CN114774339A

CN114774339A - Whole-cell biosensor for detecting p-nitrophenol and detection method

Info

Publication number: CN114774339A
Application number: CN202210380660.1A
Authority: CN
Inventors: 李猛; 马钊
Original assignee: Shenzhen University
Current assignee: Shenzhen University
Priority date: 2022-04-12
Filing date: 2022-04-12
Publication date: 2022-07-22
Anticipated expiration: 2042-04-12
Also published as: CN114774339B

Abstract

The invention discloses a whole-cell biosensor for detecting p-nitrophenol and a detection method, wherein the whole-cell biosensor for detecting p-nitrophenol comprises a host cell and a pPNP-mrfp plasmid or a pPNP-amilCP plasmid positioned in the host cell, and the nucleotide sequence of the pPNP-mrfp plasmid is shown as SEQ ID NO: 1, the nucleotide sequence of the pPNP-amilCP plasmid is shown as SEQ ID NO: 2, and the physical maps of the pPNP-mrfp plasmid and the pPNP-amilCP plasmid are shown in FIG. 1. When the whole-cell biosensor is used for detecting the extracted state p-nitrophenol in soil, the combination of the p-nitrophenol and the repressor protein pobR eliminates the combination of the pobR and an operator gene site (pobO), the fluorescent protein or chromoprotein gene in the opposite direction is transcribed to generate the fluorescent protein or chromoprotein, and the rapid and high-flux detection of the extracted state p-nitrophenol in the soil is realized by detecting the fluorescence intensity value or the absorbance value.

Description

Whole-cell biosensor for detecting p-nitrophenol and detection method

Technical Field

The invention relates to the technical field of biological detection, in particular to a whole-cell biosensor for detecting p-nitrophenol and a detection method.

Background

Para-nitrophenol is an aromatic compound widely applied to chemical raw materials and drug intermediates, has a long half-life period in a natural environment, poses a threat to the ecological environment and is considered as an environmental endocrine disrupter. At present, various detection means play an important role in the prevention and control work of pollution risk to nitrophenol, such as High Performance Liquid Chromatography (HPLC) and novel rapid detection method (novel nano-material sensor). The existing method cannot directly and timely reflect the comprehensive influence (bioavailability) of various toxic substances on organisms in a complex environment medium. The whole-cell biosensor is used as a microorganism-mediated and environment-friendly pollutant detection method, and has obvious advantages in the aspects of use efficiency and ecological environment protection compared with a chemical detection method.

The whole-cell biosensor based on the method has a place for environmental pollutant detection and ecological toxicity evaluation, has environmental compatibility and potential for in-situ detection, and has attracted extensive attention of researchers. Currently, strains and cell lines of whole cell based biosensors are capable of detecting and reporting information about chemicals and stress stresses, including organic compounds, heterologous organisms, metals, radiation, changes in pH, and the like. Due to its simple detection procedure, the application of whole-cell based biosensors has expanded into the field of monitoring of contaminants in soil. The detection method established by Hansen et al has the defects of unstable reporter gene expression, long detection period (more than 1 day) and the like, and fails to provide reasonable detection indexes such as a pollutant concentration calculation formula, a detection limit, a linear range and the like. Since a specific whole-cell biosensor only has specific response to a certain chemical, the detection of nitrophenol requires the development of a novel biosensor strain. The current detection method of the microbial whole-cell biosensor cannot meet the requirements of rapid, high-flux and accurate detection of nitrophenol.

Accordingly, the prior art is yet to be improved and developed.

Disclosure of Invention

In view of the defects of the prior art, the invention aims to provide a whole-cell biosensor for detecting p-nitrophenol and a detection method thereof, and aims to solve the problem that the conventional microbial whole-cell biosensor cannot meet the requirements of rapid, high-flux and accurate detection of p-nitrophenol.

The technical scheme of the invention is as follows:

in a first aspect of the present invention, there is provided a whole cell biosensor for detecting p-nitrophenol, comprising a host cell and a pnp-mrfp plasmid or pnp-amilCP plasmid located in the host cell, wherein the nucleotide sequence of the pnp-mrfp plasmid is as shown in SEQ ID NO: 1, the nucleotide sequence of the pPNP-amilCP plasmid is shown as SEQ ID NO: 2, and the physical maps of the pPNP-mrfp plasmid and the pPNP-amilCP plasmid are shown in FIG. 1.

Optionally, the host cell is escherichia coli.

Alternatively, the escherichia coli is e.

In a second aspect of the present invention, there is provided a method for preparing the whole-cell biosensor for detecting p-nitrophenol, comprising the steps of:

cloning the gene sequence of a pPNP gene fragment from a pET22b-YFP plasmid, cloning the gene sequence of a pobRO-m reporter gene fragment from a pMV _ pobRO plasmid, and cloning the gene sequence of a mrfp reporter gene fragment from a pUC19_ mrfp plasmid by using a primer polymerase chain reaction;

using the obtained mixture of the amplification products of the pobRO-m reporter gene fragment and the mrfp reporter gene fragment as a template, and obtaining the pobRO-m-mrfp gene by utilizing a primer polymerase chain reaction;

connecting the pobRO-m-mrfp gene to a pClone007 skeleton to obtain a pClone007_ pobRO-m-mrfp plasmid;

cloning the gene sequence of the pobRO-m-mrfp gene fragment from the pClone007_ pobRO-m-mrfp plasmid;

connecting the gene sequence of the pobRO-m-mrfp gene fragment with the gene sequence of the pPNP gene fragment through a homologous recombinase to obtain a connection product;

transferring the ligation product into E.coli DH5 alpha competent cells to obtain E.coli DH5 alpha/pPNP-mrfp strains;

inoculating the E.coli DH5 alpha/pPNP-mrfp strain into a liquid culture medium containing kanamycin and p-nitrophenol, collecting thalli after culture, then extracting pPNP-mrfp plasmid, and introducing the extracted pPNP-mrfp plasmid into the E.coli BL21 strain by a plasmid heat shock conversion method to obtain the whole cell biosensor E.coli BL21/pPNP-mrfp for detecting p-nitrophenol.

Optionally, primers for amplifying the pnp gene fragment:

the forward primer sequence is: GAGATCCGGCTGCTAACAAAGC, respectively;

the reverse primer sequence is as follows: GGATCCGCGACCCATTTGC, respectively;

primers used for amplifying the pobRO-m reporter gene fragment:

the forward primer sequence was: TTATACCAGATTGCGCAGTTCGTTG;

the reverse primer sequence is as follows: AAACCATTTTGGATTTGAATGTTATGATGGAACAACACCATCAGTATTTGG;

the primers used for amplifying the mrfp reporter gene fragment are as follows:

the forward primer sequence is: CCAAATACTGATGGTGTTGTTCCATCATAACATTCAAATCCAAAATGGTTT;

the reverse primer sequence is as follows: TCATTTATATAATTCGTCCATGCCAC;

primers for amplifying the homologous arm pobRO-m-mrfp gene fragment are adopted:

forward primer sequence: TTATACCAGATTGCGCAGTTCGTTG, respectively;

reverse primer sequence: GCTTTGTTAGCAGCCGGATCTCTCATTTATATAATTCGTCCATGCC are provided.

In a third aspect of the present invention, there is provided another method for preparing a whole cell biosensor for detecting p-nitrophenol, comprising the steps of:

cloning the gene sequence of pPNP gene fragment from pET22b-YFP plasmid, cloning the gene sequence of pobRO-a reporter gene fragment from pMV _ pobRO plasmid, and cloning the gene sequence of amilCP reporter gene fragment from pUC19_ amilCP plasmid by using primer polymerase chain reaction;

using the obtained mixture of amplification products of the pobRO-a reporter gene fragment and the amilCP reporter gene fragment as a template, and obtaining the pobRO-a-amilCP gene by utilizing a primer polymerase chain reaction;

connecting the pobRO-a-amilCP gene to a pClone007 skeleton to obtain a pClone007_ pobRO-a-amilCP plasmid;

cloning the gene sequence of the pobRO-a-amilCP gene fragment from the pClone007_ pobRO-a-amilCP plasmid;

connecting the gene sequence of the pobRO-a-amilCP gene fragment with the gene sequence of the pPNP gene fragment through a homologous recombinase to obtain a connection product;

transferring the ligation product into an E.coliDH5 alpha competent cell to obtain an E.coliDH5 alpha/pPNP-amilCP strain;

inoculating the E.coliDH5 alpha/pPNP-amilCP strain into a liquid culture medium containing kanamycin and p-nitrophenol, collecting thalli after culture, then extracting pPNP-amilCP plasmid, and introducing the extracted pPNP-amilCP plasmid into the E.coliBL21 strain by a plasmid heat shock transformation method to obtain the whole cell biosensor E.coli BL21/pPNP-amilCP for detecting the p-nitrophenol.

