alcohol and fully and uniformly mixing. Adding all the obtained liquid into FL adsorption column, centrifuging at 12000r/m for 1min, discarding waste liquid, and returning the adsorption column to the collecting tube.

5. Add 700. mu.L RW1 Buffer to the adsorption column, centrifuge at 12000r/m for 1min, discard the waste, and place the adsorption column back into the collection tube.

6. Adding 500 μ L RW2 Buffer (adding anhydrous alcohol in advance) into adsorption column, centrifuging at 12000r/m for 1min, discarding waste liquid, and placing adsorption column back into collection tube. The operation was repeated once.

7. Separating collection tube with adsorption column at 12000r/m for 2min, discarding waste liquid, placing the adsorption column in a new EP tube without RNase, standing at room temperature for 8-10min for completely drying.

8. Adding 30-50 μ L RNase-Free Water dropwise into the center of adsorption column, standing at room temperature for 2min, centrifuging at 12000r/m for 1min, and storing at-80 deg.C.

Using the extracted mRNA as a template, mRNA of the engineered strain was reverse-transcribed using Hifair II 1st Strand cDNA Synthesis Kit (gDNA digaster plus) (assist in Shanghai san Francisco Ltd.), and the gDNA digaster contained in the Kit was removed from the genomic DNA remaining during the extraction of RNA.

2.2.11 Western-Blot analysis

vgb is from Vitreoscilla sp, encodes hemoglobin, and to further confirm expression of this gene in the heterologous host p.putida KT2440, a short peptide (KHPEVRPLFDMGRQC) was selected to synthesize antigen and antibody, and whether vgb was expressed in the engineered strain was determined by observing the engineered and wild strain VHb proteins for the presence or absence. The specific operation steps are as follows:

1. taking the culture at the last stage of logarithmic growth, centrifuging for 3min at 4 ℃ at 12000r/m, removing the supernatant, and collecting the thalli.

2. The cells were washed with pre-chilled PBS buffer and then resuspended in an equal concentration of liquid. This step was repeated three times.

3. About 50mL of the cell suspension was subjected to ultrasonication treatment (pause time 3s, ultrasonication time 3s, power 500W, total time about 10 min).

4. After the completion of the sonication, the supernatant was centrifuged at 4 ℃ and an appropriate amount of 5 XSDS-PAGE loading buffer was added to carry out the subsequent SDS-PAGE experiments.

The specific procedures of SDS-PAGE are as follows:

1. and thoroughly cleaning the rubber plate with distilled water, installing and fixing the rubber plate on a base, and adding distilled water to detect whether a device leaks.

2. After confirming that the sealing was good, the distilled water in the rubber plate was poured off, and the water was sucked off with clean filter paper.

3. Preparing 12% separation glue, uniformly and quickly adding the separation glue to a position which is about 3cm away from the top end of the rubber plate, then adding a proper amount of isopropanol at a constant speed to compact the separation glue, and ensuring that no bubbles appear in the operation process.

4. After about 1h of the separation gel had solidified, the upper isopropanol layer was decanted off and blotted dry with clean filter paper.

5. 5% concentrated gum was prepared, the remaining portion of the slab was filled, and a comb was inserted.

6. And after the concentrated gel is solidified, taking the gel tank out of the fixed base, placing the gel tank into the electrophoresis tank, adding the buffer solution, and gently pulling out the comb to ensure that the gel hole is not polluted.

7. About 10-20. mu.L of sample was taken and accurately added to the center of the gel well.

8. Connecting the electrophoresis apparatus, firstly lowering the voltage to 60V for 20min, then increasing the voltage to 120V for about 3h until the protein bands are completely separated.

9. The plate was gently removed and two SDS-PAGE gels were obtained. One piece was stained with Coomassie Brilliant blue solution for 4-5h, repeatedly destained 4-5 times, and the run results of SDS-PAGE were examined using a gel imager. The other was used for the subsequent film transfer experiments.

The Western blot comprises the following specific operation steps:

1. the PVDF membrane combined with the target protein is placed in 5% skimmed milk powder and is sealed for 1h in a shaking table at room temperature.

2. Diluting rabbit-derived VHb polypeptide antibody 1000 times with 5% skimmed milk powder, placing the sealed PVDF membrane in the solution as primary antibody, and shaking at room temperature for 2h or overnight at 4 deg.C.

3. The PVDF membrane bound to one antibody was eluted 3 times with PBST buffer in a shaker at room temperature for about 10min each time.

4. The goat anti-rabbit IgG-HRP was diluted 2000-fold with 5% skimmed milk powder, and the PVDF membrane was placed in the diluted solution as a secondary antibody and shaken at room temperature for 2 hours or overnight at 4 ℃.

5. The PVDF membrane bound to secondary antibody was eluted 3 times with PBST buffer in a shaker at room temperature for about 10min each time.

6. Respectively and fully mixing A and B developing solutions in 250 mu L ECL kit, standing for 2min in the dark, and then uniformly coating on the surface of PVDF membrane for developing specific protein bands.

7. After developing for 2min at room temperature, observing the target protein band by using a gel imager.

2.2.12 detection of Green fluorescent protein

1. The KTU-MOVG and the KTU were streaked on LB plates, respectively, and a single colony was picked up and inoculated into 5mL of LB liquid medium and cultured overnight at 30 ℃.

2.2 mL of the above-mentioned bacterial solution was centrifuged at 4 ℃ and 5000r/m for 5min in a 1.5mL centrifuge tube, the supernatant was discarded, and the cells were washed 3 times with LB liquid medium and then resuspended in 400. mu.L of LB liquid medium.

3. FM4-64 fluorescent dye was added to a working concentration of 10. mu.M/L, and incubated at 30 ℃ for 15min in the absence of light.

4. And (3) sucking 5 mu L of the mixture on a glass slide in the dark, dropwise adding glycerol with the final concentration of 2%, pressing a cover glass, and sucking peripheral liquid by using filter paper.

5. The samples were observed under a 100X 10 oil microscope using a Leica confocal microscope, and the intracellular green fluorescent protein was excited using green excitation light (wavelength 488nm) and the red cell profile stained with FM4-64 fluorescent dye was excited using blue excitation light (wavelength 515 nm).

2.2.13 degradation experiment of organophosphorus pesticide

KTU-MOVG streaked culture, single colony was selected and inoculated in LB liquid medium and cultured overnight at 30 ℃. Centrifuging at 4 deg.C and 5000r/m for 4min, and collecting thallus. The cells were washed well with pre-cooled M9 medium and suspended.

2. An appropriate amount of the cell suspension was inoculated into a 500mL Erlenmeyer flask containing 100mL of M9 liquid medium to give an initial concentration of OD600 of 0.05. Adding proper amount of mother liquor of methyl parathion, chlorpyrifos, parathion and diazinon. Glucose was added at 0.5% to ensure normal cell growth.

3. Three sets of parallel experiments were set up and incubated at 30 ℃. KTU cultured under the same conditions was used as a negative control.

4. Sampling at different time points, and sucking 2mL of culture solution each time, wherein 1mL of culture solution is detected by using an ultraviolet spectrophotometer; an additional 1mL extraction was followed by analysis for contaminant degradation using Gas Chromatography (GC).

2.2.14 extraction of organophosphorus pesticides from samples

The extraction steps of the organophosphorus pesticide in the sample are as follows:

1. a1 mL sample was taken in a tube and an equal volume of ethyl acetate was added quickly.

2. And covering a plug, carrying out vortex oscillation for 2min, and standing for 5 min.

3. The liquid was transferred to a centrifuge tube and centrifuged at 12000r/m for 3min at 4 ℃.

4. Adding a proper amount of anhydrous sodium sulfate to further separate out the water in the organic phase.

5. The upper organic phase was carefully aspirated and filtered through a 0.45 μm filter into a brown sample vial followed by GC detection.

