CN102465109A - Genetic engineering strain for degrading farm chemicals and application thereof - Google Patents
Genetic engineering strain for degrading farm chemicals and application thereof Download PDFInfo
- Publication number
- CN102465109A CN102465109A CN2010105542658A CN201010554265A CN102465109A CN 102465109 A CN102465109 A CN 102465109A CN 2010105542658 A CN2010105542658 A CN 2010105542658A CN 201010554265 A CN201010554265 A CN 201010554265A CN 102465109 A CN102465109 A CN 102465109A
- Authority
- CN
- China
- Prior art keywords
- plasmid
- genetic engineering
- bacterium
- fragment
- suicide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a genetic engineering strain for degrading farm chemicals and an application thereof. The genetic engineering strain for degrading the farm chemicals comprises 1) double-gene expression plasmid having fluorescent characteristic and farm chemical degrading activity; and 2) inducible suicide plasmid. The genetic engineering strain not only has farm chemical degrading activity, and can be used for degrading residue farm chemicals in the environment, but also has a red fluorescent characteristic, so the genetic engineering strain can be easily found by people in the environment. At the same time, the genetic engineering strain also has an inducible suicide mechanism, so the genetic engineering strain can be artificially controlled to disappear in the environment according to the real situation and has promising application prospect.
Description
Technical field
The invention belongs to the genetically engineered field; Relate to a kind of genetic engineering bacterium (genetically engineered bacteria that is used for degrading pesticide; GEB), have and relate to a kind of genetic engineering bacterium and structure and application with red fluorescence characteristic and degradation of pesticide activity and inducibility suicide ability.
Background technology
Along with chemical pesticide widespread use aborning, people also pay close attention to all the more the residual and corresponding problem of environmental pollution that agricultural chemicals causes.The pesticide residue of how removing in the environment are the problems that numerous scientific research personnel endeavour to study always.
The using gene engineering mikrobe (be called genetically engineered microorganism again, genetically engineeredmicroorganisms, the degradation function to chemical pesticide that GEMs) is had to remove pesticide residue is effectively and economic method.Although GEMs has broad application prospects, many GEMs with specific function have also shown good functional performance under experiment condition, really are used to produce actual GEMs but seldom; Because GEMs is different with chemical substance, it is a kind of entity that can self-replacation, in case be released in the environment; Just can self-reproduction; Continue to exist, disadvantageous effect is arranged, want thoroughly to eliminate that they are extremely difficult in case find them.It is thus clear that; GEMs is a double-edged sword, and it is discharged in the environment, can bring into play useful effect; But might influence original ecosystem in the environment simultaneously again; As disturb the distribution of indigenous bacterium, through horizontal transfer and indigenous bacterium crossing over etc., can form new biological pollution like this, bring potential threat to the natural ecosystem human health of unifying.The genetically engineered researchdevelopment of China is rapider, the release of the GEMs of existing at present some amount, but to the ecology of GEMs be discharged in the environment after safety research do not see more deep research report as yet.
No matter be that GEMs is discharged in the environment, still will they be eliminated from environment, all need monitor existence, distribution and the remote effect of GEMs.Therefore, be necessary to set up the monitoring system of a GEMs security that is used for controling environment.
The rise of modern molecular biology method and technology is for the environmental monitoring of GEMs provides strong instrument.At present, existing monitoring method comprises PCR method (Amici et al., 1991; Khan etal., 1998), monoclonal antibody method (Ramos-Gonzalez et al., 1992), luciferin enzyme process (Rattray et al., 1990; Heller et al., 1992; Ripp et al., 2000) etc., when monitoring, all needing special device or substrate, practical application is very limited.Utilize the method for fluorescent protein labeling to monitor to be a simple and feasible method, without any need for the interpolation of substrate or cofactor, detect simple, and the luminous real-time monitoring that can continue of organism.
The safe handling of GEMs not only need have Monitoring systems easily; Also need have safety control system; Be the potentially dangerous property that reduces GEMs; The researchist has designed initiatively biophylaxis, and (active biological containment, ABC) system is so that reduce or eliminate the existence of GEMs in needs.Though ABC can not guarantee 100% biological containment rate, it helps to reduce the potentially dangerous property of GEMs really.1987, Molin etc. utilized the expression of trp promoter control suicide gene hok successfully to carry out bacterium conditionality suicide experiment (Molin et al., 1987); 1991; Formal ABC imagination (the Contreras et al. that proposes such as Contreras; 1991); This ABC system controls cell survival through the control of suicide gene is expressed, thereby for example controls the survival of the expression control GEMs of suicide gene through the change of chemical substrate or physical condition.Adopting which kind of mode to control the necrocytosis key is the selection that is the inducible promoters at the suicide gene upper reaches.After this, the ABC systematic research has had very fast development, and the kind that is used for the suicide gene of ABC system gets more and more, and the ABC pattern is also more and more perfect.Had multiple suicide gene to be used for the ABC system at present, they cause necrocytosis through different mechanism, as destroying cytolemma, cause lysis, decomposing cytogenetics material etc.
Though through nearly 20 years research and constantly transformation; The defence capability of the ABC system of GEMs is greatly enhanced; But its practical application is still waiting further research; Because have efficiently the mechanism of suicide and do not represent them in physical environment, also to have same effect external, physiological status of cells maybe be very inequality in experiment in vitro and actual environment, also might difference to the susceptibility of the inductor and the mechanism of committing suiside.How that the ABC system applies is actual in producing, really control effectively GEMs in environment distribution and construct safely and effectively GEMs and still remain further further investigation.
Summary of the invention
The purpose of this invention is to provide a kind of genetic engineering bacterium that is used for degrading pesticide.
Another object of the present invention provides the application of said gene engineering bacteria.
The objective of the invention is to realize through following technical scheme.On the one hand, the present invention provides a kind of genetic engineering bacterium that is used for degrading pesticide, and said genetic engineering bacterium comprises: 1) have the active double gene expression plasmid of fluorescent characteristic and degradation of pesticide; With 2) the inducibility suicide plasmid.
Preferably, said double gene expression plasmid has the gene of coding red fluorescent protein and the gene of coding organophosphor hydrolytic enzyme.
Preferably, said double gene expression plasmid has the plasmid map shown in Figure 1B.
Preferably, said double gene expression plasmid has the base sequence shown in SEQ.ID.NO 1.
Preferably, said inducibility suicide plasmid has the plasmid map shown in Fig. 1 C.
Preferably, said inducibility suicide plasmid has the base sequence shown in SEQ.ID.NO 2.
Preferably, said genetically engineered bacteria strain is selected from ETEC and false pseudomonas bacillus, is preferably ETEC.
On the other hand, the invention provides the construction process of said gene engineering bacteria, said method following steps: 1) structure has fluorescent characteristic and the active double gene expression plasmid of degradation of pesticide; 2) make up the inducibility suicide plasmid; 3) the double gene expression plasmid and the step 2 that step 1) are made up) the inducibility suicide plasmid cotransfection that makes up in bacterial strain, screen, promptly get.
In addition, the present invention also provides the cell liquid culture by said gene engineering bacteria preparation, and by the whole-cell protein liquid of said gene engineering bacteria preparation.
Another aspect the invention provides the said gene engineering bacteria, or above-mentioned cell liquid culture, or the application of above-mentioned whole-cell protein liquid in degrading pesticide.
In addition, the present invention also provides a kind of method of degrading pesticide, and said method adopts the said gene engineering bacteria, or above-mentioned cell liquid culture, or above-mentioned whole-cell protein liquid comes degrading pesticide.