Optionally, primers for amplifying the pnp gene fragment:

the forward primer sequence was: GAGATCCGGCTGCTAACAAAGC, respectively;

the reverse primer sequence is: GGATCCGCGACCCATTTGC;

primers used for amplifying the pobRO-a reporter gene fragment:

forward primer sequence: TTATACCAGATTGCGCAGTTCGTTG, respectively;

reverse primer sequence: ATGTATATCTCCTTGCTATTTTCTATTTT, respectively;

primers used for amplifying amilCP reporter gene fragment:

forward primer sequence: AAAATAGAAAATAGCAAGGAGATATACATATGAGTGTGATCGCTAAACAAATG;

reverse primer sequence: TTATTAGGCGACCACAGGTTTG;

primers for amplifying the homologous arm pobRO-a-amilCP gene fragment are adopted:

forward primer sequence: TTATACCAGATTGCGCAGTTCGTTG, respectively;

reverse primer sequence: GCTTTGTTAGCAGCCGGATCTCTTATTAGGCGACCACAGGTTT is added.

The fourth aspect of the present invention provides a method for detecting p-nitrophenol, which comprises the steps of:

inoculating the whole-cell biosensor into a culture medium containing kanamycin for culture, collecting, and adding the culture medium containing lactose and polymyxin B for resuscitation;

adding the recovered whole-cell biosensor into each small hole on the pore plate, filling a standard sample with known p-nitrophenol concentration into each small hole, then adding EDTA (ethylene diamine tetraacetic acid), placing the pore plate on a shaking table for incubation, measuring the fluorescence intensity value or absorbance value of each small hole of the pore plate, and establishing a standard curve equation between the p-nitrophenol concentration and the fluorescence intensity value or absorbance value;

adding the resuscitated whole-cell biosensor cells into each small hole on the pore plate, filling a p-nitrophenol sample to be detected in each small hole, then adding EDTA (ethylene diamine tetraacetic acid), placing the pore plate on a shaking table for incubation, determining the fluorescence intensity value or absorbance value of each small hole of the pore plate, and calculating to obtain the concentration of the p-nitrophenol sample to be detected through a standard curve equation between the p-nitrophenol concentration and the fluorescence intensity value or absorbance value.

Optionally, the whole-cell biosensor is inoculated into an LB liquid culture medium containing 50mg/L kanamycin antibiotic, cultured for 4-5 hours and then collected.

Optionally, the ratio of the whole-cell biosensor added to the lactose-and polymyxin b (pmb) -containing medium for resuscitation to the lactose-and polymyxin b (pmb) -containing medium is (3-4) mg: 100 μ L.

Has the beneficial effects that: when the whole-cell biosensor provided by the invention is used for detecting the extraction state p-nitrophenol in soil, the combination of the p-nitrophenol and the repressor protein pobR eliminates the combination of the pobR and an operator gene locus (pobO), the reverse fluorescent protein or chromoprotein gene is transcribed to generate the fluorescent protein or chromoprotein, and the rapid and high-flux detection of the extraction state p-nitrophenol in the soil is realized by detecting the fluorescent intensity value or the absorbance value and detecting different concentrations of the p-nitrophenol to obtain different fluorescent intensity values or absorbance values.

Drawings

FIG. 1 is a physical map of the DNA sequences of pPNP-mrfp plasmid and pPNP-amilCP plasmid in the present example.

FIG. 2 is a schematic diagram of the action principle of the whole-cell biosensor and p-nitrophenol in the embodiment of the present invention.

Fig. 3 (a) is a concentration induction curve of the whole cell biosensor e.colibl21/pnp-mrfp in example 1 of the present invention, and fig. 3 (b) is a concentration induction curve of the whole cell biosensor e.colibl21/pnp-amiICP in example 2 of the present invention.

FIG. 4 is a schematic view showing the detection of p-nitrophenol using the whole-cell biosensor in example 1 of the present invention.

Detailed Description

The present invention provides a whole-cell biosensor and a detection method for detecting p-nitrophenol, and the present invention will be described in further detail below in order to make the objects, technical solutions, and effects of the present invention clearer and clearer. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

The embodiment of the invention provides a whole-cell biosensor for detecting p-nitrophenol, which comprises a host cell and a pPNP-mrfp plasmid or a pPNP-amilCP plasmid positioned in the host cell, wherein the nucleotide sequence of the pPNP-mrfp plasmid is shown as SEQ ID NO: 1, the nucleotide sequence of the pPNP-amilCP plasmid is shown as SEQ ID NO: 2, and the physical maps of the pPNP-mrfp plasmid and the pPNP-amilCP plasmid are shown in FIG. 1.

When the whole-cell biosensor provided by the invention is used for detecting the extraction-state p-nitrophenol in soil, as shown in figure 2, the p-nitrophenol (p-NP) is combined with the repressor protein pobR, so that the combination of the pobR and an operator gene site (pobO) is eliminated, a fluorescent protein or chromoprotein gene in the opposite direction is transcribed, and the rapid and high-flux detection of the extraction-state p-nitrophenol in the soil is realized by detecting the fluorescent intensity value or the chromoprotein absorbance value of the fluorescent protein and detecting different concentrations of the p-nitrophenol to obtain different fluorescent intensity values or different absorbance values.

Wherein, the chemical structural formula of the p-nitrophenol is as follows:

in one embodiment, the host cell is E.coli.

In one embodiment, the escherichia coli is e.

An embodiment of the present invention further provides a method for preparing the whole-cell biosensor for detecting p-nitrophenol, including the steps of:

s11, cloning the gene sequence of pPNP gene fragment from pET22b-YFP plasmid (the nucleotide sequence of which is shown as SEQ ID NO: 3), cloning the gene sequence of pobRO-m reporter gene fragment from pMV _ pobRO plasmid (the nucleotide sequence of which is shown as SEQ ID NO: 4) and cloning the gene sequence of mrfp reporter gene fragment from pUC19_ mrfp plasmid (the nucleotide sequence of which is shown as SEQ ID NO: 5) by using primer polymerase chain reaction;

s12, taking the obtained mixture of the amplification products of the pobRO-m reporter gene fragment and the mrfp reporter gene fragment as a template, and obtaining the pobRO-m-mrfp gene by utilizing primer polymerase chain reaction;

s13, connecting the pobRO-m-mrfp gene to a pClone007 skeleton to obtain a pClone007_ pobRO-m-mrfp plasmid;

s14, cloning the gene sequence of the pobRO-m-mrfp gene fragment from the pClone007_ pobRO-m-mrfp plasmid;

s15, connecting the gene sequence of the pobRO-m-mrfp gene fragment with the gene sequence of the pPNP gene fragment through a homologous recombinase to obtain a connection product;

s16, transferring the ligation product into an E.coli DH5 alpha competent cell to obtain an E.coli DH5 alpha/pPNP-mrfp strain;

s17, inoculating the E.coli DH5 alpha/pPNP-mrfp strain into a liquid culture medium containing kanamycin and p-nitrophenol, collecting thalli after culture, then extracting pPNP-mrfp plasmid, and introducing the extracted pPNP-mrfp plasmid into the E.coli BL21 strain through a plasmid heat shock conversion method to obtain the whole cell biosensor E.coli BL21/pPNP-mrfp for detecting p-nitrophenol.

In step S11, in one embodiment, the gene sequence of pPNP gene fragment (4677bp) was cloned from pET22b-YFP plasmid using primer Polymerase Chain Reaction (PCR) with annealing temperature of 53 ℃; cloning the gene sequence of the pobRO-m reporter gene fragment (842bp) from the pMV _ pobRO plasmid, the annealing temperature is 60 ℃; the gene sequence of mrfp reporter fragment (860bp) was cloned from pUC19_ mrfp plasmid at an annealing temperature of 60 ℃.

Specifically, primers used for amplifying the pnp gene fragment:

the forward primer sequence is: GAGATCCGGCTGCTAACAAAGC, respectively;

the reverse primer sequence is: GGATCCGCGACCCATTTGC;

primers used for amplifying the pobRO-m reporter gene fragment:

the forward primer sequence was: TTATACCAGATTGCGCAGTTCGTTG, respectively;

the reverse primer sequence is: AAACCATTTTGGATTTGAATGTTATGATGGAACAACACCATCAGTATTTGG;

the primers used for amplifying mrfp reporter gene fragments are as follows:

the forward primer sequence is: CCAAATACTGATGGTGTTGTTCCATCATAACATTCAAATCCAAAATGGTTT, respectively;

the reverse primer sequence is as follows: TCATTTATATAATTCGTCCATGCCAC, respectively;

in step S12, in one embodiment, the mixture of the amplification products of the obtained pobRO-m reporter gene fragment and mrfp reporter gene fragment is used as a template to obtain the pobRO-m-mrfp gene by using a primer polymerase chain reaction, wherein the volume ratio of the amplification products of the pobRO-m reporter gene fragment and the mrfp reporter gene fragment in the mixture is 1: 1.