2.2.15GC assay conditions

The concentration of organophosphorus pesticide in the sample was detected by GC. The column model was DB-FFAP (30 m. times.0.25 mm. times.0.25 μm) and the amount of sample was 1. mu.L.

Detection conditions of methyl parathion: maintaining the initial temperature at 50 deg.C for 1 min; then raising the temperature to 180 ℃ at a speed of 30 ℃/min, and keeping the temperature for 1 min; then raising the temperature to 280 ℃ at a speed of 15 ℃/min, and keeping the temperature for 1 min; the temperature of the sample inlet is 220 ℃, and the temperature of the detector is 250 ℃; no split mode.

Detection conditions of chlorpyrifos: maintaining the initial temperature at 60 deg.C for 1 min; then raising the temperature to 170 ℃ at a speed of 20 ℃/min, and keeping the temperature for 0.5 min; raising the temperature to 250 ℃ at a speed of 5 ℃/min, and keeping the temperature for 0.5 min; then raising the temperature to 300 ℃ at a speed of 10 ℃/min, and keeping the temperature for 2 min; the temperature of the sample inlet is 250 ℃, and the temperature of the detector is 320 ℃; no split mode.

Detection conditions of parathion: the initial temperature is 50 ℃, and the temperature is kept for 0.5 min; raising the temperature to 120 ℃ at a speed of 20 ℃/min; then raising the temperature to 250 ℃ at a speed of 5 ℃/min, and keeping the temperature for 5 min; the injection port temperature is 250 ℃, and the detector temperature is 260 ℃; no split mode.

Detection conditions of diazinon: the initial temperature is 95 ℃, and the temperature is kept for 1.5 min; raising the temperature to 200 ℃ at a speed of 25 ℃/min, raising the temperature to 240 ℃ at a speed of 5 ℃/min, raising the temperature to 280 ℃ at a speed of 20 ℃/min, and keeping the temperature for 10 min; the injection port temperature is 250 ℃, and the detector temperature is 250 ℃; no split mode.

The standard solutions (0, 20, 50, 80, 100mg/L) with different concentrations were prepared from the stock solutions of the above pesticides, and GC measurement was carried out, and a standard curve of the concentration of each pesticide was drawn based on the peak areas measured. And calculating the concentration of the pesticide in the sample by using the standard curve.

Experimental results and data:

2.3.1 construction of engineering strains for degrading various organophosphorus pesticides

Organophosphorus pesticides are very common in agricultural production, wherein methyl parathion, chlorpyrifos, parathion and diazinon are widely used, and the organophosphorus pesticides can be physically, chemically and biologically repaired. Research shows that methyl parathion and chlorpyrifos can be effectively degraded by MPH (methyl parathion hydrolase) coded by mpd gene, parathion can be effectively degraded by OPH (organic phosphorus hydrolase) coded by opd gene, and diazinon is proved to be effectively degraded by pseudomonas strain.

The invention inserts mpd and opd into chromosome of P.putida KT2440 to construct intermediate strain KTU-MO; in order to improve the expression quantity of the exogenous gene, J23119 strong promoters are added before the two inserted genes; the invention also inserts vgb to improve the oxygen uptake capacity of the strain and construct an intermediate strain KTU-MOV; gfp was inserted to trace the activity of the strain, and the engineered strain KTU-MOVG was constructed. The insertion sites selected by the exogenous genes are non-essential genes and byproduct genes of the strain. The information and insertion sites of the foreign genes are shown in Table 14.

TABLE 14 information and insertion sites of foreign genes

The construction method of the engineering strain is as described in the above section, namely, the constructed insertion vector is electrically transformed into the prepared KT2440 competent cell, single-double exchange screening is carried out by utilizing different antibiotic resistances, PCR amplification is carried out by utilizing upstream and downstream primers of an insertion gene expression cassette, and then detection is carried out through the size of a strip, so as to obtain the engineering strain.

As shown in FIG. 3, lane 1 shows the result of PCR of reading frame insertion of mpd gene, and the size of the band is 2251 bp; lane 2 shows the result of PCR of the opd gene insertion reading frame, with a band size of 2456 bp; lane 3 shows the result of PCR of the vgb gene insertion reading frame, and the band size is 1567 bp; lane 4 shows the result of PCR with gfp gene inserted in reading frame, and the band size is 1846 bp. And selecting the strains with correct band verification, sending the strains to a company for sequencing, comparing the sequencing result with the original sequence, and displaying that the sequencing result is consistent with the original sequence, thereby successfully constructing the engineering strains. The invention constructs strains KTU-M, KTU-MO, KTU-MOV and KTU-MOVG inserted into mpd, opd, vgb and gfp in sequence.

2.3.2 growth status of wild and engineered strains

The foreign gene is inserted into the P.putida KT2440 chromosome, and the selected insertion site is a non-essential gene or a byproduct gene, so that the normal state of the strain is not influenced. In order to examine whether the insertion of foreign gene affects the growth of cells, the growth conditions of the wild type strain P.putida KTU and the engineered strain KTU-MOVG were observed and compared in this experiment (FIG. 4), and the specific operation method is shown in FIG. 2.2.8.

2.3.3 stability of the foreign Gene of the engineered Strain KTU-MOVG

To further confirm that the foreign gene can be stably inherited in P.putida KT2440, the test was performed by continuously culturing the engineered strain KTU-MOVG in LB liquid medium for 50 passages, and the specific operation steps are shown in 2.2.9. The results of PCR verification of the 50 th generation of the engineered strain are shown in FIG. 5. The 4 inserted foreign genes exist stably on the genome, which indicates that the engineering strain can be inherited stably in a natural state.

2.3.4 transcription of foreign genes in engineered strains

According to the invention, 4 exogenous genes mpd, opd, vgb and gfp are placed under the regulation of a promoter J23119 when an exogenous gene expression cassette is constructed, and the constitutive strong promoter J23119 can be effectively used for the expression of the exogenous genes in P.putida. The transcription of four exogenous genes in the engineering strain P.putida KTU-MOVG is analyzed by RT-PCR with cDNA obtained by reverse transcription as a template, the specific operation steps are shown in 2.2.10, and the PCR amplification result is verified as shown in FIG. 6.

As is clear from FIG. 2.6, when PCR amplification was carried out using the genomic DNA of the engineered strain and the cDNA obtained by reverse transcription as templates, the desired bands were obtained, and mRNA and ddH were used₂When O is a template, the target band is not obtained. This indicates that the foreign gene inserted into the KTU-MOVG genome was successfully transcribed.

2.3.5 expression of exogenous genes in engineered strains

Four exogenous genes including mpd, opd, vgb and gfp are inserted into a P.putida KT2440, and the expression of the mpd and opd is verified by carrying out a degradation experiment of an engineering strain P.putida KTU-MOVG on an organophosphorus pesticide; verifying the expression of vgb by detecting the presence and expression of VHb in the engineered strain; gfp expression was verified by fluorescence detection of the viability of p.putida KTU-MOVG.

2.3.5.1 degradation of organophosphorus pesticide by engineering strain

In order to verify the degradation capability of the engineering strain P.putida KTU-MOVG to different organophosphorus pesticides, methyl parathion, chlorpyrifos, parathion and diazinon are selected for degradation. 100mg/L of methyl parathion, chlorpyrifos, parathion and diazinon are respectively added into an M9 liquid culture medium, and a control experiment and a parallel experiment are set. Sampling and monitoring are carried out at different time nodes, and the sample is extracted and then is detected by using a GC (gas chromatography), wherein the specific operation method is shown in the detection condition of the GC. Before detecting the concentration of the pesticide in the sample, determining the peak-appearing time of the pesticide, and drawing a corresponding standard curve.