In sum; The present invention provides a kind of artificial constructed genetic engineering bacterium with red fluorescence characteristic and degradation of pesticide activity and inducibility suicide ability; This bacterium can be used for removing pesticide residue; And have red fluorescence and can conveniently detect, have inducibility suicide ability and can carry out the characteristics that the oneself removes.With genetic engineering bacterium provided by the invention (genetically engineered bacteria; GEB) called after GEB-SRO; This GEB-SRO bacterium is by the double expression plasmid pL-DsRed-pL-OPH that carries red fluorescent protein gene and organophosphor hydrolytic enzyme gene [ETEC (Escherichia coli) EC-DGEP-LMT001; Be preserved in the common micro-organisms center (CGMCC of China Committee for Culture Collection of Microorganisms on January 19th, 2009; Address: Datun Road, Chaoyang District, Beijing City Institute of Microorganism, Academia Sinica); Its preserving number CGMCCNo.2881 specifically can be referring to patented claim 200910091287.2] and the suicide plasmid pDS corotation that carry the two copies of suicide gene dissolve E.coliBL21AI
TMExpressing bacterium constitutes.Particularly, said preparation method is following: adopt Calcium Chloride Method to prepare E.coli BL21AI
TMExpress bacterium competence, transform pL-DsRed-pL-OPH and go into E.coliBL21AI
TMExpress bacterium competence; Coat on the LB agar plate that contains penbritin, 28 ℃ of incubated overnight are chosen mono-clonal next day and are shaken bacterium it is prepared into competence; Suicide plasmid pDS is transformed in this competence; Coat and contain on the two anti-LB agar plates of kantlex and penbritin, 28 ℃ of incubated overnight, the mono-clonal of growing on flat board is has suicide mechanism and red fluorescence mark and the active genetic engineering bacterium GEB-SRO of OPH bacterium.
Through experimental verification GEB-SRO bacterial strain provided by the invention have following characteristic: 1) organophosphor hydrolytic enzyme is active, can be used for the removal of organophosphorus pesticide; 2) red fluorescence characteristic can detect without any need for the interpolation of substrate or cofactor, and method is simple, and the real-time monitoring that can continue; 3) can induce the suicide ability, can artificially control its extinction in environment, strengthen the environment safety in utilization of this bacterium according to practical situation.
Therefore; The invention provides a kind of genetic engineering bacterium with red fluorescence characteristic and degradation of pesticide activity and inducibility suicide ability; Its for the plasmids that will contain the two copies of suicide gene and the function plasmid corotation that have red fluorescent protein gene and organophosphor hydrolytic enzyme gene compatible with suicide plasmid in intestinal bacteria, screening obtains.This genetic engineering bacterium not only has the degradation of pesticide activity; Can be used for residual chemical pesticide degraded in the environment; And have the red fluorescence characteristic and can make it in environment, be prone to it is found that; Also have simultaneously and can induce the mechanism of suicide can let application person artificially control its extinction in environment, have broad application prospects according to practical situation.
Description of drawings
Below, specify embodiment of the present invention in conjunction with accompanying drawing, wherein:
Figure 1A is the plasmid construction figure of double gene expression plasmid pL-DsRed-pL-OPH provided by the present invention;
Figure 1B is the plasmid map of double gene expression plasmid pL-DsRed-pL-OPH provided by the present invention;
Fig. 1 C is the plasmid map of inducibility suicide plasmid pDS provided by the present invention;
Fig. 1 D is the plasmid construction figure of the plasmid map of inducibility suicide plasmid pDS provided by the present invention;
Fig. 2 is double gene expression plasmid pL-DsRed-pL-OPH Transformed E .coliBL21AI provided by the present invention
TMBacterial strain is cloned in the picture (magnification 10 of observing under the fluorescent microscope
* 4), wherein A is for transforming bacterial strain, and B is unconverted bacterial strain;
Fig. 3 is double gene expression plasmid pL-DsRed-pL-OPH Transformed E .coliBL21AI provided by the present invention
TMBacterial strain is cloned in the direct viewing picture under the daylight, and wherein A is for transforming bacterial strain, and B is unconverted bacterial strain;
Fig. 4 is the pcr amplified fragment electrophorogram of egfp gene fragment of the present invention;
Fig. 5 cuts the evaluation electrophorogram for the enzyme of pGEM-T-EGFP carrier of the present invention, and wherein restriction enzyme site is EcoR I+BamH I;
Fig. 6 identifies electrophorogram for the PCR of pBV-EGFP carrier of the present invention, and wherein 1 is egfp gene fragment/pBV-EGFP, and 2 is egfp gene fragment/pEGFP-N3;
Fig. 7 is the pcr amplified fragment electrophorogram of pL-EGFP of the present invention;
Fig. 8 cuts the evaluation electrophorogram for the enzyme of pL-EGFP carrier of the present invention, and wherein 1 is restriction enzyme site EcoR I+BamH I, and 2 is restriction enzyme site EcoR I;
Fig. 9 is the pcr amplified fragment electrophorogram of dsred of the present invention;
Figure 10 cuts the evaluation electrophorogram for the enzyme of pGEM-T-DsRed carrier of the present invention, and wherein restriction enzyme site is EcoR I+BamH I;
Figure 11 is the PCR checking electrophorogram of pL-DsRed carrier of the present invention, and wherein 1 is dsred fragment/pDsRed-N1, and 2 is dsred fragment/pL-DsRed;
Figure 12 cuts the evaluation electrophorogram for the enzyme of pL-DsRed carrier of the present invention, and wherein 1 is restriction enzyme site EcoR I+BamH I, and 2 is restriction enzyme site EcoR I;
Figure 13 is the pcr amplification electrophorogram of opd of the present invention;
Figure 14 cuts the evaluation electrophorogram for the enzyme of pGEM-T-OPH carrier of the present invention, and wherein restriction enzyme site is Hind III+Xho I;
Figure 15 is the PCR checking electrophorogram of pL-OPH carrier of the present invention, and wherein 1 is opd gene fragment/pGEM-T-opd, and 2 is opd gene fragment/pL-OPH;
Figure 16 cuts the evaluation electrophorogram for the enzyme of pL-OPH carrier of the present invention, and wherein 1 is restriction enzyme site BamH I, and 2 is restriction enzyme site Pst I+BamH I;
Figure 17 is the segmental pcr amplification electrophorogram of pL-DsRed of the present invention;
Figure 18 is the segmental pcr amplification electrophorogram of Promoter-OPH-terminator of the present invention;
Figure 19 is the PCR checking electrophorogram of pL-DsRed-pL-OPH carrier of the present invention, and wherein 1 is dsred and opd gene fragment/pL-DsRed-pL-OPH, and 2 is opd gene fragment/pGEM-T-opd, and 3 is dsred gene fragment/pDsRed-N1;
Figure 20 cuts the evaluation electrophorogram for the enzyme of pL-DsRed-pL-OPH carrier of the present invention, and wherein 1 is restriction enzyme site Nco I, and 2 is restriction enzyme site Sac I;
Figure 21 removes the pcr amplification of the Serratia marcescens nuclease gene nuc of leader peptide sequences for the present invention, and wherein 1 is nuc gene PCR amplified fragments, and M is Marker;
Figure 22 A is the pcr amplification electrophorogram of pET-Nuclease carrier of the present invention, and wherein 1 for being the nuc PCR fragment of template amplification with pAH12, and 2 for being the nuc PCR fragment of template amplification with pET-Nuclease, and M is Marker;
Figure 22 B cuts the checking electrophorogram for the enzyme of pET-Nuclease carrier of the present invention, wherein 1 be pET-28b through Xho I single endonuclease digestion linear fragment, 2 be pET-Nuclease through Xho I single endonuclease digestion linear fragment, M is Marker;
Figure 23 is p15A of the present invention and the segmental pcr amplification electrophorogram of Kanamycine-Nuclease-T7, and wherein 1 is the pcr amplified fragment of p15A, and 2 is the pcr amplified fragment of Kanamycine-Nuclease-T7, and M is Marker;
Figure 24 cuts the evaluation electrophorogram for the enzyme of pGEM-T-p15A carrier of the present invention, and wherein 1 is pGEM-T-p15A fragment behind Pst I and Nde I double digestion, and M is Mark;
Figure 25 A is the pcr amplification electrophorogram of pSS carrier of the present invention, and wherein 1 for being the p15A PCR fragment of template amplification with pSS, and 2 for being the p15A PCR fragment of template amplification with pLysS, and M is Marker;
Figure 25 B cuts the evaluation electrophorogram for pSS carrier enzyme of the present invention, wherein 1 be pSS through Pst I single endonuclease digestion linear fragment, M is Marker;
Figure 26 is the pcr amplification electrophorogram of Nuclease-T7 of the present invention, and wherein 1 is the pcr amplified fragment of Nuclease-T7, and M is Marker;
Figure 27 cuts the evaluation electrophorogram for the enzyme of pGEM-T-Nuclease-T7 of the present invention, and wherein 1 is pGEM-T-Nuclease-T7 fragment behind BamH I and Pst I double digestion, and M is Marker;
Figure 28 cuts the evaluation electrophorogram for the enzyme of pDS carrier of the present invention, wherein 1 be PDS through Pst I single endonuclease digestion fragment, M is Marker;
Figure 29 A and Figure 29 B are respectively GEB-SRO bacterium of the present invention and cultivate 14h and place the bacterium liquid density measurement value in the 9d process.