In step S13, in one embodiment, the pox-m-mrfp gene is ligated to pClon 007 backbone using pClon 007 Blunt Simple Vector Kit to obtain pClon 007_ pox-m-mrfp plasmid.

In step S14, in one embodiment, the gene sequence of the pobRO-m-mrfp gene fragment (1694bp) was cloned from the pClone007_ pobRO-m-mrfp plasmid at an annealing temperature of 64 ℃. Meanwhile, when designing a primer, a homologous fragment is added. Further, primers used for amplifying the homologous arm pobRO-m-mrfp gene fragment are as follows:

forward primer sequence: TTATACCAGATTGCGCAGTTCGTTG;

reverse primer sequence: GCTTTGTTAGCAGCCGGATCTCTCATTTATATAATTCGTCCATGCC is added.

In step 15, in one embodiment, the gene sequence of the pobRO-m-mrfp gene fragment and the gene sequence of the pPNP gene fragment are linked by a homologous recombinase, the pobRO-m-mrfp gene fragment and the pPNP gene fragment are added into a PCR tube, a pipette is used to gently blow and beat the mixture, all the liquid is instantaneously centrifuged to the bottom of the centrifuge tube at a low speed, 10-100 ng of the carrier is used, the molar ratio of the carrier to the insert fragment is 1: 1-1: 10, the solid molar ratio of each fragment is 1:1, wherein pmols (mass ng × 1000)/(fragment length bp × 650daltons) are added, and the mixture is reacted at 50 ℃ for 15 min.

In step S16, the step of transferring the ligation product into an e.coli DH5 α competent cell to obtain an e.colidh5 α/pnp-mrfp strain specifically includes:

taking 100 mu L of E.coliDH5 alpha competent cells melted on an ice bath, adding the ligation product, gently mixing uniformly, standing on ice for 25min, performing water bath heat shock at 42 ℃ for 30-45 s, quickly transferring to the ice bath, standing for 2min, adding 500 mu L of antibiotic-free sterile LB culture medium, recovering at 37 ℃ for 1h at 200rpm after mixing uniformly, absorbing recovery solutions with different volumes, uniformly coating the recovery solutions on the LB culture medium containing kanamycin antibiotic, and inversely placing a flat plate in a 37 ℃ culture box for overnight culture;

selecting points on a culture medium, drawing lines on an LB (Langmuir-Blodgett) culture medium containing 50mg/L kanamycin antibiotic and an LB solid culture medium containing 50mg/L kanamycin and 10mg/L p-nitrophenol respectively by using a sterile 10 mu L pipette tip, screening strains which can grow on the two culture media, growing color spots on the LB solid culture medium containing 50mg/L kanamycin and 10mg/L p-nitrophenol, identifying the recombined plasmid by using a primer PCR (polymerase chain reaction), and verifying that the core fragment of the plasmid is 2815bp at the annealing temperature of 60 ℃;

identification of the primers used:

forward primer sequence: GCAAATGGGTCGCGGATCC;

reverse primer sequence: GCTTTGTTAGCAGCCGGATCTC, respectively;

in step S17, the step of inoculating the e.colidh5 α/pnp-mrfp strain to a liquid medium containing kanamycin and p-nitrophenol, collecting the thallus after culture, then extracting pnp-mrfp plasmid, introducing the extracted pnp-mrfp plasmid into the e.coli BL21 strain by a plasmid heat shock transformation method, and obtaining the whole cell biosensor e.colibl21/pnp-mrfp for detecting p-nitrophenol specifically includes:

inoculating the E.coliDH5 alpha/pPNP-mrfp strain into LB liquid culture medium containing 50mg/L kanamycin and 10mg/L paranitrophenol, culturing for 24h, then centrifugally collecting thalli with 10000 Xg relative centrifugal force, then extracting pPNP-mrfp plasmid by using a plasmid extraction box, and introducing the extracted pPNP-mrfp plasmid into the E.coliBL21 strain through a plasmid heat shock conversion method to obtain the whole-cell biosensor E.coliBL21/pPNP-mrfp for detecting the paranitrophenol.

The embodiment of the invention also provides another preparation method of the whole-cell biosensor for detecting p-nitrophenol, which comprises the following steps:

s21, cloning the gene sequence of pPNP gene fragment from pET22b-YFP plasmid (the nucleotide sequence of which is shown in SEQ ID NO: 3), cloning the gene sequence of pobRO-a reporter gene fragment from pMV _ pobRO plasmid (the nucleotide sequence of which is shown in SEQ ID NO: 4) and cloning the gene sequence of amiCP reporter gene fragment from pUC19_ amiCP plasmid (the nucleotide sequence of which is shown in SEQ ID NO: 6) by using primer polymerase chain reaction;

s22, using the obtained mixture of amplification products of the pobRO-a reporter gene fragment and the amilCP reporter gene fragment as a template, and obtaining the pobRO-a-amilCP gene by utilizing a primer polymerase chain reaction;

s23, connecting the pobRO-a-amilCP gene to a pClone007 skeleton to obtain a pClone007_ pobRO-a-amilCP plasmid;

s24, cloning the gene sequence of the pobRO-a-amilCP gene fragment from the pClone007_ pobRO-a-amilCP plasmid;

s25, connecting the gene sequence of the pobRO-a-amilCP gene fragment with the gene sequence of the pPNP gene fragment through a homologous recombinase to obtain a connection product;

s26, transferring the ligation product into an E.coliDH5 alpha competent cell to obtain an E.coliDH5 alpha/pPNP-amilCP strain;

s27, inoculating the E.coli DH5 alpha/pPNP-amilCP strain in a liquid culture medium containing kanamycin and paranitrophenol, collecting thalli after culture, then extracting pPNP-amilCP plasmid, and introducing the extracted pPNP-amilCP plasmid into the E.coli BL21 strain through a plasmid heat shock transformation method to obtain the whole-cell biosensor E.coli BL21/pPNP-amilCP for detecting paranitrophenol.

In step S21, in one embodiment, the gene sequence of pnp gene fragment (4677bp) was cloned from pET22b-YFP plasmid using primer polymerase chain reaction, annealing at 53 ℃; cloning the gene sequence of the pobRO-a reporter gene fragment (949bp) from the pMV _ pobRO plasmid, with an annealing temperature of 55 ℃; the gene sequence of the amilCP reporter fragment (698bp) was cloned from the pUC19_ amilCP plasmid at 55 ℃.

Specifically, primers for amplifying the pPNP gene fragment are as follows:

the forward primer sequence is: GAGATCCGGCTGCTAACAAAGC, respectively;

the reverse primer sequence is: GGATCCGCGACCCATTTGC;

primers used for amplifying the pobRO-a reporter gene fragment:

forward primer sequence: TTATACCAGATTGCGCAGTTCGTTG, respectively;

reverse primer sequence: ATGTATATCTCCTTGCTATTTTCTATTTT, respectively;

primers used for amplifying amilCP reporter gene fragment:

forward primer sequence: AAAATAGAAAATAGCAAGGAGATATACATATGAGTGTGATCGCTAAACAAATG, respectively;

reverse primer sequence: TTATTAGGCGACCACAGGTTTG is added.

In step 22, in one embodiment, the mixture of the amplification products of the pobRO-a reporter gene fragment and the amiCP reporter gene fragment is used as a template, and a primer polymerase chain reaction is used to obtain the pobRO-a-amiCP gene, wherein the volume ratio of the amplification products of the pobRO-a reporter gene fragment and the amiCP reporter gene fragment in the mixture is 1: 1.

In step S23, in one embodiment, the plasmid pClon 007_ pobRO-a-amilCP is obtained by ligating the pobRO-a-amilCP gene to the pClon 007 backbone using the pClon 007 Blunt Simple Vector Kit.

In step S24, in one embodiment, the gene sequence of the pobRO-a-amilCP gene fragment (1640bp) was cloned from pClone007_ pobRO-a-amilCP plasmid at 60 ℃ while adding a homologous fragment at the time of designing the primer. Further, primers for amplifying the homologous arm pobRO-a-amilCP gene fragment are adopted:

forward primer sequence: TTATACCAGATTGCGCAGTTCGTTG;

reverse primer sequence: GCTTTGTTAGCAGCCGGATCTCTTATTAGGCGACCACAGGTTT are provided.

In step S25, in one embodiment, the gene sequence of the pobRO-m-amicp gene fragment and the gene sequence of the pnp gene fragment are linked by a homologous recombinase, the pobRO-m-amicp gene fragment and the pnp gene fragment are added to a PCR tube, a pipette is used to gently blow and mix the mixture, all the liquid is centrifuged to the bottom of the centrifuge tube at a low speed, 10 to 100ng of the carrier is used, the molar ratio of the carrier to the insert fragment is 1:1 to 1:10, the solid molar ratio of each fragment is 1:1, pmols is (mass ng × 1000)/(fragment length bp × 650daltons), and the mixture is reacted at 50 ℃ for 15 min.