Methyl parathion:

according to the GC result of the methyl parathion standard product, the peak emergence time of the methyl parathion is about 8.1 min. The peak time chart and the concentration standard curve are shown in figure 7.

Taking 100mg/L methyl parathion as a substrate, sampling 2mL every 6h, wherein 1mL uses an ultraviolet spectrophotometer to detect the growth condition of the thalli, and the other 1mL is extracted by ethyl acetate and then subjected to GC detection. And (4) measuring and calculating the concentration of the methyl parathion according to the standard curve, and drawing a methyl parathion degradation curve. The growth of the cells and the degradation curve of methyl parathion are shown in FIG. 8.

In FIG. 8, A is the degradation curve of the engineering strain parathion-methyl, which is rapidly degraded in the first 12h, and the degradation amount is about 80% of the initial addition amount; the reduction of the degradation rate after 12h is probably caused by the toxicity to the thalli and the inhibition of the activity of the thalli due to the accumulation of metabolites; methyl parathion was completely degraded at 30 h. No reduction in methyl parathion was detected in the wild type strain KTU culture system. B is a growth curve of the engineering strain KTU-MOVG in a culture medium added with methyl parathion, the strain does not grow in the first 6h, and probably the strain is influenced to a certain extent by the addition of the methyl parathion; after 6h, the concentration of methyl parathion is reduced, and the bacterial strain grows faster; after 18h, methyl parathion was largely consumed as a substrate and the strain grew to plateau. No increase of thallus density is seen in a wild type strain KTU culture system.

Chlorpyrifos:

according to GC results of chlorpyrifos standard products, the peak emergence time of the chlorpyrifos is about 31.0 min. The peak time chart and the concentration standard curve are shown in figure 9.

Taking 100mg/L chlorpyrifos as a substrate, sampling 2mL every 6h, wherein 1mL uses an ultraviolet spectrophotometer to detect the growth condition of thalli, and the other 1mL is extracted by ethyl acetate and then subjected to GC detection. According to the drawn standard curve, the concentration of the chlorpyrifos is calculated through the peak area of the sample, and a chlorpyrifos degradation curve is drawn. The growth of the cells and the degradation curve of chlorpyrifos are shown in FIG. 10.

In fig. 10, a is a degradation curve of the engineering strain to chlorpyrifos, and it can be seen that chlorpyrifos is rapidly degraded in the first 12 hours, and the degradation amount is about 70% of the initial addition amount; the degradation rate is slightly reduced after 12 hours; chlorpyrifos was substantially degraded at 24 h. No reduction in chlorpyrifos was detected in the wild type strain KTU culture system. B is a growth curve of the engineering strain KTU-MOVG in a culture medium added with chlorpyrifos, the strain grows rapidly in the first 12 hours, and the utilization capacity of the engineering strain to the chlorpyrifos is good; after 12h, the chlorpyrifos is consumed as a substrate in a large amount, the strain grows to a plateau stage, and the thallus density is slowly increased. No increase of thallus density is seen in a wild type strain KTU culture system.

Parathion:

according to the GC result of the parathion standard product, the peak-off time of the parathion is about 32.0 min. The peak time chart and the concentration standard curve are shown in figure 11.

Taking 100mg/L parathion as a substrate, sampling 2mL every 6h, wherein 1mL uses an ultraviolet spectrophotometer to detect the growth condition of the thalli, and the other 1mL is extracted by ethyl acetate and then subjected to GC detection. According to the drawn standard curve, the concentration of parathion is calculated through the peak area of the sample, and a parathion degradation curve is drawn. The growth of the cells and the parathion degradation curve are shown in FIG. 12.

In FIG. 12, A is the degradation curve of the engineering strain to parathion, and it can be seen that parathion is rapidly degraded in the first 18h, the degradation amount is about 85% of the initial addition amount; the degradation is slow after 18 hours; parathion was completely degraded at 36 h. No decrease in parathion was detected in the wild type strain KTU culture system. B is a growth curve of the engineering strain KTU-MOVG in a culture medium added with parathion, and the growth rate of the strain is higher in the first 18 h; after 18h, the parathion concentration is reduced, and the strain grows slowly. No increase of thallus density is seen in a wild type strain KTU culture system.

Diazinon:

according to the GC result of the diazinon standard product, the peak-off time of the diazinon is about 30.7 min. The peak time chart and the concentration standard curve are shown in figure 13.

2mL samples were taken every 6 hours with 100mg/L diazinon as a substrate, wherein 1mL was assayed for growth of the cells using an ultraviolet spectrophotometer, and 1mL was assayed by GC after extraction with ethyl acetate. According to the drawn standard curve, calculating the concentration of the diazinon through the peak area of the sample, and drawing a diazinon degradation curve. The growth of the cells and the degradation curve of diazinon are shown in FIG. 14.

FIG. 14, A is the degradation curve of the engineering strain to diazinon, and it can be seen that the degradation rate of diazinon is fast in the first 12h, and the degradation amount is about 70% of the initial addition amount; the degradation is slow after 12h, and the diazinon is not degraded basically at the 18 th to 24 th h. No reduction in diazinon was detected in the wild-type strain KTU culture system. B is a growth curve of the engineering strain KTU-MOVG in the culture medium added with diazinon, and the growth rate of the strain is higher in the first 12 h; after 12h, the density of the thalli is basically unchanged, and the strain grows to a plateau stage. No increase of thallus density is seen in a wild type strain KTU culture system.

2.3.5.2 VHb was expressed in P.putida KT2440

To verify that vgb is normally expressed in p.putida KT2440, the present invention verifies the presence of VHb in KT 2440. Coomassie brilliant blue staining treatment was performed using SDS-PAGE gel; Western-Blot was performed using cell lysates and anti-VHb serum as specific primary antibodies (rabbit antibodies) and goat anti-rabbit secondary antibodies, as detailed in 2.2.11. The results of Coomassie blue staining and Western-Blot detection are shown in FIG. 15.

The protein molecular weight calculated from the amino acid sequence of VHb is about 15.78kDa, and A in FIG. 15 is Coomassie brilliant blue staining pattern of SDS-PAGE gel, where the expression of VHb in wild strain and engineered strain cannot be distinguished clearly, probably because vgb is inserted into KT2440 genome rather than plasmid expression, and the staining effect with Coomassie brilliant blue is not obvious. B is a result graph of detecting VHb by Western-Blot, a specific band appears in the engineering strain KTU-MOVG at 15kDa, the molecular weight of the protein is consistent with that of VHb, and the specific band can not be detected in the wild strain KTU. This indicates that VHb can be successfully expressed in recombinant p.putida KT 2440.

VHb expression can improve the growth and metabolic capability of cells, KTU-MOVG is cultured under the condition of oxygen limitation, and the thallus presents deeper red than the wild strain KTU after centrifugation, as shown in figure 16.

2.3.5.3 expression of GFP in P.putida KT2440

To trace the engineered strain, gfp was inserted into the chromosome of p.putida KT2440 and the viability of the recombinant strain KTU-MOVG was monitored by green fluorescent protein. The specific operation steps are shown in 2.2.12. The results of GFP expression in the engineered strain are shown in FIG. 17.