Figure 30 A and Figure 30 B are respectively GEB-SRO bacterium of the present invention and cultivate 14h and place the bacterium liquid fluorescent strength determining value in the 9d process.
Figure 31 be under the fluorescent microscope under (A and B) and the daylight (C and D) observe the fluoroscopic examination figure of GEB-SRO bacterium and common bacterium bacterium colony.
Figure 32 is that the GEB-SRO bacterium provided by the invention mechanism of committing suiside starts growth curve.
Figure 33 is GEB-SRO bacterium suicide effect flat-plate experimental result figure provided by the invention.
Figure 34 is the typical curve of p-NP provided by the invention.
Embodiment
The concrete embodiment of following reference explains the present invention.It will be appreciated by those skilled in the art that these embodiment only are used to explain the present invention, the scope that it does not limit the present invention in any way.
Employed technology in following examples comprises that PCR, enzyme cut the equimolecular biological means, and strain culturing, conversion, detection technique etc., unless stated otherwise, is routine techniques known to those skilled in the art; Employed plant and instrument, reagent, bacterial strain etc., only this specification sheets specifies, what the research that is this area and technician can be through public approach acquisitions.
Below related concrete experimental implementation method is in this explanation as follows among each embodiment:
1, the preparation of 50 μ LPCR amplification systems is following:
TV 50 μ L contain 0.1～10ng plasmid, and 1 * PCR damping fluid (contains Mg
2+), each 0.8 μ mol/L of upstream and downstream primer, 0.2mmol/LdNTP, 2.5UDNA polysaccharase.
2, agarose gel electrophoresis; Concrete grammar is with reference to " molecular cloning " (third edition) SambrookJ, Russell DW (2001) Molecular cloning:A Laboratory Manual.Cold SpringHarbor Laboratory Press, Cold Spring Harbor; New York; Adopt the TAE electrophoretic buffer, the ethidium bromide staining mark, tetrabromophenol sulfonphthalein is an indicator.
3, the dna gel purifying and recovering adopts dna gel purifying and recovering test kit (available from Beijing ancient cooking vessel state Bioisystech Co., Ltd), and concrete operations are following:
1) will not have PCR reaction solution or the endonuclease reaction liquid electrophoresis on 1% plain agar sugar gel of Yellow Protopet 2A, and will downcut required DNA band and pack in the 1.5mL centrifuge tube, adding solution A (glue heavy/liquor capacity=1/3).
2) 50 ℃ are incubated 10 minutes, put upside down mixing 1 time, sepharose is melted fully in per 2 minutes.Wait to dissolve rearmounted room temperature and add 15 μ L solution B, fully mixing.
3) will mix liquid and be transferred to centrifugal post, leave standstill 2 minutes, 12000r/ minute centrifugal 30 seconds, outwell the waste liquid in the collection tube.
4) add 500 μ L solution C in centrifugal post, 12000r/ minute centrifugal 30 seconds, outwell the waste liquid in the collection tube.
5) repeating step 4) once.
6) 12000r/ minute centrifugal 1 minute, dry remaining liq to remove residual alcohol.
7) the centrifugal purification column sleeve is gone in the clean 1.5mL centrifuge tube, uncap and placed 5～10 minutes, ethanol is fully volatilized totally.
8) add 20～30 μ L solution D (or sterilization deionized water), leave standstill 2 minutes after, 12000r/ minute is centrifugal 30 seconds.Liquid in the centrifuge tube promptly is the dna fragmentation of purifying, gets 4 μ L electrophoresis (0.8% agarose, 120V, 10 minutes) and detects and estimate quantitatively.-20 ℃ of preservations are subsequent use.
4, the T/A cloning process is following:
The PCR product adds the A reaction after reclaiming the test kit recovery with dna gel, contains 6 μ LPCR in the 10 μ L systems and reclaims fragment; 1 * PCR damping fluid, 0.8mmol/L dNTP, 0.5U TaqDNA polysaccharase; 72 ℃ are moved 20 minutes on the PCR appearance, directly get reaction solution then and are connected with the T carrier.Linked system 10 μ L comprise 5 μ L, 2 * damping fluid, 1 μ LT carrier DNA (50ng), and 2 μ L add the A fragment, 1 μ LT 4DNA ligase enzyme, 4 ℃ of connections are spent the night.Get 5 μ L and connect product and join among the 100 μ L competence bacterium TOP 10, ice bath 30 minutes, 42 ℃ of thermal shocks 90 seconds; Placed on ice immediately 3 minutes, and added 950 μ L liquid LB substratum, behind 37 ℃ of shaking culture 1h; Centrifugal 1 minute of 5000g abandons top nutrient solution, keeps 150 μ L nutrient solution suspension thalline; Be uniformly coated on the LB flat board that contains IPTG/X-β-gal/ penbritin, be inverted flat board and after 16～20 hours, flat board placed 1～2 hour in 4 ℃ in 37 ℃ of cultivations; It is clear that blueness is manifested, and the picking white colony shakes the dientification of bacteria.
5, preparation of ETEC competent cell (Calcium Chloride Method) and method for transformation are with reference to " molecular cloning " (third edition) Sambrook J; Russell DW (2001) Molecular cloning:ALaboratory Manual.Cold Spring Harbor Laboratory Press; Cold Spring Harbor; New York, concrete operations are following:
1) (diameter 2～3mm) forwards in the 1L flask that contains 100mL LB substratum to cultivate 16～20 hours the fresh flat board single bacterium colony of picking from 37 ℃.Cultivated about 3 hours in 37 ℃ of shaken.For effectively being transformed, viable count should not surpass 10
8Individual/mL, can whenever measure the growing state that the OD600 value is monitored culture at a distance from 20～30 minutes, treat that bacterium liquid OD600 reaches at 0.35 o'clock and begins to gather in the crops bacterial cultures.
2) under aseptic condition, bacterium is transferred in the aseptic PA tube of ice-cold 50mL, placed 10 minutes, make culture be cooled to 0 ℃ on ice.
3) in 4 ℃ with SorvallGS3 rotary head (or rotary head suitable) with it with 4100r/ minute centrifugal 10 minutes, to reclaim cell.
4) pour out nutrient solution, pipe was inverted 1 minute so that the trace nutrient solution of final residual flows to end.
5) every 50mL initial incubation thing is with the 0.1mol/L CaCl of 30mL precooling
2-MgCl
2Solution is resuspended.
6) in 4 ℃ with 4100r/ minute centrifugal 10 minutes, reclaim cell.
7) pour out supernatant, pipe was inverted 1 minute so that the liquid of final residual flows to end.
8) every 50mL initial incubation thing is with the 0.1mol/LCaCl of 2mL precooling
2Suspend.
9) from the competent cell suspension, get 200 μ L with the aseptic suction nozzle of refrigerative and transfer in the aseptic Eppendorf tube, add DNA (volume is less than 10 μ L, and dna content is less than 50ng), rotate gently, in ice, placed 30 minutes with the mixing content.
10) pipe is put into 90 seconds (not shaking) of placement in the circulator bath that is warmed to 42 ℃ in advance therebetween.
11) fast pipe is transferred in the ice bath, made cell cooling 1～2 minute.
12) Xiang Guanzhong adds 800 μ LLB substratum, then pipe is transferred on 37 ℃ of shaking tables gentleness and shakes (rotating speed is no more than 225r/ minute), and incubation made bacteria resuscitation in 45 minutes, and the antibiotics resistance marker gene of expression plasmid coding.
13) centrifugal concentrating cells is used an amount of LB re-suspended cell gently then, and the competent cell that proper volume (each 90mm flat board can reach 200 μ L) has been transformed is transferred to and contained on the corresponding antibiotic LB nutrient agar.
14) place room temperature to be absorbed flat board until liquid.Be inverted plate,, bacterium colony can occur after 12～16 hours in 37 ℃ of cultivations.