In step S26, the step of transferring the ligation product into an e.colidh5 α competent cell to obtain an e.colidh5 α/pnp-amilCP strain specifically includes:

taking 100 mu L of E.coliDH5 alpha competent cells melted on ice bath, adding the ligation product, gently mixing uniformly, standing on ice for 25min, carrying out water bath heat shock at 42 ℃ for 30-45 s, quickly transferring to the ice bath, standing for 2min, adding 500 mu L of antibiotic-free sterile LB culture medium, recovering at 37 ℃ and 200rpm for 1h after mixing uniformly, absorbing recovery solutions with different volumes, uniformly coating the recovery solutions on the LB culture medium containing kanamycin antibiotic, and inversely placing a flat plate in a 37 ℃ culture box for overnight culture;

the culture medium was spotted, a sterile 10. mu.L pipette tip was used to draw lines on LB medium containing 50mg/L kanamycin antibiotic, LB solid medium containing 50mg/L kanamycin and 10mg/L p-nitrophenol, respectively, to screen strains that could grow on both media and developed color spots on LB solid medium containing 50mg/L kanamycin and 10mg/L p-nitrophenol, the recombinant plasmid was identified using primer PCR at 60 ℃ to verify that the core fragment of the plasmid was 2761 bp.

Identification of the primers used:

forward primer sequence: GCAAATGGGTCGCGGATCC, respectively;

reverse primer sequence: GCTTTGTTAGCAGCCGGATCTC, respectively;

in step S27, the step of inoculating the e.colidh5 α/pnp-amilCP strain in a liquid medium containing kanamycin and paranitrophenol, collecting the mycelia after culturing, then extracting pnp-amilCP plasmid, and introducing the extracted pnp-amilCP plasmid into the e.colibl21 strain by a plasmid heat shock transformation method to obtain the whole cell biosensor e.colibl21/pnp-amilCP for detecting paranitrophenol specifically includes:

inoculating the E.coli DH5 alpha/pPNP-amilCP strain into LB liquid culture medium containing 50mg/L kanamycin and 10mg/L paranitrophenol, culturing for 24h, centrifuging at a relative centrifugal force of 10000 Xg to collect thalli, then extracting pPNP-amilCP plasmid by using a plasmid extraction box, and introducing the extracted pPNP-amilCP plasmid into the E.coli BL21 strain through a plasmid heat shock transformation method to obtain the whole cell biosensor E.coli BL21/pPNP-amilCP for detecting the paranitrophenol.

The embodiment of the invention also provides a method for detecting p-nitrophenol, which comprises the following steps:

s31, inoculating the whole cell biosensor E.coli DH5 alpha/pPNP-mrfp or E.coli DH5 alpha/pPNP-amilCP into a culture medium containing kanamycin for culture, collecting, and adding into a culture medium containing lactose and polymyxin B (PMB) for resuscitation;

s32, adding the recovered whole-cell biosensor into each small hole on the pore plate, filling a standard sample with known p-nitrophenol concentration into each small hole, then adding EDTA, placing the pore plate on a shaking table for incubation, measuring the fluorescence intensity value or absorbance value of each small hole of the pore plate, and establishing a standard curve equation between the p-nitrophenol concentration and the fluorescence intensity value or absorbance value;

s33, adding the resuscitated whole-cell biosensor cells into each small hole on the pore plate, filling a p-nitrophenol sample to be detected into each small hole, then adding EDTA (ethylene diamine tetraacetic acid), placing the pore plate on a shaking table for incubation, determining the fluorescence intensity value or absorbance value of each small hole of the pore plate, and calculating to obtain the concentration of the p-nitrophenol sample to be detected through a standard curve equation between the p-nitrophenol concentration and the fluorescence intensity value or absorbance value.

In this embodiment, on the basis of the construction of the whole-cell biosensor, EDTA and polymyxin B are used to reconstruct the whole-cell biosensor sensitive to nitrophenol, and when the whole-cell biosensor is used to detect the extracted state of nitrophenol in soil, the binding of nitrophenol and repressor protein pobR eliminates the binding of pobR and operator site (pobO), transcribes the fluorescent protein or chromoprotein gene in the opposite direction, and generates fluorescent protein or chromoprotein, and the nitrophenol with different concentrations induces the whole-cell biosensor to generate different amounts of fluorescent protein or chromoprotein, and by detecting the fluorescence intensity value (fluorescent protein) or absorbance value (chromoprotein), the relationship between the fluorescence intensity value or absorbance value and the concentration of nitrophenol is determined, so as to achieve the rapid and high-throughput detection of the extracted state of nitrophenol in soil.

In step S31, the whole cell biosensor E.coli DH5 alpha/pPNP-mrfp or E.coli DH5 alpha/pPNP-amilCP is inoculated into LB liquid medium containing 50mg/L kanamycin antibiotic, cultured for 4-5 hours and collected.

In step S32, the ratio of the whole cell biosensor (e.coli dh5 α/pnp-mrfp or e.coli DH5 α/pnp-amilCP) added to the lactose-and polymyxin b (pmb) -containing medium for resuscitation to the lactose-and polymyxin b (pmb) -containing medium is (3-4) mg: 100 μ L.

The invention is further illustrated by the following specific examples.

The species and plasmid information used in the following examples are shown in table 1.

TABLE 1 information on the species and plasmids

Example 1

Preparation of Whole cell biosensor E.coli BL 21/pPNP-mrfp:

(1) cloning a pPNP gene fragment (4677bp) with a pET22b plasmid skeleton structure from pET22b-YFP plasmid by using a primer Polymerase Chain Reaction (PCR), wherein the annealing temperature is 53 ℃;

primers used for amplifying the pnp gene fragment:

forward primer sequence (pnpf): GAGATCCGGCTGCTAACAAAGC;

reverse primer sequence (pnpr): GGATCCGCGACCCATTTGC;

(2) cloning the gene sequence of the pobRO-m reporter gene fragment (842bp) from the pMV _ pobRO plasmid by using a primer Polymerase Chain Reaction (PCR) at the annealing temperature of 60 ℃;

primers used for amplifying the pobRO-m reporter gene fragment:

forward primer sequence (pobR-mF): TTATACCAGATTGCGCAGTTCGTTG;

reverse primer sequence (pobR-mR): AAACCATTTTGGATTTGAATGTTATGATGGAACAACA

CCATCAGTATTTGG；

(3) Cloning the gene sequence of mrfp reporter gene fragment (860bp) from pUC19_ mrfp plasmid by using primer Polymerase Chain Reaction (PCR) at 60 ℃;

the primers used for amplifying the mrfp reporter gene fragment are as follows:

forward primer sequence (mrfpF): CCAAATACTGATGGTGTTGTTCCATCATAACATTCAAATCCAAAATGGTTT;

reverse primer sequence (mrfpR): TCATTTATATAATTCGTCCATGCCAC are provided.

(4) Taking a mixture (1:1, v/v) of amplification products of the pobRO-m reporter gene fragment and the mrfp reporter gene fragment as a template, and carrying out polymerase chain reaction by using a pobR-mF/mrfp primer to obtain a pobRO-m-mrfp gene;

the primers used were:

forward primer sequence (pobR-mF): TTATACCAGATTGCGCAGTTCGTTG;

the reverse primer sequence was (mrfpR): TCATTTATATAATTCGTCCATGCCAC;

(5) the gene of pobRO-m-mrfp was ligated to pClone007 backbone using pClone007 Blunt Simple Vector Kit to obtain pClone007_ pobRO-m-mrfp plasmid;

(6) cloning a gene sequence of a pobRO-m-mrfp gene fragment (1694bp) from a pClone007_ pobRO-m-mrfp plasmid, wherein the annealing temperature is 64 ℃, and when a primer is designed, a homologous fragment is added;

forward primer sequence (pobR-mrfp-F): TTATACCAGATTGCGCAGTTCGTTG

Reverse primer sequence (pobR-mrfp-R):

GCTTTGTTAGCAGCCGGATCTCTCATTTATATAATTCGTCCATGCC；

(7) connecting a gene sequence of a pobRO-m-mrfp gene fragment with a gene sequence of a pPNP gene fragment through a homologous recombinase, adding the pobRO-m-mrfp gene fragment and the pPNP gene fragment into a PCR tube, gently blowing and uniformly mixing the gene fragments by using a pipette, carrying out low-speed instantaneous centrifugation on all liquid to the bottom of a centrifugal tube, using 100ng of a carrier, wherein the molar ratio of the carrier to an inserted fragment is 1:1, the solid molar ratio of each fragment is 1:1, wherein pmols is (mass ng multiplied by 1000)/(fragment length bp multiplied by 650daltons), and reacting the mixed liquid at 50 ℃ for 15min to obtain a connection product;