FIG. 17A shows green fluorescence observed under a confocal microscope, and when excited by green excitation light, the engineered strain with gfp inserted into the chromosome appears green, indicating that gfp is successfully expressed and functions normally; b is a confocal observation red fluorescence result in the same visual field, the strain is dyed by FM4-64, and a red cell outline can be seen by using blue excitation light for excitation; c is the fusion of A and B, the cell membrane of the thallus is red, the intracellular is green, and the green is proved to be the green generated by the function of GFP in the engineering strain KTU-MOVG. In the test, the wild type strain KTU is used as a negative control, and no green fluorescent signal is observed.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> university of southern kayak

<120> engineering bacterium for degrading organophosphorus pesticide and construction method thereof

<160> 37

<170> SIPOSequenceListing 1.0

<210> 1

<211> 10

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gtaagagagg 10

<210> 2

<211> 35

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 2

ctacgtgttc gacctttgac agctagctca gtcct 35

<210> 3

<211> 35

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 3

ctatcaacag gagtctcact tggggttgac gaccg 35

<210> 4

<211> 35

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 4

ccagtccatc cgcacttgac agctagctca gtcct 35

<210> 5

<211> 35

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 5

ctatcaacag gagtctcatg acgcccgcaa ggtcg 35

<210> 6

<211> 64

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 6

agtcctaggt ataatgctag ccgcagtaag agaggaatgt acacatgtta gaccagcaaa 60

ccat 64

<210> 7

<211> 35

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 7

gcaacactgt ggcgactggt tattcaaccg cttga 35

<210> 8

<211> 64

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 8

agtcctaggt ataatgctag ccgcagtaag agaggaatgt acacatggtg agcaagggcg 60

agga 64

<210> 9

<211> 35

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 9

tcatcagcaa tgcgcctggt tacttgtaca gctcg 35

<210> 10

<211> 35

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 10

gtcaacccca agtgagactc ctgttgatag atcca 35

<210> 11

<211> 35

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 11

gatgtaggtg gacagctgga ttctcaccaa taaaa 35

<210> 12

<211> 78

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 12

ttgacagcta gctcagtcct aggtataatg ctagccgcag taagagagga atgtacacat 60

ggccgcaccg caggtgcg 78

<210> 13

<211> 35

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 13

ttgcgggcgt catgagactc ctgttgatag atcca 35

<210> 14

<211> 35

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 14

acgggttgcg tggcgctgga ttctcaccaa taaaa 35

<210> 15

<211> 78

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 15

ttgacagcta gctcagtcct aggtataatg ctagccgcag taagagagga atgtacacat 60

gcaaacgaga agggttgt 78

<210> 16

<211> 41

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 16

ccgggtaccg agctcgaatt ctcggcacgc accgtgctgc g 41

<210> 17

<211> 35

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 17

tgagctagct gtcaaaggtc gaacacgtag aactt 35

<210> 18

<211> 35

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 18

ttggtgagaa tccagctgtc cacctacatc gatgc 35

<210> 19

<211> 41

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 19

aaaacgacgg ccagtgaatt ccgaacagat gtgccgagcg g 41

<210> 20

<211> 41

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 20

ccgggtaccg agctcgaatt cacaccacgc gcctgccggc c 41

<210> 21

<211> 35

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 21

tgagctagct gtcaagtgcg gatggactgg ttgtc 35

<210> 22

<211> 35

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 22

ttggtgagaa tccagcgcca cgcaacccgt accgc 35

<210> 23

<211> 41

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 23

aaaacgacgg ccagtgaatt ccgttcttcc tgcaggaact t 41

<210> 24

<211> 41

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 24

ccgggtaccg agctcgaatt ctgcagcacg gcgcgctgat t 41

<210> 25

<211> 35

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 25

tgagctagct gtcaagcttc cgtggcccgc atatc 35

<210> 26

<211> 35

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 26

cggttgaata accagtcgcc acagtgttgc tcggc 35

<210> 27

<211> 41

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 27

aaaacgacgg ccagtgaatt ctcgacagcc tgttgcaacc g 41

<210> 28

<211> 41

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 28

ccgggtaccg agctcgaatt cctgccgaag ctgccatagc c 41

<210> 29

<211> 35

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 29

tgagctagct gtcaaggcag atctgcatgt ccacc 35

<210> 30

<211> 35

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 30

tgtacaagta accaggcgca ttgctgatga cattg 35

<210> 31

<211> 41

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 31

aaaacgacgg ccagtgaatt cactggcgag gtggtgtcgc a 41

<210> 32

<211> 2251

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 32

tcggcacgca ccgtgctgcg ccaggccgtg cgccaaccgc tgcacagcgc caagcatgtg 60

gctcactttg gcctggagct gaagaacgtg ttgctgggca aatccagcct ggccccggac 120

agcgacgacc gtcgcttcaa tgacccggcc tggagcaaca acccgctgta ccgccgctac 180

ctgcaaacct acctggcctg gcgcaaggag ctgcaggact gggtgagcag cagcgacctg 240

tccccccagg acatcagccg cggccagttc gtcatcaacc tgatgaccga ggccatggcg 300

ccgaccaata ccctgtccaa cccggctgcg gtcaaacgct tcttcgaaac cggcggcaag 360

agcctgctcg atggcctgtc caacctggcc aaggacatgg tcaacaacgg cggcatgccc 420

agccaggtga acatggatgc cttcgaagtg ggcaagaacc tgggcaccag cgaaggcgcg 480

gtggtgtacc gcaacgatgt gctggaactg atccagtaca gccccatcac cgagcaggtg 540