6, a small amount of of plasmid is extracted (SDS alkaline lysis) method with reference to " molecular cloning " (third edition) Sambrook J; Russell DW (2001) Molecular cloning:A Laboratory Manual.Cold Spring Harbor Laboratory Press; Cold Spring Harbor; New York, concrete operations are following:
1) the mono-clonal bacterium colony of choosing after the conversion contains in the antibiotic LB substratum (50 μ g/L microbiotic) in 37 ℃ of shaken overnight cultures in 3mL.
2) the 1.5mL culture is poured in the Eppendorf tube, with Eppendorf centrifuge in 4 ℃ with 12000g centrifugal 30 seconds, abandon supernatant, make bacterial precipitation dry as far as possible.
3) the gained bacterial precipitation is resuspended in the solution I (solution composition is: 25mmol/LTris-HCl (pH8.0), 10mmol/L EDTA, 50mmol/L glucose) of 100 μ L precoolings, thermal agitation disperses bacterial precipitation fully in solution I.
4) add the new preparation of 200 μ L solution II (solution composition is: 200mmol/L NaOH, 1%SDS), cover the tight mouth of pipe, put upside down centrifuge tube fast 5 times, centrifuge tube is positioned on ice.
5) (solution composition is: 3mol/L Potassium ethanoate (KAc) damping fluid to add the solution III of 150 μ L precoolings; PH 4.8), cover the tight mouth of pipe, will manage and leniently vibrate 10 seconds after being inverted; Solution III is uniformly dispersed in the heavy-gravity bacterial lysate, afterwards pipe was placed 3～5 minutes on ice.
6) with Eppendorf centrifuge in 4 ℃, centrifugal 5 minutes kinds of 12000g are transferred to supernatant in another centrifuge tube.
7) absolute ethyl alcohol of 2 times of volumes of adding, vibration mixes, and places 30 minutes in-20 ℃.With Eppendorf centrifuge in 4 ℃ with 12000g centrifugal 10 minutes.
8) the careful suction removed supernatant, centrifuge tube is inverted on a piece of paper towel, so that all liquid flows out.The drop that will invest tube wall again eliminates.
9) with 1mL 70% washing with alcohol deposition, set by step 8) said method is removed supernatant, in air, makes dry 8 minutes of nucleic acid deposition.
10) add the sterilization deionized water dissolving deposition that 40 μ L contain 20 μ g/mL RNaseA ,-20 ℃ of preservations are put in 37 ℃ of insulations after 30 minutes subsequent use.
7, endonuclease reaction
The single endonuclease digestion reaction system: TV 20 μ L, the about 500ng of plasmid or dna fragmentation, restriction endonuclease 1 μ L, 10 * damping fluid, 2 μ L supply volume to 20 μ L with the sterilization deionized water.37 ℃ of insulations 4 hours are got 5 μ L enzymes and are cut product and carry out electrophoresis and identify, continue endonuclease reaction and cut entirely until enzyme.
The double digestion reaction system: TV 20 μ L, the about 500 μ g of plasmid or dna fragmentation, two kinds of each 0.8 μ L of restriction endonuclease, 10 * damping fluid, 2 μ L supply volume to 20 μ L with the sterilization deionized water.37 ℃ of insulation 4h get 5 μ L enzymes and cut product and carry out electrophoresis and identify, continue endonuclease reaction and cut entirely until enzyme.
Embodiment 1: the structure of carrier pL-EGFP
Present embodiment is the structure of carrier pL-EGFP; Comprise the pcr amplification that carries out the EGFP gene fragment earlier and clone, construct carrier pBV-EGFP then; After amplifying pL-EGFP fragment wherein, finally construct carrier pL-EGFP, details are as follows for concrete operation steps:
(1) pcr amplification of EGFP gene fragment and T/A clone
1. the pcr amplification of egfp gene fragment: with pEGFP-N3 (Clotech company) is template, amplification egfp gene fragment, 717bp.Adopt pfuDNA polysaccharase (Promega company); Amplification system 50 μ L; The upstream primer sequence is 5 '-GGGAATTCATGGTGAGCAAGGGCGAGGAGCT (EcoR I); The downstream primer sequence is 5 '-TTGGATCCCTTGTACAGCTCGTCCATGCCGAG (BamH I), and the pcr amplification parameter is set to: 94 ℃ of preparatory sex change 3 minutes; 94 ℃, 30 seconds/68 ℃ 80 seconds (25 circulations); 72 ℃ 10 minutes.Amplified fragments carry out agarose gel electrophoresis, the result is as shown in Figure 4;
2. the purifying and recovering of egfp gene fragment: adopt the agarose gel electrophoresis purifying also to reclaim the egfp gene fragment;
3. make up plasmid pGEM-T-EGFP: after the egfp gene fragment that reclaims is added the A reaction, be connected structure plasmid pGEM-T-EGFP (working instructions of Promega company are seen in the concrete operations that add A reaction and connection) with pGEM-TEasy carrier (Promega company);
4. enzyme is cut evaluation: adopt EcoR I and BamH I double digestion plasmid pGEM-T-EGFP can obtain the egfp fragment, enzyme is cut and is identified that electrophoresis result is as shown in Figure 5.
(2) structure of carrier pBV-EGFP
1. enzyme is cut processing: the purified product of plasmid pBV 220 (Inst. of Viruses, China Preventive Medicine Science Academy) and pGEM-T-EGFP is handled through EcoR I and BamH I double digestion respectively, and purifying purpose band is reclaimed in gel electrophoresis;
2. make up plasmid pBV-EGFP: linked system 25 μ L; Comprise 2.5 μ L, 10 * T4DNA ligase enzyme damping fluid, the 100ng enzyme is cut the recovery fragment behind pBV 220 carriers, and the 100ng enzyme is cut the recovery fragment behind the pGEM-T-EGFP; 1 μ LT4DNA ligase enzyme, 16 ℃ connect 20 hours.
3. transform plasmid pBV-EGFP: with connecting product Transformed E .coli DH 5 α (available from sky, Beijing root company), be coated on the LB agar plate that contains penbritin (50 μ g/mL, down together), 37 ℃ of incubated overnight.Choose mono-clonal bacterium colony (volume 5mL, down together) in the liquid LB that contains penbritin, 37 ℃ of following 200～250r/ minute incubated overnight.
4. identify: get 1.5mL bacterium liquid and carry out plasmid and extract in a small amount, 25 times of former plasmids of dilution can amplify the egfp gene fragment as pcr template through the PCR checking, and electrophoresis result is as shown in Figure 6, and wherein 1 is pBV-EGFP, and 2 is pEGFP-N3.Electrophoresis result proof gained plasmid is purpose plasmid pBV-EGFP.
(3) structure of carrier pL-EGFP
1. the segmental pcr amplification of pL-EGFP: with pBV-EGFP is template, adopts pcr amplification pL-EGFP fragment, 3624bp.Adopt the pfuDNA polysaccharase, amplification system 50 μ L, the upstream primer sequence is 5 '-TTC
GAGCTCCGTGCGTGTTGACTATTTTACCT (Sac I), the downstream primer sequence is 5 '-GC
TCTAGATCGGCAAGGTGTTCTGGTC (Xba I), the pcr amplification parameter is set to: 94 ℃ of preparatory sex change 3 minutes; 94 ℃, 40 seconds/56 ℃, 35 seconds/72 ℃, 6 minutes 10 seconds (25 circulations); 72 ℃, 10 minutes.The electrophoresis result of amplified fragments is as shown in Figure 7;
2. the segmental purifying and recovering of pL-EGFP: utilize dna gel to reclaim the pL-EGFP fragment that test kit reclaims the purifying pcr amplification;
3. the segmental phosphorylation of pL-EGFP connects and transforms:
1) phosphorylation: utilize T4 polynucleotide kinase (available from Dalian Bao Bio-Engineering Company) phosphorylation PCR product pL-EGFP fragment terminal; Press following system configurations reaction tubes: the about 25pmol/L of PCR product fragment; 5 μ L, 10 * T4 polynucleotide kinase damping fluid; 1 μ L 10mmol/LATP, 1 μ LT4 polynucleotide kinase replenishes volume to 50 μ L with the sterilization deionized water.37 ℃, reacted 30 minutes.65 ℃ then, 20 minutes deactivation polynucleotide kinases.Phenol-chloroform extracting 2 times;
2) connect: carry out recirculation and connect; System is following: the PCR product 100ng of phosphorylation, 1 μ L10 * T4DNA ligase enzyme damping fluid, 0.5 μ LT4DNA ligase enzyme (available from Dalian Bao Bio-Engineering Company); 1.5 μ L30%PEG8000, water supply volume to 10 μ L.16 ℃, reacted 20 hours;
3) transform and identify: get 8 μ L and connect product Transformed E .coli DH5 α, be coated on the LB agar plate that contains penbritin, 28 ℃ of incubated overnight.The picking mono-clonal goes into to contain in the liquid LB substratum of penbritin, in 28 ℃ of incubated overnight.Next day, get bacterium liquid 1mL centrifugation thalline, the thalline color appear being of obvious green the thalline that will clone; Extract plasmid, and carry out enzyme with EcoR I and BamH I and cut evaluation, the gained stripe size is consistent with expection; Electrophoresis result is as shown in Figure 8; Wherein 1 is restriction enzyme site EcoR I+BamH I, and 2 is restriction enzyme site EcoR I, and the success of pL-EGFP plasmid construction is described.