(8) placing E.coli DH5 alpha competent cells melted on 100 mu L of ice bath into a centrifuge tube, adding the ligation product, gently mixing uniformly, standing on ice for 25min, performing water bath heat shock for 45s at 42 ℃, quickly transferring into the ice bath, standing for 2min, adding 500 mu L of antibiotic-free LB culture medium into the centrifuge tube, recovering at 37 ℃ and 200rpm for 1h after mixing uniformly, sucking recovery liquid with different volumes, uniformly coating the recovery liquid on the LB culture medium containing 50mg/L kanamycin antibiotic, inverting the plate, and placing the plate in an incubator at 37 ℃ for overnight culture;

(9) selecting points on a culture medium, respectively drawing lines on an LB (Langmuir) culture medium containing 50mg/L kanamycin antibiotic, an LB solid culture medium containing 50mg/L kanamycin and 10mg/L paranitrophenol by using a sterile 10-microliter pipette tip, screening strains which can grow on the two culture media, growing color spots on the LB solid culture medium containing 50mg/L kanamycin and 10mg/L paranitrophenol, identifying the recombined plasmid by using primer PCR (polymerase chain reaction), wherein the annealing temperature is 60 ℃, and verifying the core fragment of the plasmid to be 2815 bp;

identifying the adopted primers:

forward primer sequence (TF): GCAAATGGGTCGCGGATCC;

reverse primer sequence (TR): GCTTTGTTAGCAGCCGGATCTC;

and sequencing and verifying the obtained recombinant plasmid-containing strain E.coli DH5 alpha/pPNP-mrfp, wherein the pPNP-mrfp plasmid map is shown in figure 1.

(10) Inoculating a strain in LB liquid culture medium containing 50mg/L kanamycin and 10mg/L p-nitrophenol by using a sterile inoculating loop, culturing for 24 hours, centrifuging by using a relative centrifugal force of 10000 Xg to collect thalli, extracting pPNP-mrfp plasmid by using a plasmid extraction kit, introducing the obtained pPNP-mrfp plasmid into E.coli BL21 strain through a common plasmid heat shock transformation test, and obtaining the whole cell biosensor E.coli BL 21/pPNP-mrfp.

Example 2

Preparation of Whole cell biosensor E.coli BL 21/pPNP-amilCP:

(1) cloning gene sequence of pPNP gene fragment (4677bp) from pET22b-YFP plasmid by using primer polymerase chain reaction, wherein annealing temperature is 53 ℃;

primers used for amplifying the pnp gene fragment:

forward primer sequence (pnpf): GAGATCCGGCTGCTAACAAAGC, respectively;

reverse primer sequence (pnpr): GGATCCGCGACCCATTTGC, respectively;

(2) cloning the gene sequence of a pobRO-a reporter gene fragment (949bp) from a pMV _ pobRO plasmid by using a primer polymerase chain reaction, wherein the annealing temperature is 55 ℃;

primers used for amplifying the pobRO-a reporter gene fragment:

forward primer sequence (pobR-aF): TTATACCAGATTGCGCAGTTCGTTG, respectively;

reverse primer sequence (pobR-aR): ATGTATATCTCCTTGCTATTTTCTATTTT;

(3) cloning the gene sequence of amilCP reporter gene fragment (698bp) from pUC19_ amilCP plasmid by using primer polymerase chain reaction, wherein the annealing temperature is 55 ℃;

primers used for amplifying amilCP reporter gene fragment:

forward primer sequence (amilCPF): AAAATAGAAAATAGCAAGGAGATATACATAT

GAGTGTGATCGCTAAACAAATG；

Reverse primer sequence (amicpr): TTATTAGGCGACCACAGGTTTG;

(4) using a mixture (1:1, v/v) of amplification products of the pobRO-a reporter gene fragment and the amiCP reporter gene fragment as a template, using a pobR-aF/amiCPR primer, and using a primer polymerase chain reaction to obtain a pobRO-a-amilCP gene;

the primers used were:

forward primer sequence (pobR-aF): TTATACCAGATTGCGCAGTTCGTTG

Reverse primer sequence (amilCPR): AAAATAGAAAATAGCAAGGAGATATACATAT

GAGTGTGATCGCTAAACAAATG；

(5) Connecting the pobRO-a-amilCP gene to a pClon 007 skeleton by using a pClon 007 Blunt Simple Vector Kit to obtain a pClon 007_ pobRO-a-amilCP plasmid;

(6) the gene sequence of the pobRO-a-amilCP (1640bp) gene fragment was cloned from the pClone007_ pobRO-a-amilCP plasmid, and the homologous fragment was added when the primers were designed at an annealing temperature of 60 ℃.

forward primer sequence (pobR-amilCP-F): TTATACCAGATTGCGCAGTTCGTTG, respectively;

reverse primer sequence (pobR-amilCP-R): GCTTTGTTAGCAGCCGGATCTCTTATTAGGCGACCACAGGTTT, respectively;

(7) connecting a gene sequence of a pobRO-a-amilCP gene fragment with a gene sequence of a pPNP gene fragment through a homologous recombinase, adding the pobRO-a-amilCP gene fragment and the pPNP gene fragment into a PCR tube, gently blowing and uniformly mixing the pobRO-a-amilCP gene fragment and the pPNP gene fragment by using a pipette, carrying out low-speed instantaneous centrifugation on all liquid to the bottom of a centrifuge tube, using 100ng of a carrier, wherein the molar ratio of the carrier to an inserted fragment is 1:1, the solid molar ratio of each fragment is 1:1, wherein pmols is (mass ng multiplied by 1000)/(fragment length bp multiplied by 650daltons), and reacting the mixed liquid for 15min at 50 ℃ to obtain a connection product;

(8) taking 100 mu L of E.coli DH5 alpha competent cells melted on ice bath, adding the ligation product, gently mixing uniformly, standing on ice for 25min, performing water bath heat shock at 42 ℃ for 45s, quickly transferring to the ice bath, standing for 2min, adding 500 mu L of antibiotic-free LB culture medium into a centrifuge tube, recovering at 37 ℃ and 200rpm for 1h after mixing uniformly, absorbing recovery liquid with different volumes, uniformly coating the recovery liquid on the LB culture medium containing 50mg/L kanamycin antibiotic, and inversely placing a flat plate in a 37 ℃ culture box for overnight culture;

(9) the culture medium was spotted, a sterile 10. mu.L pipette tip was used to draw lines on LB medium containing 50mg/L kanamycin antibiotic, LB solid medium containing 50mg/L kanamycin and 10mg/L p-nitrophenol, respectively, to screen strains that could grow on both media and developed color spots on LB solid medium containing 50mg/L kanamycin and 10mg/L p-nitrophenol, the recombinant plasmid was identified using primer PCR at 60 ℃ to verify that the core fragment of the plasmid was 2761 bp.

Identifying the adopted primers:

forward primer sequence (TF): GCAAATGGGTCGCGGATCC, respectively;

reverse primer sequence (TR): GCTTTGTTAGCAGCCGGATCTC;

and the obtained plasmid map containing the recombinant plasmid strain E.coli DH5 alpha/pPNP-amilCP is shown in figure 1 by sequencing verification.

(10) Inoculating the strain into LB liquid culture medium containing 50mg/L kanamycin and 10mg/L paranitrophenol by using a sterile inoculating loop, after culturing for 24h, centrifugally collecting thalli by 10000 Xg relative centrifugal force, extracting pPNP-amilCP plasmid by using a plasmid extraction kit, and introducing the extracted pPNP-amilCP plasmid into E.coli BL21 strain through a common plasmid heat shock transformation test to obtain the whole-cell biosensor E.coli BL 21/pPNP-amilCP.

And (3) testing:

(1) as shown in FIG. 4, the whole cell biosensor E.coli BL21/pPNP-mrfp of example 1 was inoculated in LB liquid medium containing 50mg/L kanamycin antibiotic, cultured at 37 ℃ for 4 hours, vigorously shaken at 150r/min, and OD was measured₆₀₀ _nmThe sample is 0.450-0.500, the sample is collected by centrifugation for 10min at the relative centrifugal force of 4000 Xg, and then the collected sample is added into 1/4LB culture medium of 10% lactose and 0.50 mu g/mLPMB for resuscitation, and each 100 mu L of the culture medium contains 4mg of whole cell biosensor;

mu.L of resuscitated whole cell biosensor was added to each well of 96-well plate (Corning, America), 100. mu.L of test sample (soil extract containing standard p-nitrophenol at concentrations of 0, 10, 25, 50, 75, 100, 250, 500, 750, 1000, 2500, 5000, 7500, 10000. mu.g/L, respectively) was dispensed to each well, 25. mu.L of 125mmol/LEDTA was added, mixed well, covered, and the 96-well plate was incubated for 4.5 hours on 30 ℃ shaker (300 rpm). The red fluorescence intensity value of each well of the 96-well plate of the assay was measured using a SpectraMaxM5 microplate reader, and the equation y for the standard curve between the concentration of p-nitrophenol and the fluorescence intensity value was set to 82.2x, R²0.980(x represents the logarithm of the p-nitrophenol concentration and y represents the measured valueFluorescence intensity value of (2), R²Is a correlation coefficient in linear fitting), the results are shown in fig. 3 (a), and it is confirmed that there is a linear correlation between the response value of the reporter gene of the whole cell biosensor and the logarithm of the concentration of the detection substrate.