catgcccgtc cgctgctggt ggtgccaccg cagatcaaca agttctacgt gttcgacctt 600

tgacagctag ctcagtccta ggtataatgc tagccgcagt aagagaggaa tgtacacatg 660

gccgcaccgc aggtgcgcac ctcggccccc ggctactacc ggatgctgct gggcgacttc 720

gaaatcaccg cgctgtcgga cggcacggtg gcgctgccgg tcgacaagcg gctgaaccag 780

ccggccccga agacgcagag cgcgctggcc aagtccttcc agaaagcgcc gctcgaaacc 840

tcggtcaccg gttacctcgt caacaccggc tccaagctgg tgctggtgga caccggcgcg 900

gccggcctgt tcggccccac cctgggccgg ctggcggcca acctcaaggc cgcaggctat 960

cagcccgagc aggtcgacga gatctacatc acccacatgc accccgacca cgtgggcggc 1020

ttgatggtgg gtgagcaact ggcgttcccg aacgcggtgg tgcgtgcgga ccagaaagaa 1080

gccgatttct ggctcagcca gaccaacctc gacaaggccc cggacgacga gagcaaaggc 1140

ttcttcaaag gcgccatggc ctcgctgaac ccctatgtga aggccggcaa gttcaagcct 1200

ttctcgggga acaccgacct ggtgcccggc atcaaagcgc tggccagcca cggccacacc 1260

ccgggccaca ccacctacgt ggtcgaaagc caggggcaaa agctcgccct gctcggcgac 1320

ctgatactcg tcgccgcggt gcagttcgac gaccccagcg tcacgaccca gctcgacagc 1380

gacagcaagt ccgtcgcggt ggagcgcaag aaggccttcg cggatgccgc caagggcggc 1440

tacctgatcg cggcgtccca cctgtcgttc cccggcatcg gccacatccg cgccgaaggc 1500

aagggctacc gtttcgtgcc ggtgaactac tcggtcgtca accccaagtg agactcctgt 1560

tgatagatcc agtaatgacc tcagaactcc atctggattt gttcagaacg ctcggttgcc 1620

gccgggcgtt ttttattggt gagaatccag ctgtccacct acatcgatgc gctgaaagaa 1680

gccgtcgacg cggtgctgtc gattaccggc agcaaggacc tgaacatgct cggcgcctgc 1740

tccggtggca tcacttgtac cgcactggtg ggccactatg ccgccattgg cgagaacaag 1800

gtcaacgccc tgaccctgct ggtcagcgtg ctggacacca ccatggacaa ccaggttgct 1860

ttgtttgtcg acgagcagac cttggaggcc gccaagcgcc actcctatca ggcgggcgtg 1920

ctggaaggca gcgaaatggc caaggtgttc gcctggatgc gccccaacga cctgatctgg 1980

aactactggg taaacaacta cctgctcggc aatgagcccc ccgtgttcga catcctgttc 2040

tggaacaacg acaccacgcg cctgccggcc gccttccacg gcgacctgat cgaaatgttc 2100

aagagcaacc cgctgacccg ccccgacgcc ctggaagtgt gcggcaccgc gatcgacctg 2160

aaacaggtca aatgcgacat ctacagcctc gccggcacca acgaccacat caccccctgg 2220

ccgtcatgct accgctcggc acatctgttc g 2251

<210> 33

<211> 2456

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 33

acaccacgcg cctgccggcc gccttccacg gcgacctgat cgaaatgttc aagagcaacc 60

cgctgacccg ccccgacgcc ctggaagtgt gcggcaccgc gatcgacctg aaacaggtca 120

aatgcgacat ctacagcctc gccggcacca acgaccacat caccccctgg ccgtcatgct 180

accgctcggc acatctgttc ggcggcaaga tcgaattcgt actgtccaac agcgggcata 240

tccagagcat cctcaacccg ccgggcaacc cgaaggcacg tttcatgacc ggtgccgatc 300

gcccgggtga cccggtggcc tggcaggaaa atgccatcaa gcatgcagac tcctggtggt 360

tgcactggca gagttggctg ggcgagcgtg ccggcgcgct gaaaaaggca ccgacccgcc 420

tgggcaaccg tacctatgcc gccggcgaag cctccccagg cacctacgtt cacgagcgtt 480

gagttacagc gccgtggcgg cctgcacggc gccacggtgt ttacttcacc caagagtcac 540

gtgcatgccg caaccctata ttttcaggac cgtcgagctg gacaaccagt ccatccgcac 600

ttgacagcta gctcagtcct aggtataatg ctagccgcag taagagagga atgtacacat 660

gcaaacgaga agggttgtgc tcaagtctgc ggccgccgca ggaactctgc tcggcggcct 720

ggctgggtgc gcgagcgtgg ctggatcgat cggcacaggc gatcggatca ataccgtgcg 780

cggtcctatc acaatctctg aagcgggttt cacactgact cacgagcaca tctgcggcag 840

ctcggcagga ttcttgcgtg cttggccaga gttcttcggt agccgcaaag ctctagcgga 900

aaaggctgtg agaggattgc gccgcgccag agcggctggc gtgcgaacga ttgtcgatgt 960

gtcgactttc gatatcggtc gcgacgtcag tttattggcc gaggtttcgc gggctgccga 1020

cgttcatatc gtggcggcga ccggcttgtg gttcgacccg ccactttcga tgcgattgag 1080

gagtgtagag gaactcacac agttcttcct gcgtgagatt caatatggca tcgaagacac 1140

cggaattagg gcgggcatta tcaaggtcgc gaccacaggc aaggcgaccc cctttcagga 1200

gttagtgtta aaggcggccg cccgggccag cttggccacc ggtgttccgg taaccactca 1260

cacggcagca agtcagcgcg atggtgagca gcaggccgcc atttttgagt ccgaaggctt 1320

gagcccctca cgggtttgta ttggtcacag cgatgatact gacgatttga gctatctcac 1380

cgccctcgct gcgcgcggat acctcatcgg tctagaccac atcccgcaca gtgcgattgg 1440

tctagaagat aatgcgagtg catcagccct cctgggcatc cgttcgtggc aaacacgggc 1500

tctcttgatc aaggcgctca tcgaccaagg ctacatgaaa caaatcctcg tttcgaatga 1560

ctggctgttc gggttttcga gctatgtcac caacatcatg gacgtgatgg atcgcgtgaa 1620

ccccgacggg atggccttca ttccactgag agtgatccca ttcctacgag agaagggcgt 1680

cccacaggaa acgctggcag gcatcactgt gactaacccg gcgcggttct tgtcaccgac 1740

cttgcgggcg tcatgagact cctgttgata gatccagtaa tgacctcaga actccatctg 1800

gatttgttca gaacgctcgg ttgccgccgg gcgtttttta ttggtgagaa tccagcgcca 1860

cgcaacccgt accgcttccc tgggctggcc aagctgaccg cgcggatgct cgactacctc 1920

gactacggcc aggtcaacgt catcggcgtg tcctggggcg gcgccctggc ccagcagttt 1980

gctcacgatt accccgagcg ctgcaagaag ctggtgctgg ccgccaccgc tgccggtgcg 2040

gtaatggtgc caggcaagcc caaggtgctg tggatgatgg ccagcccccg gcgttacgtg 2100

cagccatcgc atgtcatccg cattgcgccg atgatctatg gcggcggctt ccgacgtgac 2160

cccgacctgg ccatgcacca tgccgccaag gtgcgctccg gcggcaagct gggctactac 2220

tggcagctgt tcgcagggct cggctggacc agcatccact ggctgcacaa gatccggcag 2280

cccaccctgg tactggctgg cgacgacgac ccgttgatcc cgctgatcaa catgcgcctg 2340

ctggcctggc ggattcccaa tgcccagcta cacattatcg acgacggcca tctgttcctg 2400

atcacccgtg ccgaagccgt cgccccgatc atcatgaagt tcctgcagga agaacg 2456

<210> 34

<211> 1567

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 34

tgcagcacgg cgcgctgatt gatcgagccc ttgtcggtga tttcaccggc gtcgatcgac 60

ggcggctcgg ccagcagcga cagccattcg atacggctgg cgttgccttg ggcatcgcgg 120

ttcaagcgct ccagccagtc agcgaaccaa ctgcgcacgg tgtcgttggc cagcacccgc 180

gcatcgctgg catcctctgc cagcccggcc aggcgccgac actcgggcag acgcgggaac 240

accagcaggc ccaggcattc acggtccggc gcggtgacca cgatgtcctg tacgtaaggc 300

gagccctcca gcactgcgcg gttgcgcagc ggcccgacac tgacgaatac cccggacgaa 360

agtttgaagt cctcagcgat acggccatcg aacatcaggc caagctcggg ctgcctggca 420

tcggccagct tcaacgcgtc gcccgaacag tagaagccct cctcgtcgaa cgcctcggcg 480