Embodiment 2: the structure of double gene expression plasmid pL-DsRed-pL-OPH
Present embodiment is the structure of double gene expression plasmid pL-DsRed-pL-OPH; After comprising that elder generation makes up and amplify plasmid pL-DsRed and plasmid pL-OPH respectively; Connect and construct double gene expression plasmid pL-DsRed-pL-OPH; Its plasmid construction figure is shown in Figure 1A, and corresponding plasmid map is shown in Figure 1B, and details are as follows for concrete operation steps:
(1) structure of plasmid pL-DsRed
1. the pcr amplification of DsRed gene fragment and T/A clone: with pDsRed-N1 (available from Clontech company) be template, the DsRed gene fragment that increases, its base sequence shown in SEQ.ID.NO3,690bp.Adopt the pfuDNA polysaccharase, amplification system 50 μ L, the pcr amplification parameter is set to: 94 ℃ of preparatory sex change 3 minutes; 94 ℃, 30 seconds/57 ℃, 30 seconds/72 ℃, 90 seconds (25 circulations); 72 ℃, 10 minutes.The electrophoresis result of amplified fragments, as shown in Figure 9; The upstream primer sequence is 5 '-G
GAATTCATGGTGCGCTCCTCCAAGA (EcoR I), the downstream primer sequence is 5 '-CG
GGATCCCTCATTACTACAGGAACAGGTGGTGGC (BamH I);
2. the purifying and recovering of DsRed gene fragment: the DsRed gene fragment of electrophoresis purifying and recovering PCR electrophoresis amplification;
3. the structure of plasmid pGEM-T-DsRed: add A reaction back and be connected structure plasmid pGEM-T-DsRed with the pGEM-TEasy carrier;
4. enzyme is cut evaluation: the plasmid pGEM-T-DsRed that utilizes EcoR I and BamH I double digestion to make up, enzyme cut and identify that electrophoresis result is shown in figure 10.
5. the structure of plasmid pL-DsRed:
1) enzyme is cut processing: adopt EcoR I and BamH I double digestion to handle pGEM-T-DsRed and pL-EGFP;
2) purifying and recovering: gel electrophoresis purifying and recovering purpose band;
3) make up the pL-DsRed carrier: connect;
4) checking: utilize pcr amplification DsRed gene to verify that electrophoresis result is shown in figure 11, wherein 1 is pDsRed-N1, and 2 is pL-DsRed; Utilizing EcoR I and BamH I to carry out double digestion simultaneously identifies; It is thus clear that double digestion can cut out DsRed gene fragment (690bp); EcoR I single endonuclease digestion gained linearizing band also with the expection consistent (3615bp); Electrophoresis result is shown in figure 12, and wherein 1 is restriction enzyme site EcoR I+BamH I, and 2 is restriction enzyme site EcoR I.
(2) structure of plasmid pL-OPH
1. the pcr amplification of OPH gene fragment and T/A clone: with plasmid pGEM-T-opd (zooscopy institute of the Chinese Academy of Sciences) is the gene opd of template amplification OPH, its base sequence shown in SEQ.ID.NO 4,1098bp.Adopt the pfuDNA polysaccharase, amplification system 50 μ L, the pcr amplification parameter is set to: 94 ℃ of preparatory sex change 3 minutes; 94 ℃, 30 seconds/57 ℃, 35 seconds/72 ℃, 2 minutes (25 circulations); 72 ℃, 10 minutes.The electrophoresis result of amplified fragments is shown in figure 13;
2. the purifying and recovering of opd gene fragment: the opd gene fragment of electrophoresis purifying and recovering PCR electrophoresis amplification;
3. the structure of plasmid pGEM-T-OPH: add A reaction back and be connected structure plasmid pGEM-T-OPH with the pGEM-TEasy carrier;
4. enzyme is cut evaluation: the plasmid pGEM-T-OPH that utilizes BamH I and Pst I double digestion to make up, enzyme cut and identify that electrophoresis result is shown in figure 14.
5. the structure of plasmid pL-OPH
1) enzyme is cut processing: adopt BamH I and Pst I double digestion to handle pGEM-T-OPH and carrier pBV 220;
2) purifying and recovering: gel electrophoresis purifying and recovering purpose band opd;
3) make up the pBV-OPH carrier: connect;
4) make up the pL-OPH carrier: cut out the opd gene with EcoR I and Pst I double digestion processing pBV-OPH, be connected structure pL-OPH carrier with carrier pL-EGFP with EcoR I and Pst I double digestion;
5) checking: utilize pcr amplification opd gene to verify that electrophoresis result is shown in figure 15, wherein 1 is pGEM-T-opd, and 2 is pL-OPH; Utilize EcoR I and Pst I to carry out double digestion simultaneously and identify that electrophoresis result is shown in figure 16, wherein 1 is restriction enzyme site BamH I, and 2 is restriction enzyme site Pst I+BamH I.
(3) structure of double gene expression plasmid pL-DsRed-pL-OPH
1. the segmental pcr amplification of pL-DsRed fragment and Promoter-OPH-terminator
1) the segmental pcr amplification of pL-DsRed: with pL-DsRed is that template adopts pcr amplification pL-DsRed fragment, 3615bp.Adopt the pfuDNA polysaccharase, amplification system 50 μ L, the pcr amplification parameter is set to: 94 ℃ of preparatory sex change 3 minutes; 94 ℃, 40 seconds/56 ℃, 35 seconds/72 ℃, 6 minutes 10 seconds (25 circulations); 72 ℃, 10 minutes.Electrophoresis result is shown in figure 17.
2) the segmental pcr amplification of Promoter-OPH-terminator: with pL-OPH is that template adopts pcr amplification Promoter-OPH-terminator fragment, 2002bp.Adopt the pfuDNA polysaccharase, amplification system 50 μ L, the pcr amplification parameter is set to: 94 ℃ of preparatory sex change 3 minutes; 94 ℃, 40 seconds/53 ℃, 35 seconds/72 ℃, 4 minutes 30 seconds (25 circulations); 72 ℃, 10 minutes.Electrophoresis result is shown in figure 18.
2. the structure of double gene expression plasmid pL-DsRed-pL-OPH
1) purifying and recovering: utilize dna gel to reclaim test kit and reclaim purifying pL-DsRed and Promoter-OPH-terminatorPCR amplified fragments;
2) phosphorylation: utilize T4 polynucleotide kinase phosphorylation Promoter-OPH-terminator fragment terminal.Press following system configurations reaction tubes: the about 25pmol/L of PCR product fragment, 5 μ L10 * T4 polynucleotide kinase damping fluid, 1 μ L 10mmol/LATP, 1 μ L T4 polynucleotide kinase replenishes volume to 50 μ L with the sterilization deionized water.37 ℃, reacted 30 minutes.65 ℃ then, 20 minutes deactivation polynucleotide kinases.Phenol-chloroform extracting 2 times.