(2) The whole cell biosensor E.coli BL21/pPNP-amilCP of example 2 was inoculated into LB liquid medium containing 50mg/L kanamycin antibiotic, cultured at 37 ℃ for 4 hours with vigorous shaking at 150r/min, OD₆₀₀ _nmIs 0.450-0.500, centrifugating at 4000 Xg for 10min, and recovering by adding into 1/4LB culture medium containing 10% lactose and 0.50 μ g/ml PMB;

adding 100 μ L of resuscitated whole cell biosensor into each well of 96-well plate (Corning, America), subpackaging 100 μ L of test sample (soil extract containing standard sample of p-nitrophenol with concentration of 0, 10, 25, 50, 75, 100, 250, 500, 750, 1000, 2500, 5000, 7500, 10000 μ g/L), adding 25 μ L of 12mmol/LEDTA, mixing, covering, incubating 96-well plate on 30 deg.C shaking table (300R/min) for 4.5 hr, measuring absorbance value of each well of 96-well plate by using SpectraMaxM5 microplate reader, and establishing standard curve equation y between concentration of p-nitrophenol and absorbance value of 0.310x, R²0.978(x denotes the logarithm of the p-nitrophenol concentration, y denotes the measured absorbance value, R²Is a correlation coefficient in linear fitting), the results are shown in (b) in fig. 3, which proves that a linear correlation exists between the response value of the reporter gene of the whole-cell biosensor and the logarithm of the concentration of the detection substrate, and the obtained standard curve can be used for analyzing the content of the paranitrophenol in the contaminated soil.

The Detection Limit (DL) of the above whole-cell biosensor is calculated according to the following formula:

DL-3 SD/S, where SD is the standard deviation of the blank and S is the slope of the standard curve.

The detection limit and linear range of the extractable paranitrophenol in the soil are detected by adopting the whole-cell biosensor method, and are shown in table 2.

TABLE 2 Whole-cell biosensor for determining parameters of extractable paranitrophenol in soil

Note: mrfp indicates the reporter gene of whole cell biosensor E.coli BL21/pPNP-mrfp, iICP indicates the reporter gene of whole cell biosensor E.coli BL21/pPNP-amilCP, and HPLC indicates high performance liquid chromatography.

(2) Random access of p-nitrophenol-contaminated S using the above method_1-10Soil leachate and two kinds of p-nitrophenol polluted soil (S) collected from Nanjing_AAnd S_B) The leachate was tested by using whole cell biosensors e.coli BL 21/pnp-mrfp and e.coli BL 21/pnp-amilCP, respectively, and the results are shown in table 3.

TABLE 3 Whole cell biosensor for determining the concentration of p-nitrophenol in soil samples

Note: BC and HPLC represent the p-nitrophenol concentration measured using the whole-cell biosensor and high performance liquid chromatography, respectively, and DC represents the standard deviation between the p-nitrophenol concentration measured using the whole-cell biosensor and the p-nitrophenol concentration measured by high performance liquid chromatography.

The result shows that the result of measuring the content of the p-nitrophenol in the soil by using the whole-cell biosensor is stable and has reproducibility, and the aromatic is reliable and feasible and has practical application value.

Compared with the prior art, the invention has the beneficial effects that:

(1) the method can effectively detect the content of the p-nitrophenol in the soil;

(2) the invention can detect p-nitrophenol in soil without introducing any organic chemical reagent;

(3) the invention provides a powerful means for researching the biological available p-nitrophenol in the soil.

In summary, the invention provides a whole-cell biosensor and a detection method for detecting p-nitrophenol, when the whole-cell biosensor is used for detecting the extracted p-nitrophenol in soil, the combination of p-nitrophenol and repressor protein pobR eliminates the combination of pobR and operator locus (pobO), transcribes the fluorescent protein or chromoprotein of the gene in the opposite direction to generate fluorescent protein or chromoprotein, and realizes the rapid and high-flux detection of the extracted p-nitrophenol in soil by detecting the fluorescence intensity value or absorbance value.

It is to be understood that the invention is not limited to the examples described above, but that modifications and variations may be effected thereto by those of ordinary skill in the art in light of the foregoing description, and that all such modifications and variations are intended to be within the scope of the invention as defined by the appended claims.