gtctgctgcg gcgagcgcca gtagcccggc atgatatgcg ggccacggaa gcttgacagc 540

tagctcagtc ctaggtataa tgctagccgc agtaagagag gaatgtacac atgttagacc 600

agcaaaccat taacatcatc aaagccactg ttcctgtatt gaaggagcat ggcgttacca 660

ttaccacgac tttttataaa aacttgtttg ccaaacaccc tgaagtacgt cctttgtttg 720

atatgggtcg ccaagaatct ttggagcagc ctaaggcttt ggcgatgacg gtattggcgg 780

cagcgcaaaa cattgaaaat ttgccagcta ttttgcctgc ggtcaaaaaa attgcagtca 840

aacattgtca agcaggcgtg gcagcagcgc attatccgat tgtcggtcaa gaattgttgg 900

gtgcgattaa agaagtattg ggcgatgccg caaccgatga cattttggac gcgtggggca 960

aggcttatgg cgtgattgca gatgtgttta ttcaagtgga agcagatttg tacgctcaag 1020

cggttgaata accagtcgcc acagtgttgc tcggcaatgc ggtccagccg gtcccagacg 1080

ctttgcgaca ggcctgcggc ggcaaagaag aacagcttga tgcgggcaaa gaacacctcg 1140

cgtagcgcgg ggtcctgctc cagtgccttg accagttcct cccagccctt gggtacggtg 1200

aggtaggccg tgggggaaat ctcgcgcaga ttgcgcaagg tctcggcgaa gccttgcggg 1260

gtcggcttgc cggcgtccag gtagaaactg cccccgttgt aaagcacgat gccgaggttg 1320

tggctaccgc cgaacgtgtg gttccacggc agccagtcca ccagcaccgg cggctcctcg 1380

gcgaacgtcg gaaaagtctg cagaagcatc tgctgattgg cgcacagcat gcgctgggtg 1440

gtgatcaccg ccttgggcag cttggtcgag cccgaggtga agaggaattt ggcgatggtg 1500

tccggcccgg tggcggcgaa agccgcatcg gccgccgcca ggtcacccgg ttgcaacagg 1560

ctgtcga 1567

<210> 35

<211> 1846

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 35

ctgccgaagc tgccatagcc gctggacttg accccgccaa acggcatctg cgcttcatcg 60

tgaacggtcg ggccgttgat atggcagata cccgactcca cccgttgggc caaggccagg 120

gcgcggctgg tgtcgcggct gaaaatggcc gatgacagac cgaactccga gtcgttggcc 180

agctgcagca aggcttcgtc gccttcggcg cgcagtacca ccgccaccgg gccgaaggac 240

tcctcgcggt acaggcgcat gctggcatcg acgttgtcga gcaaggtcgg ttgcaggatg 300

ctgccttcca gctggccgcc gctgaccagg cgcgcgccct tggccacggc atcgtcgatc 360

agtgccttga tgcgctcgcc ggccgctgcg ctgaccagcg agccgagcac cgaggtgctg 420

gcttgcggat cacctgcacg cagcccggcg atcttcaccg ccagcttgtc gacgaaagcg 480

tcggcaatac agctgtccac cacaaggcgc tcggtggaca tgcagatctg ccttgacagc 540

tagctcagtc ctaggtataa tgctagccgc agtaagagag gaatgtacac atggtgagca 600

agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac ggcgacgtaa 660

acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac ggcaagctga 720

ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc ctcgtgacca 780

ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag cagcacgact 840

tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc ttcaaggacg 900

acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg gtgaaccgca 960

tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac aagctggagt 1020

acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac ggcatcaagg 1080

tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc gaccactacc 1140

agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac tacctgagca 1200

cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc ctgctggagt 1260

tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa ccaggcgcat 1320

tgctgatgac attgaccacg ccgtcgccga tgcctgcatc gtgcagcacc tggccgatca 1380

gccgatggac cgccgggctc agctccgagg ccttgagcac cacggtgttg ccgcaggcca 1440

gcggcatggc aatggcacgc gtggccagta tcaccggggc gttccacggt gcgatgccca 1500

acaccacgcc gcagggcgcg cgcagggcca ttgcgaagct gccgggaacg tccgagggga 1560

tcacttcacc ggtgatctgc gtggtcatgg ctgcagcctc gcgcagcatg ttggcggcca 1620

acttcacgtt gaagccatac cagttggcca tggccccggt ttcaccggcg gcggcgatga 1680

actcggcggc cctcgcctgc aacagatcag cgcctgccag caagcggctg cgccgctcgc 1740

ccggtgccag ggcggcccag gccggaaacg ccgcgctggc agcagccacc gcggcatcgg 1800

catcggccag tgtggcggcg gcagcctgcg acaccacctc gccagt 1846

<210> 36

<211> 4329

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 36

tcaaggccgc accttggcgt gcaatgcgtc ggggtcttcg ccacggtaca gcgcctcgac 60

ctgagcggcg cgccgctgca gcacggcgcg ctgattgatc gagcccttgt cggtgatttc 120

accggcgtcg atcgacggcg gctcggccag cagcgacagc cattcgatac ggctggcgtt 180

gccttgggca tcgcggttca agcgctccag ccagtcagcg aaccaactgc gcacggtgtc 240

gttggccagc acccgcgcat cgctggcatc ctctgccagc ccggccaggc gccgacactc 300

gggcagacgc gggaacacca gcaggcccag gcattcacgg tccggcgcgg tgaccacgat 360

gtcctgtacg taaggcgagc cctccagcac tgcgcggttg cgcagcggcc cgacactgac 420

gaataccccg gacgaaagtt tgaagtcctc agcgatacgg ccatcgaaca tcaggccaag 480

ctcgggctgc ctggcatcgg ccagcttcaa cgcgtcgccc gaacagtaga agccctcctc 540

gtcgaacgcc tcggcggtct gctgcggcga gcgccagtag cccggcatga tatgcgggcc 600

acggaagctt gacagctagc tcagtcctag gtataatgct agccgcagta agagaggaat 660

gtacacatgt tagaccagca aaccattaac atcatcaaag ccactgttcc tgtattgaag 720

gagcatggcg ttaccattac cacgactttt tataaaaact tgtttgccaa acaccctgaa 780

gtacgtcctt tgtttgatat gggtcgccaa gaatctttgg agcagcctaa ggctttggcg 840

atgacggtat tggcggcagc gcaaaacatt gaaaatttgc cagctatttt gcctgcggtc 900

aaaaaaattg cagtcaaaca ttgtcaagca ggcgtggcag cagcgcatta tccgattgtc 960

ggtcaagaat tgttgggtgc gattaaagaa gtattgggcg atgccgcaac cgatgacatt 1020

ttggacgcgt ggggcaaggc ttatggcgtg attgcagatg tgtttattca agtggaagca 1080

gatttgtacg ctcaagcggt tgaataacca gtcgccacag tgttgctcgg caatgcggtc 1140

cagccggtcc cagacgcttt gcgacaggcc tgcggcggca aagaagaaca gcttgatgcg 1200

ggcaaagaac acctcgcgta gcgcggggtc ctgctccagt gccttgacca gttcctccca 1260

gcccttgggt acggtgaggt aggccgtggg ggaaatctcg cgcagattgc gcaaggtctc 1320

ggcgaagcct tgcggggtcg gcttgccggc gtccaggtag aaactgcccc cgttgtaaag 1380

cacgatgccg aggttgtggc taccgccgaa cgtgtggttc cacggcagcc agtccaccag 1440

caccggcggc tcctcggcga acgtcggaaa agtctgcaga agcatctgct gattggcgca 1500

cagcatgcgc tgggtggtga tcaccgcctt gggcagcttg gtcgagcccg aggtgaagag 1560

gaatttggcg atggtgtccg gcccggtggc ggcgaaagcc gcatcggccg ccgccaggtc 1620

acccggttgc aacaggctgt cgaagcttat atgggggcga cctgcgacct ggccacgcac 1680