3) connect: the system that connects is following: pL-DsRed fragment purification product 100ng; Phosphorylation Promoter-OPH-terminator fragment 100ng, 1 μ L, 10 * T4DNA ligase enzyme damping fluid, 0.5 μ L T4DNA ligase enzyme; 1.5 μ L 30%PEG8000, water supply volume to 10 μ L.16 ℃, reaction 20h.
4) transform and identify: get 8 μ L and connect product Transformed E .coli DH 5 α, be coated on the LB agar plate that contains penbritin, 28 ℃ of incubated overnight.Choose the mono-clonal bacterium colony and contain 28 ℃ of 200～250r/ minute incubated overnight among the liquid LB of penbritin in 3mL.Get 1.5mL bacterium liquid and carry out plasmid and extract in a small amount, 25 times of former plasmids of dilution are as pcr template, the DsRed gene fragment that increases simultaneously and opd gene fragment; Carry out the PCR checking, electrophoresis result is shown in figure 19, and wherein 1 is pL-DsRed-pL-OPH; 2 is pGEM-T-opd, and 3 is pDsRed-N1; Utilize Sac I and Nco I to carry out the single endonuclease digestion checking respectively, electrophoresis result is shown in figure 20, and wherein 1 is restriction enzyme site Nco I, and 2 is restriction enzyme site Sac I.
Embodiment 3: the structure of inducibility suicide plasmid pDS
Present embodiment is the structure of the property led suicide plasmid pDS; Can be referring to document Li Q; Wu YJ.Afluorescent genetically engineered micro-organism that degradesorganophosphates and commits suicide when required.Applied Microbiologyand Biotechnology.2009; 82 (4): 749-756, details are as follows at this.
(1) structure of the two copy of suicide gene plasmid pDS
1. primer design is with synthetic
The design primer is that the Serratia marcescens nuclease gene nuc of template amplification removal leader peptide sequences inserts formation pET-Nuclease in T7 promotor downstream in the pET-28b carrier with pAH12; Designing primer again is that template amplification contains kalamycin resistance gene with pET-Nuclease; The fragment of Serratia nuclease gene and T7 promotor; This fragment and the fragment that contains p15A replicon sequence that with pLysS is template amplification are connected to form the suicide plasmid pSS that contains single copy suicide gene; Design second copy that primer amplification contains the fragment insertion pSS formation suicide gene of T7 promotor and suicide gene again, formation contains the two suicide plasmid pDS that copy of suicide gene.
2. the structure of carrier pET-Nuclease
1) the segmental pcr amplification of suicide gene
With plasmid pAH12 (German Oldenburg university give) is the Serratia marcescens nuclease gene nuc (741bp) that template amplification is removed leader peptide sequences; Adopt the pfu archaeal dna polymerase; Amplification system 50 μ L; Upstream primer sequence: 5 '-CATGCCATGGCAGCCGACACGCTCGAATCCAT (Nco I), downstream primer sequence: 5 '-CCGCTCGAGTCAGTTTTTGCAGCCCATCAACT (Xho I).The pcr amplification parameter is set to: 94 ℃ of preparatory sex change 3min; 94 ℃, 40s/68 ℃, 90s (25 circulations); 72 ℃, 10min.Amplified fragments carries out agarose gel electrophoresis, and the result is shown in figure 21, and is visible, and nuc gene PCR amplified fragments size is consistent with expection.
2) structure of carrier pET-Nuclease
The PCR purified product of carrier pET-28b (Novagen company) and nuclease gene nuc is handled through Nco I and Xho I double digestion respectively; Utilize dna gel to reclaim test kit (available from Beijing ancient cooking vessel state Bioisystech Co., Ltd) and reclaim purifying purpose band, carry out ligation, connect product Transformed E .coliDH5 α; Coat the LB agar plate and (contain kantlex 50 μ g/mL; Down except, the person of specializing), 37 ℃ of incubated overnight.Choose mono-clonal bacterium colony (volume 5mL contains kantlex, down except, the person of specializing) in liquid LB, 37 ℃ of 200～250r/min incubated overnight.Get 1.5mL bacterium liquid and carry out plasmid and extract in a small amount, 25 times of former plasmids of dilution are as pcr template, amplification nuc fragment; Carrying out PCR identifies; Amplified fragments carries out agarose gel electrophoresis, and the result is shown in Figure 22 A, and visible is that template can amplify the nuc fragment with pET-Nuclease.Utilizing restriction endonuclease Xho I that institute's upgrading grain is carried out single endonuclease digestion simultaneously identifies; Enzyme is cut and is identified that electrophoresis result is shown in Figure 22 B; It is thus clear that, with Xho I it being carried out single endonuclease digestion and obtain and expect consistent linear fragment (5980bp), PCR and enzyme are cut checking explanation carrier pET-Nuclease and are made up successfully.
3. the suicide gene list copies the structure of plasmid pSS
1) segmental pcr amplification of Kan-Nuclease-T7 fragment and p15A and T/A clone
With plasmid pET-Nuclease is that template amplification contains kalamycin resistance gene; The fragment Kan-Nuclease-T7 of Serratia nuclease gene and T7 promotor; Adopt the pfu archaeal dna polymerase; Amplification system 50 μ L, upstream primer sequence: 5 '-AACTGCAGAACTACGGCTACACTAGAAGGACAG (Pst I), downstream primer sequence: 5 '-GGAATTCCATATGGTAGTAGGTTGAGGCCGTTGAG (Nde I).The pcr amplification parameter is set to: 94 ℃ of preparatory sex change 3min; 94 ℃, 40s/57 ℃, 35s/72 ℃, 5min 30s (25 circulations); 72 ℃, 10min.Amplified fragments carries out agarose gel electrophoresis, and the result is shown in figure 23, visible amplified fragments size and expection consistent (2934bp).
With pLysS is the fragment p15A that template amplification contains p15A replicon sequence; Adopt the ExTaq archaeal dna polymerase; Amplification system 50 μ L, upstream primer sequence: 5 '-AACTGCAGAACCAATGGCATTGCGGATCCCCTTAGCTCCTGAAAATCTCGATA (Pst I-BamHI) downstream primer sequence: 5 '-GGAATTCCATATGATAGTGACTGGCGATGCTGT (NdeI).The pcr amplification parameter is set to: 94 ℃ of preparatory sex change 3min; 94 ℃, 40s/55 ℃, 35s/72 ℃, 2min (25 circulations); 72 ℃, 10min.Amplified fragments carries out agarose gel electrophoresis, and the result is shown in figure 23, visible amplified fragments size and expection consistent (1529bp)
Electrophoresis purifying and recovering fragment p15A directly is connected structure plasmid pGEM-T-p 15A with pGEM-T Easy carrier (Promega company).Utilize enzyme to cut the evaluation positive colony; Enzyme is cut and identified that electrophoresis result is shown in figure 24, and is visible, and the PCR product of p15A replicon sequence is connected with the T carrier after can cut out the fragment of one section about 1500bp and the fragment about one section about 3000bp behind PstI and the Nde I double digestion; The former is a p15A replicon fragment; The latter is the T carrier that cuts out, and is all consistent with expection, explains that pGEM-T-p15A successfully makes up.
2) structure of suicide gene list copy plasmid pSS
The PCR purified product of fragment Kan-Nuclease-T7 and plasmid pGEM-T-p15A handle through Pst I and Nde I double digestion respectively; Gel electrophoresis is reclaimed the purpose band and is carried out ligation; Connect product Transformed E .coli DH5, be coated on the LB agar plate 37 ℃ of incubated overnight.Choose mono-clonal bacterium colony 37 ℃ of 200～250r/min incubated overnight in liquid LB.Getting 1.5mL bacterium liquid carries out plasmid and extracts in a small amount; 25 times of former plasmids of dilution are as pcr template; Amplification p15A fragment is carried out PCR checking, upstream primer sequence: 5 '-AACTGCAGAACCAATGGCATTGCGGATCCCCTTAGCTCCTGAAAATCTCG ATA (Pst I-BamH I) downstream primer sequence: 5 '-GGAATTCCATATGATAGTGACTGGCGATGCTGT (Nde I).Amplified fragments carries out agarose gel electrophoresis, and the result is shown in Figure 25 A, and visible is that template can amplify p15A fragment (1529bp) with pSS.Utilize Pst I that the extraction plasmid is carried out enzyme simultaneously and cut evaluation, enzyme is cut and is identified electrophoresis result shown in Figure 25 B, fragment that obtains after the visible single endonuclease digestion linearizing and expection consistent (4439bp).PCR and enzyme are cut checking presentation of results pSS and are successfully made up.