SEQUENCE LISTING

<110> Shenzhen university

<120> Whole cell biosensor for detecting p-nitrophenol and detection method

<130>

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 7470

<212> DNA

<213> Artificial sequence

<400> 1

tcactgcccg ctttccagtc gggaaacctg tcgtgccagc tgcattaatg aatcggccaa 60

cgcgcgggga gaggcggttt gcgtattggg cgccagggtg gtttttcttt tcaccagtga 120

gacgggcaac agctgattgc ccttcaccgc ctggccctga gagagttgca gcaagcggtc 180

cacgctggtt tgccccagca ggcgaaaatc ctgtttgatg gtggttaacg gcgggatata 240

acatgagctg tcttcggtat cgtcgtatcc cactaccgag atatccgcac caacgcgcag 300

cccggactcg gtaatggcgc gcattgcgcc cagcgccatc tgatcgttgg caaccagcat 360

cgcagtggga acgatgccct cattcagcat ttgcatggtt tgttgaaaac cggacatggc 420

actccagtcg ccttcccgtt ccgctatcgg ctgaatttga ttgcgagtga gatatttatg 480

ccagccagcc agacgcagac gcgccgagac agaacttaat gggcccgcta acagcgcgat 540

ttgctggtga cccaatgcga ccagatgctc cacgcccagt cgcgtaccgt cttcatggga 600

gaaaataata ctgttgatgg gtgtctggtc agagacatca agaaataacg ccggaacatt 660

agtgcaggca gcttccacag caatggcatc ctggtcatcc agcggatagt taatgatcag 720

cccactgacg cgttgcgcga gaagattgtg caccgccgct ttacaggctt cgacgccgct 780

tcgttctacc atcgacacca ccacgctggc acccagttga tcggcgcgag atttaatcgc 840

cgcgacaatt tgcgacggcg cgtgcagggc cagactggag gtggcaacgc caatcagcaa 900

cgactgtttg cccgccagtt gttgtgccac gcggttggga atgtaattca gctccgccat 960

cgccgcttcc actttttccc gcgttttcgc agaaacgtgg ctggcctggt tcaccacgcg 1020

ggaaacggtc tgataagaga caccggcata ctctgcgaca tcgtataacg ttactggttt 1080

cacattcacc accctgaatt gactctcttc cgggcgctat catgccatac cgcgaaaggt 1140

tttgcgccat tcgatggtgt ccgggatctc gacgctctcc cttatgcgac tcctgcatta 1200

ggaagcagcc cagtagtagg ttgaggccgt tgagcaccgc cgccgcaagg aatggtgcat 1260

gcaaggagat ggcgcccaac agtcccccgg ccacggggcc tgccaccata cccacgccga 1320

aacaagcgct catgagcccg aagtggcgag cccgatcttc cccatcggtg atgtcggcga 1380

tataggcgcc agcaaccgca cctgtggcgc cggtgatgcc ggccacgatg cgtccggcgt 1440

agaggatcga gatctcgatc ccgcgaaatt aatacgactc actatagggg aattgtgagc 1500

ggataacaat tcccctctag aaataatttt gtttaacttt aagaaggaga tataccatgg 1560

gcagcagcca tcatcatcat catcacagca gcggcctggt gccgcgcggc agccatatgg 1620

ctagcatgac tggtggacag caaatgggtc gcggatccat gcccctgaag aaccgcttgc 1680

tggcccgcct gtcctgtgtt gcggccgtgg tggccgccac ggccgccgtt gcaccgttga 1740

cgctggtgtc caccgcccgc gccgccgcac cgcaggtgcg cacctcggcc cccggctact 1800

accggatgct gctgggcgac ttcgaaatca ccgcgctgtc ggacggcacg gtggcgctgc 1860

cggtcgacaa gcggctgaac cagccggccc cgaagacgca gagcgcgctg gccaagtcct 1920

tccagaaagc gccgctcgaa acctcggtca ccggttacct cgtcaacacc ggctccaagc 1980

tggtgctggt ggacaccggc gcggccggcc tgttcggccc caccctgggc cggctggcgg 2040

ccaacctcaa ggccgcaggc tatcagcccg agcaggtcga cgagatctac atcacccaca 2100

tgcaccccga ccacgtgggc ggcttgatgg tgggtgagca actggcgttc ccgaacgcgg 2160

tggtgcgtgc ggaccagaaa gaagccgatt tctggctcag ccagaccaac ctcgacaagg 2220

ccccggacga cgagagcaaa ggcttcttca aaggcgccat ggcctcgctg aacccctatg 2280

tgaaggccgg caagttcaag cctttctcgg ggaacaccga cctggtgccc ggcatcaaag 2340

cgctggccag ccacggccac accccgggcc acaccaccta cgtggtcgaa agccaggggc 2400

aaaagctcgc cctgctcggc gacctgatac tcgtcgccgc ggtgcagttc gacgacccca 2460

gcgtcacgac ccagctcgac agcgacagca agtccgtcgc ggtggagcgc aagaaggcct 2520

tcgcggatgc cgccaagggc ggctacctga tcgcggcgtc ccacctgtcg ttccccggca 2580

tcggccacat ccgcgccgaa ggcaagggct accgtttcgt gccggtgaac tactcggtcg 2640

tcaaccccaa gtgataacaa agcccgaaag gaagctgagt tggctgctgc caccgctgag 2700

caataactag cataacccct tggggcctct aaacgggtct tgaggggttt tttgctgaaa 2760

ggaggaacta tatccggatt tataccagat tgcgcagttc gttggcagtg ttgcgcagca 2820

acggtaacac ctggtcgatg aggtactggg gttgaacccg attagtctgg gacaggcagt 2880

tcagggctgc aatcgtcagc ccttgtgcgt tgaggactgg aaccgcaatg ccaatcacac 2940

cgagctcata ttcttccgtg gttaagcagt aatccgactg acgaacggca tccagggttt 3000

caagaaaggt gtgttcatcg gtgatggtat acggcgtcag gcgtttcagg ccatacttct 3060

cgatccactc gatctgtact tcgcgatcaa gcacgctaag aagcacttta ccggttgcga 3120

tagcatgcgc aggcagacga ttccctaagt gcatgccata cggactgagg cggttgtctt 3180

gctgaggcag ataggaacgg gcgactggaa ccacctcgtg ttcatccagg accacaatgg 3240

taaacgtcag actcgtctgc gcacacagca gattgaggaa agattgggcc actttcggca 3300

aatgcgctga actcagatag ctcgaagaga agcgcaaaac acgatgggtt aaccagaagt 3360

agtgttcgtc agtatccagg taacccagaa acttcagggt tttcagatag cgacgagctg 3420

ctgtacggct aatgccggtg cgttcagcta cctgtgtcac gtttaagcgc tgccgatcaa 3480

tgccaaacgc ttccagtaac gccagacctt ttgccagtcc cgcgatgtag tcctctgtac 3540

gaatctcttc gctcgaatgc ggatgcgcca aatactgatg gtgttgttcc ataacattca 3600

aatccaaaat ggttttgtcc gatcatcgga cagttgtaat gctaatcgga taattttgag 3660

ccttgattat agatgtcttt ttaatgaggc ggtactttaa aaatagaaaa tagcaaggag 3720

atatacatat gaattcagat atggtttcaa aaggggagga ggataatatg gcgattatca 3780

aggaatttat gcggtttaaa gtgcatatgg aagggtcggt caatggtcat gaatttgaga 3840

ttgaaggtga gggcgaaggg cgtccgtatg aaggtacgca gacggcgaag ttaaaagtca 3900

ctaagggagg tccgctgcca tttgcttggg atattttgag tccacagttc atgtatggat 3960

cgaaagctta cgtaaagcac cctgccgata ttccggatta tttgaagtta agttttccag 4020

aaggatttaa gtgggaacgt gttatgaact ttgaagacgg tggcgttgtt acagtaactc 4080

aagattcttc gttgcaagat ggtgaattta tttacaaggt taagttgcga ggtacgaatt 4140

ttccgtcaga tggaccagta atgcaaaaga aaactatggg ttgggaagcg agcagtgaac 4200

gcatgtatcc agaagatggc gctttgaaag gtgaaattaa acagcggttg aaattaaaag 4260

atggtggtca ctatgatgcg gaagtcaaaa cgacttataa agctaagaaa ccagttcaac 4320

tgccaggcgc atataacgtc aatattaagc tggatatcac gagtcataat gaagactata 4380

cgatcgtcga acagtatgaa cgagcagagg gacgacactc aacaggtggc atggacgaat 4440

tatataaatg agagatccgg ctgctaacaa agcccgaaag gaagctgagt tggctgctgc 4500

caccgctgag caataactag cataacccct tggggcctct aaacgggtct tgaggggttt 4560

tttgctgaaa ggaggaacta tatccggatt ggcgaatggg acgcgccctg tagcggcgca 4620

ttaagcgcgg cgggtgtggt ggttacgcgc agcgtgaccg ctacacttgc cagcgcccta 4680

gcgcccgctc ctttcgcttt cttcccttcc tttctcgcca cgttcgccgg ctttccccgt 4740

caagctctaa atcgggggct ccctttaggg ttccgattta gtgctttacg gcacctcgac 4800

cccaaaaaac ttgattaggg tgatggttca cgtagtgggc catcgccctg atagacggtt 4860

tttcgccctt tgacgttgga gtccacgttc tttaatagtg gactcttgtt ccaaactgga 4920

acaacactca accctatctc ggtctattct tttgatttat aagggatttt gccgatttcg 4980

gcctattggt taaaaaatga gctgatttaa caaaaattta acgcgaattt taacaaaata 5040

ttaacgttta caatttcagg tggcactttt cggggaaatg tgcgcggaac ccctatttgt 5100

ttatttttct aaatacattc aaatatgtat ccgctcatga attaattctt agaaaaactc 5160

atcgagcatc aaatgaaact gcaatttatt catatcagga ttatcaatac catatttttg 5220

aaaaagccgt ttctgtaatg aaggagaaaa ctcaccgagg cagttccata ggatggcaag 5280

atcctggtat cggtctgcga ttccgactcg tccaacatca atacaaccta ttaatttccc 5340

ctcgtcaaaa ataaggttat caagtgagaa atcaccatga gtgacgactg aatccggtga 5400

gaatggcaaa agtttatgca tttctttcca gacttgttca acaggccagc cattacgctc 5460

gtcatcaaaa tcactcgcat caaccaaacc gttattcatt cgtgattgcg cctgagcgag 5520

acgaaatacg cgatcgctgt taaaaggaca attacaaaca ggaatcgaat gcaaccggcg 5580

caggaacact gccagcgcat caacaatatt ttcacctgaa tcaggatatt cttctaatac 5640

ctggaatgct gttttcccgg ggatcgcagt ggtgagtaac catgcatcat caggagtacg 5700

gataaaatgc ttgatggtcg gaagaggcat aaattccgtc agccagttta gtctgaccat 5760

ctcatctgta acatcattgg caacgctacc tttgccatgt ttcagaaaca actctggcgc 5820

atcgggcttc ccatacaatc gatagattgt cgcacctgat tgcccgacat tatcgcgagc 5880

ccatttatac ccatataaat cagcatccat gttggaattt aatcgcggcc tagagcaaga 5940

cgtttcccgt tgaatatggc tcataacacc ccttgtatta ctgtttatgt aagcagacag 6000

ttttattgtt catgaccaaa atcccttaac gtgagttttc gttccactga gcgtcagacc 6060

ccgtagaaaa gatcaaagga tcttcttgag atcctttttt tctgcgcgta atctgctgct 6120

tgcaaacaaa aaaaccaccg ctaccagcgg tggtttgttt gccggatcaa gagctaccaa 6180