gctgatcacg ccgaccgaat cgtccagcac cgcctcgaag gcgcgctgga acggctggct 1740

gtcgctgacg aagaccactc cgggggtgag cacctcgcag acatggcgca acttggcgaa 1800

gtcttgcgac aacagcgcgt aggccggcga caccgggcaa taggcaatac cggcatacat 1860

ggcgccgagg gcgatttgca ggtgttcgat gtcgttgccg gaaagcagcg ccagcgggcg 1920

ctcggcactg aggcccagtc ctagcaagtt ggcggcgatg gtgcgcacat cggcgagcat 1980

ctgcacgtag ctgatcgaac gccaggcacc gtctgcctgg cgtgccgcga tgaaagtggt 2040

gtccgggcgc acctgggccc aatgcaccag gcgctcgagc aggcgcgccg gcagcggcgc 2100

cagtggctcg acaggttgca tgcgcagcac gtcgtcgacg tgactgacct gcacctgggg 2160

atgcccgatg gccacctggc ggtagcgcgg acgttggcca gggtcggtcg accctgagcg 2220

ggcttcgtta ttcacgcagg ttgctccttg ttcttgttgt acatcctgcc gccgcccgat 2280

atgacggggc ggcggtcatc ttgccggagg tctgggcctg ccgcggctag atgggatagt 2340

gacgcgggcc gtgctggagg gtgacccagc gcaactgggt gaactgatcg atggccgtgc 2400

ggctgccgaa gctgccatag ccgctggact tgaccccgcc aaacggcatc tgcgcttcat 2460

cgtgaacggt cgggccgttg atatggcaga tacccgactc cacccgttgg gccaaggcca 2520

gggcgcggct ggtgtcgcgg ctgaaaatgg ccgatgacag accgaactcc gagtcgttgg 2580

ccagctgcag caaggcttcg tcgccttcgg cgcgcagtac caccgccacc gggccgaagg 2640

actcctcgcg gtacaggcgc atgctggcat cgacgttgtc gagcaaggtc ggttgcagga 2700

tgctgccttc cagctggccg ccgctgacca ggcgcgcgcc cttggccacg gcatcgtcga 2760

tcagtgcctt gatgcgctcg ccggccgctg cgctgaccag cgagccgagc accgaggtgc 2820

tggcttgcgg atcacctgca cgcagcccgg cgatcttcac cgccagcttg tcgacgaaag 2880

cgtcggcaat acagctgtcc accacaaggc gctcggtgga catgcagatc tgccttgaca 2940

gctagctcag tcctaggtat aatgctagcc gcagtaagag aggaatgtac acatggtgag 3000

caagggcgag gagctgttca ccggggtggt gcccatcctg gtcgagctgg acggcgacgt 3060

aaacggccac aagttcagcg tgtccggcga gggcgagggc gatgccacct acggcaagct 3120

gaccctgaag ttcatctgca ccaccggcaa gctgcccgtg ccctggccca ccctcgtgac 3180

caccctgacc tacggcgtgc agtgcttcag ccgctacccc gaccacatga agcagcacga 3240

cttcttcaag tccgccatgc ccgaaggcta cgtccaggag cgcaccatct tcttcaagga 3300

cgacggcaac tacaagaccc gcgccgaggt gaagttcgag ggcgacaccc tggtgaaccg 3360

catcgagctg aagggcatcg acttcaagga ggacggcaac atcctggggc acaagctgga 3420

gtacaactac aacagccaca acgtctatat catggccgac aagcagaaga acggcatcaa 3480

ggtgaacttc aagatccgcc acaacatcga ggacggcagc gtgcagctcg ccgaccacta 3540

ccagcagaac acccccatcg gcgacggccc cgtgctgctg cccgacaacc actacctgag 3600

cacccagtcc gccctgagca aagaccccaa cgagaagcgc gatcacatgg tcctgctgga 3660

gttcgtgacc gccgccggga tcactctcgg catggacgag ctgtacaagt aaccaggcgc 3720

attgctgatg acattgacca cgccgtcgcc gatgcctgca tcgtgcagca cctggccgat 3780

cagccgatgg accgccgggc tcagctccga ggccttgagc accacggtgt tgccgcaggc 3840

cagcggcatg gcaatggcac gcgtggccag tatcaccggg gcgttccacg gtgcgatgcc 3900

caacaccacg ccgcagggcg cgcgcagggc cattgcgaag ctgccgggaa cgtccgaggg 3960

gatcacttca ccggtgatct gcgtggtcat ggctgcagcc tcgcgcagca tgttggcggc 4020

caacttcacg ttgaagccat accagttggc catggccccg gtttcaccgg cggcggcgat 4080

gaactcggcg gccctcgcct gcaacagatc agcgcctgcc agcaagcggc tgcgccgctc 4140

gcccggtgcc agggcggccc aggccggaaa cgccgcgctg gcagcagcca ccgcggcatc 4200

ggcatcggcc agtgtggcgg cggcagcctg cgacaccacc tcgccagtca ccgggttaca 4260

gcgctcgaag gttcgtccat cgctggcggg gcgcgactgc ccgccaatca gcaaaggcac 4320

ctgcaacat 4329

<210> 37

<211> 4648

<212> DNA

<213> 2 Ambystoma laterale x Ambystoma jeffersonianum

<400> 37

atgagtaaca agaacaacga tgagctacag cggcaggcct cggaaaacac cctggggctg 60

aacccggtca tcggcatccg ccgcaaggac ctgttgagct cggcacgcac cgtgctgcgc 120

caggccgtgc gccaaccgct gcacagcgcc aagcatgtgg ctcactttgg cctggagctg 180

aagaacgtgt tgctgggcaa atccagcctg gccccggaca gcgacgaccg tcgcttcaat 240

gacccggcct ggagcaacaa cccgctgtac cgccgctacc tgcaaaccta cctggcctgg 300

cgcaaggagc tgcaggactg ggtgagcagc agcgacctgt ccccccagga catcagccgc 360

ggccagttcg tcatcaacct gatgaccgag gccatggcgc cgaccaatac cctgtccaac 420

ccggctgcgg tcaaacgctt cttcgaaacc ggcggcaaga gcctgctcga tggcctgtcc 480

aacctggcca aggacatggt caacaacggc ggcatgccca gccaggtgaa catggatgcc 540

ttcgaagtgg gcaagaacct gggcaccagc gaaggcgcgg tggtgtaccg caacgatgtg 600

ctggaactga tccagtacag ccccatcacc gagcaggtgc atgcccgtcc gctgctggtg 660

gtgccaccgc agatcaacaa gttctacgtg ttcgaccttt gacagctagc tcagtcctag 720

gtataatgct agccgcagta agagaggaat gtacacatgg ccgcaccgca ggtgcgcacc 780

tcggcccccg gctactaccg gatgctgctg ggcgacttcg aaatcaccgc gctgtcggac 840

ggcacggtgg cgctgccggt cgacaagcgg ctgaaccagc cggccccgaa gacgcagagc 900

gcgctggcca agtccttcca gaaagcgccg ctcgaaacct cggtcaccgg ttacctcgtc 960

aacaccggct ccaagctggt gctggtggac accggcgcgg ccggcctgtt cggccccacc 1020

ctgggccggc tggcggccaa cctcaaggcc gcaggctatc agcccgagca ggtcgacgag 1080

atctacatca cccacatgca ccccgaccac gtgggcggct tgatggtggg tgagcaactg 1140

gcgttcccga acgcggtggt gcgtgcggac cagaaagaag ccgatttctg gctcagccag 1200

accaacctcg acaaggcccc ggacgacgag agcaaaggct tcttcaaagg cgccatggcc 1260

tcgctgaacc cctatgtgaa ggccggcaag ttcaagcctt tctcggggaa caccgacctg 1320

gtgcccggca tcaaagcgct ggccagccac ggccacaccc cgggccacac cacctacgtg 1380

gtcgaaagcc aggggcaaaa gctcgccctg ctcggcgacc tgatactcgt cgccgcggtg 1440

cagttcgacg accccagcgt cacgacccag ctcgacagcg acagcaagtc cgtcgcggtg 1500

gagcgcaaga aggccttcgc ggatgccgcc aagggcggct acctgatcgc ggcgtcccac 1560

ctgtcgttcc ccggcatcgg ccacatccgc gccgaaggca agggctaccg tttcgtgccg 1620

gtgaactact cggtcgtcaa ccccaagtga gactcctgtt gatagatcca gtaatgacct 1680

cagaactcca tctggatttg ttcagaacgc tcggttgccg ccgggcgttt tttattggtg 1740

agaatccagc tgtccaccta catcgatgcg ctgaaagaag ccgtcgacgc ggtgctgtcg 1800

attaccggca gcaaggacct gaacatgctc ggcgcctgct ccggtggcat cacttgtacc 1860

gcactggtgg gccactatgc cgccattggc gagaacaagg tcaacgccct gaccctgctg 1920

gtcagcgtgc tggacaccac catggacaac caggttgctt tgtttgtcga cgagcagacc 1980

ttggaggccg ccaagcgcca ctcctatcag gcgggcgtgc tggaaggcag cgaaatggcc 2040