4. the structures of the two copy of suicide gene plasmid pDS
1) pcr amplification of fragment Nuclease-T7 and T/A clone
With pET-Nuclease is the Nuclease-T7 fragment that template amplification contains T7 promotor and suicide gene; Adopt the ExTaq archaeal dna polymerase; Amplification system 50 μ L; Upstream primer sequence: 5 '-CGGGATCCCGCTGCGCGTAACCACCACA (BamH I), downstream primer sequence: 5 '-AACTGCAGGTAGTAGGTTGAGGCCGTTGAGCACC (Pst I).The pcr amplification parameter is set to: 94 ℃ of preparatory sex change 3min; 94 ℃, 40s/61 ℃, 35s/72 ℃, 2min (25 circulations); 72 ℃ of 10min.Amplified fragments carries out agarose gel electrophoresis, and the result is shown in figure 26, visible obtain and expects consistent specific amplification fragment (1330bp).Be connected with pGEM-T Easy carrier after the electrophoresis purifying and recovering Nuclease-T7 fragment and make up plasmid pGEM-T-Nuclease-T7.Utilize BamH I and Pst I double digestion to identify.Enzyme is cut and identified that electrophoresis result is shown in figure 27, and is visible, and visible at about 3000bp place have the T carrier segments, and purpose band Nuclease-T7 fragment is arranged between 1000bp and 2000bp.
2) structure of the two copy of suicide gene plasmid pDS
Plasmid pSS and pGEM-T-Nuclease-T7 purified product are handled through Pst I and BamH I double digestion respectively, and the purpose band is reclaimed in gel electrophoresis, carries out ligation, connect product Transformed E .coliDH5, are coated on the LB agar plate 37 ℃ of incubated overnight.Choose mono-clonal bacterium colony 37 ℃ of 200～250r/min incubated overnight in liquid LB.Get 1.5mL bacterium liquid and carry out plasmid and extract in a small amount, utilize Pst I that the extraction plasmid is carried out enzyme and cut evaluation.Enzyme is cut and is identified that electrophoresis result is shown in figure 28, fragment that obtains after the visible single endonuclease digestion linearizing and expection consistent (5732bp).
Embodiment 4: the structure of GEB-SRO bacterium
Present embodiment to thalline, has constructed double gene expression plasmid pL-DsRed-pL-OPH and inducibility suicide plasmid pDS cotransfection to have had suicide mechanism and red fluorescence mark and the active genetic engineering bacterium GEB-SRO of OPH bacterium.Detailed process is following:
Adopt Calcium Chloride Method to prepare E.coli BL21AI
TMExpress bacterium competence, the pL-DsRed-pL-OPH that makes up is transformed into E.coli BL21AI
TMExpress bacterium competence, coat on the LB agar plate that contains penbritin 28 ℃ of incubated overnight.
Next day; Choose mono-clonal and shake bacterium; It is prepared into competence, and pDS is transformed in this competence with the inducibility suicide plasmid, coats to contain on kantlex and the two anti-LB agar plates of penbritin; 28 ℃ of incubated overnight, the mono-clonal of growth is and has suicide mechanism and red fluorescence mark and the active genetic engineering bacterium GEB-SRO of OPH bacterium on the flat board.
Embodiment 5: the detection of the red fluorescence characteristic of GEB-SRO bacterium
Picking is inserted at the mono-clonal of the GEB-SRO bacterium of kantlex and the two LB agar plates growths that resist of penbritin and is contained among kantlex and the two anti-liquid LB of penbritin, in 30 ℃ of jolting overnight cultures.Next day, each bacterium liquid is inoculated in new containing in the corresponding antibiotic liquid LB substratum with 2% ratio respectively, and 30 ℃ of joltings are cultivated, and every separated 2h sampling once until 14h, is statically placed in 30 ℃ with bacterium liquid then, continuous 9d, and take a sample once every day, measures the OD of all samples
600Value and fluorescence intensity level (excitation wavelength 558nm, emission wavelength 583nm, slit width 5nm).Respectively with OD
600With fluorescence intensity level be ordinate zou, be the X-coordinate curve plotting with the incubation time.
Experimental result shows; With the GEB-SRO bacterium be seeded in the LB substratum cultivate 14 hours after, its nectar degree OD600 increases to 1.7795 (seeing Figure 29 A) by initial 0.0933, in this 14h; The fluorescence intensity level of sample has minute differences (40～150, specifically see Figure 30 A).And bacterium liquid was placed 9 days continuously; Bacterium liquid density and the fluorescent value that measure every day show; In bacterium liquid put procedure, bacterium liquid variable density less (seeing Figure 29 B), wide variation have but taken place in the fluorescence intensity of bacterium liquid; The fluorescence intensity of GEB-SRO bacterium bacterium appearance has reached more than 1000 in the time of the 9th day, and the fluorescence intensity of contrast bacterium E.coliBL21AITM is no change (seeing Figure 30 B) almost.
In addition, get the GEB-SRO bacterium sample of cultivating 14h and carry out the flat board experiment.The GEB-SRO bacterium sample of cultivating 14h with the dilution of the LB substratum of antibiotic-free is to OD
600Be 0.2, then this diluent done 200 times of dilutions, get the final diluent of 150 μ L and coat and contain kantlex and the two anti-LB agar plates of penbritin, 30 ℃ of cultivations, simultaneously every day observation plate clone under fluorescent microscope and under the daylight.When the GEB-SRO bacterium is being cultivated on the flat board about about 2d; Specifically shown in figure 31; Under fluorescent microscope, just can observe strong red fluorescence (see A, and B being common bacterium colony contrast), cultivate about about 5d; Just can see with the naked eye that under daylight bacterium colony presents redness (seeing C), obviously is different from common bacterium bacterium colony (seeing D).
Embodiment 6: the detection of the induced suicide ability of GEB-SRO bacterium
Picking goes into to contain among kantlex and the two anti-liquid LB of penbritin, in 30 ℃ of jolting overnight cultures at the mono-clonal of the GEB-SRO bacterium of kantlex and the two LB agar plates growths that resist of penbritin.Next day, each bacterium liquid is inoculated in new containing in the corresponding antibiotic liquid LB substratum with 2% ratio respectively, and 30 ℃ of joltings are cultivated, and treat bacterium liquid OD
600Reach at 0.5～0.8 o'clock, GEB-SRO bacterium bacterium liquid respectively is divided into two parts, one of which adds pectinose inductor (final concentration is 0.01%), and all bacterium liquid all continue to cultivate also every separated 2h sampling once at 30 ℃, until 14h, measure the OD of all samples
600Value, the result is shown in figure 32, show that adding inductor starts suicide mechanism after, the growth of GEB-SRO bacterium is obviously slowed down, behind about 4h, its cessation of growth cessation.
In addition, get the sample of cultivating 14h and carry out the flat board experiment.With the LB substratum dilute induction of antibiotic-free and non-ly induce bacterium appearance to OD
600Be 0.2, then this diluent done 200 times of dilutions, get the final diluent of 150 μ L and coat and contain kantlex or penbritin or contain kantlex and the two LB agar plates that resist of penbritin; 30 ℃ of incubated overnight; Next day, the result saw Figure 33 to the counting of the clone on the flat board, and wherein A is for coating the flat board that contains kantlex and penbritin without the GEB-SRO bacterium of inducing (promptly not starting the mechanism of suicide); It is thus clear that bacterium colony gathers, about 20000 more than the clone; B is for coating the flat board that contains kantlex through the GEB-SRO bacterium of inducing (starting the mechanism of suicide); C is for coating the flat board that contains kantlex and penbritin through the GEB-SRO bacterium of inducing (starting the mechanism of suicide); D is for coating the flat board that contains penbritin through the GEB-SRO bacterium of inducing (starting the mechanism of suicide); It is thus clear that do not have clonal growth containing on kantlex and the two anti-flat board, and 155 ± 38 clones arranged on the flat board that only contains penbritin.
Embodiment 7: the organophosphor hydrolytic enzyme determination of activity of the whole-cell protein liquid of GEB-SRO bacterium
1) mensuration of protein concn
Protein concn adopts the method for Bradford (1976) to measure.
2) making of p-NP typical curve
With 50mmol/L Tris-HCl damping fluid (pH 7.8) p-NP is diluted to 6 concentration gradients (0,30,60,90,120,150mmol/L), measures the absorbance of 400nm respectively, then with OD
400Value is ordinate zou, and p-NP concentration is X-coordinate, drawing standard curve (seeing Figure 34).
3) the OPH determination of activity of transformed bacteria
1. get 30 ℃ of bacterium appearance of cultivating 14h and placement 4d, 8d and prepare whole-cell protein.
2. reaction system: TV 1mL contains 10 μ g whole-cell proteins, the organophosphorus pesticide substrate thiophos of 3 μ L 50mmol/L, mixing in the 50mmol/L Tris-HCl damping fluid (pH 7.8).
3. use spectrophotometric determination OD behind 30 ℃ of reaction 1.5h
400Value, the result sees table 1.
The organophosphor hydrolytic enzyme of the whole-cell protein lysate of table 1GEB-SRO is active
Annotate: TCP:total cell protein whole-cell protein lysate
" 14h " in the table, " 4d " and " 8d " down listed numeral represent respectively 30 ℃ cultivate 14 hours active with the organophosphor hydrolytic enzyme of whole-cell protein sample of bacterium appearance preparation of placing the 4th day, the 8th day.
Claims (10)
1. a genetic engineering bacterium that is used for degrading pesticide is characterized in that, said genetic engineering bacterium comprises: 1) have the active double gene expression plasmid of fluorescent characteristic and degradation of pesticide; With 2) the inducibility suicide plasmid.
2. genetic engineering bacterium according to claim 1 is characterized in that, said double gene expression plasmid has the gene of coding red fluorescent protein and the gene of coding organophosphor hydrolytic enzyme.
3. genetic engineering bacterium according to claim 1 and 2 is characterized in that, said double gene expression plasmid has the plasmid map shown in Figure 1B; Preferably, said double gene expression plasmid has the base sequence shown in SEQ.ID.NO 1.
4. according to each described genetic engineering bacterium in the claim 1 to 4, it is characterized in that said inducibility suicide plasmid has the plasmid map shown in Fig. 1 C; Preferably, said inducibility suicide plasmid has the base sequence shown in SEQ.ID.NO 2.
5. according to each described genetic engineering bacterium in the claim 1 to 5, it is characterized in that said genetically engineered bacteria strain is selected from ETEC and false pseudomonas bacillus, is preferably ETEC.
6. the construction process of each said genetic engineering bacterium in the claim 1 to 5 is characterized in that, said method following steps:
1) structure has fluorescent characteristic and the active double gene expression plasmid of degradation of pesticide;
2) make up the inducibility suicide plasmid;
3) the double gene expression plasmid and the step 2 that step 1) are made up) the inducibility suicide plasmid cotransfection that makes up in bacterial strain, screen, promptly get.
7. the cell liquid culture for preparing by each said genetic engineering bacterium in the claim 1 to 5.
8. the whole-cell protein liquid for preparing by each said genetic engineering bacterium in the claim 1 to 5.
9. the described cell liquid culture of each said genetic engineering bacterium in the claim 1 to 5, or claim 7, or the application of the described whole-cell protein liquid of claim 8 in degrading pesticide.
10. the method for a degrading pesticide is characterized in that, said method adopts each said genetic engineering bacterium in the claim 1 to 6, or the described cell liquid culture of claim 7, or the described whole-cell protein liquid of claim 8 comes degrading pesticide.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105542658A CN102465109A (en) | 2010-11-19 | 2010-11-19 | Genetic engineering strain for degrading farm chemicals and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105542658A CN102465109A (en) | 2010-11-19 | 2010-11-19 | Genetic engineering strain for degrading farm chemicals and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102465109A true CN102465109A (en) | 2012-05-23 |
Family
ID=46069235
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010105542658A Pending CN102465109A (en) | 2010-11-19 | 2010-11-19 | Genetic engineering strain for degrading farm chemicals and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102465109A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112029698A (en) * | 2020-09-14 | 2020-12-04 | 南开大学 | Engineering bacterium for degrading organophosphorus pesticide and construction method thereof |
| CN114774339A (en) * | 2022-04-12 | 2022-07-22 | 深圳大学 | Whole-cell biosensor for detecting p-nitrophenol and detection method |
-
2010
- 2010-11-19 CN CN2010105542658A patent/CN102465109A/en active Pending
Non-Patent Citations (3)
| Title |
|---|
| QIN LI ET AL: "A fluorescent, genetically engineered microorganism that degrades organophosphates and commits suicide when required", 《APPL MICROBIOL BIOTECHNOL》 * |
| 无: "具有自杀控制功能可降解农药的环境安全型基因工程菌研制成功", 《广东农业科学》 * |
| 贾艳华: "红色荧光蛋白基因标记荧光假单胞菌的研究", 《中国优秀硕士学位论文全文数据库》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112029698A (en) * | 2020-09-14 | 2020-12-04 | 南开大学 | Engineering bacterium for degrading organophosphorus pesticide and construction method thereof |
| CN114774339A (en) * | 2022-04-12 | 2022-07-22 | 深圳大学 | Whole-cell biosensor for detecting p-nitrophenol and detection method |
| CN114774339B (en) * | 2022-04-12 | 2023-10-20 | 深圳大学 | Whole-cell biosensor for detecting p-nitrophenol and detection method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Han et al. | Identification of diverse bat alphacoronaviruses and betacoronaviruses in China provides new insights into the evolution and origin of coronavirus-related diseases | |
| Pyrc et al. | Identification of new human coronaviruses | |
| Fu et al. | A novel fish cell line derived from the brain of Chinese perch Siniperca chuatsi: development and characterization | |
| Liu et al. | Virus-induced cell gigantism and asymmetric cell division in archaea | |
| CN104846013B (en) | A kind of 55 type adenovirus vector of replication deficient human and its preparation method and application | |
| Kurhade et al. | Neutralization of Omicron sublineages and Deltacron SARS-CoV-2 by three doses of BNT162b2 vaccine or BA. 1 infection | |
| CN103774241B (en) | Library versus library yeast two-hybrid massive interaction protein screening method | |
| US20210363529A1 (en) | RNAi nano-preparation, preparation method thereof and application thereof in TMV prevention and control | |
| Tang et al. | Identification of the immediate-early genes of cyprinid herpesvirus 2 | |
| CN104762265A (en) | Novel method for obtaining goat-induced multi-potent stem cells | |
| CN105274142B (en) | 55 type adenovirus vector of science recombined human and its preparation method and application | |
| CN102465109A (en) | Genetic engineering strain for degrading farm chemicals and application thereof | |
| Zhou et al. | Establishment of a Chinese sturgeon Acipenser sinensis tail‐fin cell line and its susceptibility to frog iridovirus | |
| Torres et al. | Reporter flaviviruses as tools to demonstrate homologous and heterologous superinfection exclusion | |
| Tarakanov et al. | Ayka, a novel Curtobacterium bacteriophage, provides protection against soybean bacterial wilt and tan spot | |
| CN110358863A (en) | A kind of primer and its application for detecting cucumber mosaic virus passionflower isolate | |
| CN105801680A (en) | Grouper piscidin 4 polypeptide and application thereof | |
| CN105039241A (en) | Pelodiscus sinensis heart cell continuous cell line and establishing method and ultra-low-temperature cryopreservation method thereof | |
| CN101597617A (en) | A kind of high-efficiency transposon system that is used for gram-positive microorganism | |
| CN101921757B (en) | Standard positive reference material for rana grylio virus (RGV) detection | |
| Theodorou et al. | A droplet microfluidics based platform for mining metagenomic libraries for natural compounds | |
| CN101519440B (en) | Intersecting protective vaccine antigen, preparation method and application thereof | |
| Yang et al. | Heat shock 70 kDa protein cognate 3 of brown planthopper is required for survival and suppresses immune response in plants | |
| CN101857902A (en) | Method for screening effective shRNA of lipoprotein lipase gene | |
| Pan et al. | Application of pebrine detection by PCR infected Bombyx mori eggs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20120523 |