aaggtgttcg cctggatgcg ccccaacgac ctgatctgga actactgggt aaacaactac 2100

ctgctcggca atgagccccc cgtgttcgac atcctgttct ggaacaacga caccacgcgc 2160

ctgccggccg ccttccacgg cgacctgatc gaaatgttca agagcaaccc gctgacccgc 2220

cccgacgccc tggaagtgtg cggcaccgcg atcgacctga aacaggtcaa atgcgacatc 2280

tacagcctcg ccggcaccaa cgaccacatc accccctggc cgtcatgcta ccgctcggca 2340

catctgttcg gcggcaagat cgaattcgta ctgtccaaca gcgggcatat ccagagcatc 2400

ctcaacccgc cgggcaaccc gaaggcacgt ttcatgaccg gtgccgatcg cccgggtgac 2460

ccggtggcct ggcaggaaaa tgccatcaag catgcagact cctggtggtt gcactggcag 2520

agttggctgg gcgagcgtgc cggcgcgctg aaaaaggcac cgacccgcct gggcaaccgt 2580

acctatgccg ccggcgaagc ctccccaggc acctacgttc acgagcgttg agttacagcg 2640

ccgtggcggc ctgcacggcg ccacggtgtt tacttcaccc aagagtcacg tgcatgccgc 2700

aaccctatat tttcaggacc gtcgagctgg acaaccagtc catccgcact tgacagctag 2760

ctcagtccta ggtataatgc tagccgcagt aagagaggaa tgtacacatg caaacgagaa 2820

gggttgtgct caagtctgcg gccgccgcag gaactctgct cggcggcctg gctgggtgcg 2880

cgagcgtggc tggatcgatc ggcacaggcg atcggatcaa taccgtgcgc ggtcctatca 2940

caatctctga agcgggtttc acactgactc acgagcacat ctgcggcagc tcggcaggat 3000

tcttgcgtgc ttggccagag ttcttcggta gccgcaaagc tctagcggaa aaggctgtga 3060

gaggattgcg ccgcgccaga gcggctggcg tgcgaacgat tgtcgatgtg tcgactttcg 3120

atatcggtcg cgacgtcagt ttattggccg aggtttcgcg ggctgccgac gttcatatcg 3180

tggcggcgac cggcttgtgg ttcgacccgc cactttcgat gcgattgagg agtgtagagg 3240

aactcacaca gttcttcctg cgtgagattc aatatggcat cgaagacacc ggaattaggg 3300

cgggcattat caaggtcgcg accacaggca aggcgacccc ctttcaggag ttagtgttaa 3360

aggcggccgc ccgggccagc ttggccaccg gtgttccggt aaccactcac acggcagcaa 3420

gtcagcgcga tggtgagcag caggccgcca tttttgagtc cgaaggcttg agcccctcac 3480

gggtttgtat tggtcacagc gatgatactg acgatttgag ctatctcacc gccctcgctg 3540

cgcgcggata cctcatcggt ctagaccaca tcccgcacag tgcgattggt ctagaagata 3600

atgcgagtgc atcagccctc ctgggcatcc gttcgtggca aacacgggct ctcttgatca 3660

aggcgctcat cgaccaaggc tacatgaaac aaatcctcgt ttcgaatgac tggctgttcg 3720

ggttttcgag ctatgtcacc aacatcatgg acgtgatgga tcgcgtgaac cccgacggga 3780

tggccttcat tccactgaga gtgatcccat tcctacgaga gaagggcgtc ccacaggaaa 3840

cgctggcagg catcactgtg actaacccgg cgcggttctt gtcaccgacc ttgcgggcgt 3900

catgagactc ctgttgatag atccagtaat gacctcagaa ctccatctgg atttgttcag 3960

aacgctcggt tgccgccggg cgttttttat tggtgagaat ccagcgccac gcaacccgta 4020

ccgcttccct gggctggcca agctgaccgc gcggatgctc gactacctcg actacggcca 4080

ggtcaacgtc atcggcgtgt cctggggcgg cgccctggcc cagcagtttg ctcacgatta 4140

ccccgagcgc tgcaagaagc tggtgctggc cgccaccgct gccggtgcgg taatggtgcc 4200

aggcaagccc aaggtgctgt ggatgatggc cagcccccgg cgttacgtgc agccatcgca 4260

tgtcatccgc attgcgccga tgatctatgg cggcggcttc cgacgtgacc ccgacctggc 4320

catgcaccat gccgccaagg tgcgctccgg cggcaagctg ggctactact ggcagctgtt 4380

cgcagggctc ggctggacca gcatccactg gctgcacaag atccggcagc ccaccctggt 4440

actggctggc gacgacgacc cgttgatccc gctgatcaac atgcgcctgc tggcctggcg 4500

gattcccaat gcccagctac acattatcga cgacggccat ctgttcctga tcacccgtgc 4560

cgaagccgtc gccccgatca tcatgaagtt cctgcaggaa gaacgtcagc gtgcggtcat 4620

gcatccccgt ccggcctcgg gggggtga 4648

Claims

1. An engineering bacterium for degrading organophosphorus pesticide is obtained by inserting an mpd gene, an opd gene, a vgb gene and a gfp gene into a P.putida KT2440 host bacterium; the insertion sequence is mpd-opd-vg b-gfp.

2. The method for constructing engineering bacteria according to claim 1, comprising the steps of:

the nucleotide sequence of the RBS is shown as SEQ ID No. 1;

2) respectively carrying out second fusion on the first fusion products of the mpd and opd genes obtained in the step 1) and a lambda T0T initiator to obtain second fusion products of the two genes;

3. The construction method according to claim 2, wherein the nucleotide sequence of the upstream primer used for the first fusion of the mpd gene in step 1) is shown as SEQ ID No.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 3;

the nucleotide sequence of an upstream primer used for the first fusion of the opd gene is shown as SEQ ID N o.4, and the nucleotide sequence of a downstream primer is shown as SEQ ID No. 5;

the nucleotide sequence of an upstream primer used for the first fusion of the vgb gene is shown as SEQ ID N o.6, and the nucleotide sequence of a downstream primer is shown as SEQ ID No. 7;

4. The construction method according to claim 2, wherein the nucleotide sequence of the primer used for the second fusion of the mpd gene in step 2) is shown as SEQ ID No. 10-12;

the nucleotide sequence of a primer used for the second fusion of the opd gene is shown as SEQ ID No. 13-15.

5. The construction method according to claim 2, wherein the nucleotide sequence of the primer used for the third fusion of the mpd gene in step 3) is shown as SEQ ID No. 16-19;

6. The construction method according to claim 2, wherein the nucleotide sequence of the expression cassette of the mpd gene in step 3) is shown as SEQ ID No. 32.

7. The construction method according to claim 2, wherein the nucleotide sequence of the expression cassette of the opd gene in step 3) is shown as SEQ ID No. 33.

8. The construction method according to claim 2, wherein the nucleotide sequence of the expression cassette of the vgb gene in step 3) is shown as SEQ ID No. 34.

9. The construction method according to claim 2, wherein the nucleotide sequence of the expression cassette of the gfp gene of step 3) is shown as SEQ ID No. 35.

10. The building method according to claim 2, wherein the conditions for the step 3) connection include: the reaction was carried out at 37 ℃ for 30min in a metal bath.