ctctttttcc gaaggtaact ggcttcagca gagcgcagat accaaatact gtccttctag 6240

tgtagccgta gttaggccac cacttcaaga actctgtagc accgcctaca tacctcgctc 6300

tgctaatcct gttaccagtg gctgctgcca gtggcgataa gtcgtgtctt accgggttgg 6360

actcaagacg atagttaccg gataaggcgc agcggtcggg ctgaacgggg ggttcgtgca 6420

cacagcccag cttggagcga acgacctaca ccgaactgag atacctacag cgtgagctat 6480

gagaaagcgc cacgcttccc gaagggagaa aggcggacag gtatccggta agcggcaggg 6540

tcggaacagg agagcgcacg agggagcttc cagggggaaa cgcctggtat ctttatagtc 6600

ctgtcgggtt tcgccacctc tgacttgagc gtcgattttt gtgatgctcg tcaggggggc 6660

ggagcctatg gaaaaacgcc agcaacgcgg cctttttacg gttcctggcc ttttgctggc 6720

cttttgctca catgttcttt cctgcgttat cccctgattc tgtggataac cgtattaccg 6780

cctttgagtg agctgatacc gctcgccgca gccgaacgac cgagcgcagc gagtcagtga 6840

gcgaggaagc ggaagagcgc ctgatgcggt attttctcct tacgcatctg tgcggtattt 6900

cacaccgcat atatggtgca ctctcagtac aatctgctct gatgccgcat agttaagcca 6960

gtatacactc cgctatcgct acgtgactgg gtcatggctg cgccccgaca cccgccaaca 7020

cccgctgacg cgccctgacg ggcttgtctg ctcccggcat ccgcttacag acaagctgtg 7080

accgtctccg ggagctgcat gtgtcagagg ttttcaccgt catcaccgaa acgcgcgagg 7140

cagctgcggt aaagctcatc agcgtggtcg tgaagcgatt cacagatgtc tgcctgttca 7200

tccgcgtcca gctcgttgag tttctccaga agcgttaatg tctggcttct gataaagcgg 7260

gccatgttaa gggcggtttt ttcctgtttg gtcactgatg cctccgtgta agggggattt 7320

ctgttcatgg gggtaatgat accgatgaaa cgagagagga tgctcacgat acgggttact 7380

gatgatgaac atgcccggtt actggaacgt tgtgagggta aacaactggc ggtatggatg 7440

cggcgggacc agagaaaaat cactcagggt 7470

<210> 2

<211> 5881

<212> DNA

<213> Artificial sequence

<400> 2

tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60

cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120

ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180

gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240

acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300

ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360

ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420

acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480

tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540

tccgctcatg aattaattct tagaaaaact catcgagcat caaatgaaac tgcaatttat 600

tcatatcagg attatcaata ccatattttt gaaaaagccg tttctgtaat gaaggagaaa 660

actcaccgag gcagttccat aggatggcaa gatcctggta tcggtctgcg attccgactc 720

gtccaacatc aatacaacct attaatttcc cctcgtcaaa aataaggtta tcaagtgaga 780

aatcaccatg agtgacgact gaatccggtg agaatggcaa aagtttatgc atttctttcc 840

agacttgttc aacaggccag ccattacgct cgtcatcaaa atcactcgca tcaaccaaac 900

cgttattcat tcgtgattgc gcctgagcga gacgaaatac gcgatcgctg ttaaaaggac 960

aattacaaac aggaatcgaa tgcaaccggc gcaggaacac tgccagcgca tcaacaatat 1020

tttcacctga atcaggatat tcttctaata cctggaatgc tgttttcccg gggatcgcag 1080

tggtgagtaa ccatgcatca tcaggagtac ggataaaatg cttgatggtc ggaagaggca 1140

taaattccgt cagccagttt agtctgacca tctcatctgt aacatcattg gcaacgctac 1200

ctttgccatg tttcagaaac aactctggcg catcgggctt cccatacaat cgatagattg 1260

tcgcacctga ttgcccgaca ttatcgcgag cccatttata cccatataaa tcagcatcca 1320

tgttggaatt taatcgcggc ctagagcaag acgtttcccg ttgaatatgg ctcataacac 1380

cccttgtatt actgtttatg taagcagaca gttttattgt tcatgaccaa aatcccttaa 1440

cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga 1500

gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg 1560

gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc 1620

agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag 1680

aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc 1740

agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg 1800

cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac 1860

accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga 1920

aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt 1980

ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag 2040

cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg 2100

gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgttctt tcctgcgtta 2160

tcccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc 2220

agccgaacga ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg cctgatgcgg 2280

tattttctcc ttacgcatct gtgcggtatt tcacaccgca tatatggtgc actctcagta 2340

caatctgctc tgatgccgca tagttaagcc agtatacact ccgctatcgc tacgtgactg 2400

ggtcatggct gcgccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct 2460

gctcccggca tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag 2520

gttttcaccg tcatcaccga aacgcgcgag gcagctgcgg taaagctcat cagcgtggtc 2580

gtgaagcgat tcacagatgt ctgcctgttc atccgcgtcc agctcgttga gtttctccag 2640

aagcgttaat gtctggcttc tgataaagcg ggccatgtta agggcggttt tttcctgttt 2700

ggtcactgat gcctccgtgt aagggggatt tctgttcatg ggggtaatga taccgatgaa 2760

acgagagagg atgctcacga tacgggttac tgatgatgaa catgcccggt tactggaacg 2820

ttgtgagggt aaacaactgg cggtatggat gcggcgggac cagagaaaaa tcactcaggg 2880

tcaatgccag cgcttcgtta atacagatgt aggtgttcca cagggtagcc agcagcatcc 2940

tgcgatgcag atccggaaca taatggtgca gggcgctgac ttccgcgttt ccagacttta 3000

cgaaacacgg aaaccgaaga ccattcatgt tgttgctcag gtcgcagacg ttttgcagca 3060

gcagtcgctt cacgttcgct cgcgtatcgg tgattcattc tgctaaccag taaggcaacc 3120

ccgccagcct agccgggtcc tcaacgacag gagcacgatc atgcgcaccc gtggggccgc 3180

catgccggcg ataatggcct gcttctcgcc gaaacgtttg gtggcgggac cagtgacgaa 3240

ggcttgagcg agggcgtgca agattccgaa taccgcaagc gacaggccga tcatcgtcgc 3300

gctccagcga aagcggtcct cgccgaaaat gacccagagc gctgccggca cctgtcctac 3360

gagttgcatg ataaagaaga cagtcataag tgcggcgacg atagtcatgc cccgcgccca 3420

ccggaaggag ctgactgggt tgaaggctct caagggcatc ggtcgagatc ccggtgccta 3480

atgagtgagc taacttacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa 3540

cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat 3600

tgggcgccag ggtggttttt cttttcacca gtgagacggg caacagctga ttgcccttca 3660

ccgcctggcc ctgagagagt tgcagcaagc ggtccacgct ggtttgcccc agcaggcgaa 3720

aatcctgttt gatggtggtt aacggcggga tataacatga gctgtcttcg gtatcgtcgt 3780

atcccactac cgagatatcc gcaccaacgc gcagcccgga ctcggtaatg gcgcgcattg 3840

cgcccagcgc catctgatcg ttggcaacca gcatcgcagt gggaacgatg ccctcattca 3900

gcatttgcat ggtttgttga aaaccggaca tggcactcca gtcgccttcc cgttccgcta 3960

tcggctgaat ttgattgcga gtgagatatt tatgccagcc agccagacgc agacgcgccg 4020

agacagaact taatgggccc gctaacagcg cgatttgctg gtgacccaat gcgaccagat 4080

gctccacgcc cagtcgcgta ccgtcttcat gggagaaaat aatactgttg atgggtgtct 4140

ggtcagagac atcaagaaat aacgccggaa cattagtgca ggcagcttcc acagcaatgg 4200

catcctggtc atccagcgga tagttaatga tcagcccact gacgcgttgc gcgagaagat 4260

tgtgcaccgc cgctttacag gcttcgacgc cgcttcgttc taccatcgac accaccacgc 4320

tggcacccag ttgatcggcg cgagatttaa tcgccgcgac aatttgcgac ggcgcgtgca 4380

gggccagact ggaggtggca acgccaatca gcaacgactg tttgcccgcc agttgttgtg 4440

ccacgcggtt gggaatgtaa ttcagctccg ccatcgccgc ttccactttt tcccgcgttt 4500

tcgcagaaac gtggctggcc tggttcacca cgcgggaaac ggtctgataa gagacaccgg 4560

catactctgc gacatcgtat aacgttactg gtttcacatt caccaccctg aattgactct 4620

cttccgggcg ctatcatgcc ataccgcgaa aggttttgcg ccattcgatg gtgtccggga 4680

tctcgacgct ctcccttatg cgactcctgc attaggaagc agcccagtag taggttgagg 4740

ccgttgagca ccgccgccgc aaggaatggt gcatgcaagg agatggcgcc caacagtccc 4800

ccggccacgg ggcctgccac catacccacg ccgaaacaag cgctcatgag cccgaagtgg 4860

cgagcccgat cttccccatc ggtgatgtcg gcgatatagg cgccagcaac cgcacctgtg 4920

gcgccggtga tgccggccac gatgcgtccg gcgtagagga tcgagatctc gatcccgcga 4980

aattaatacg actcactata ggggaattgt gagcggataa caattcccct ctagaaataa 5040

ttttgtttaa ctttaagaag gagatatacc atgagtgtga tcgctaaaca aatgacctac 5100

aaggtttata tgtcaggcac ggtcaatgga cactactttg aggtcgaagg cgatggaaaa 5160

ggtaagccct acgaggggga gcagacggta aagctcactg tcaccaaggg cggacctctg 5220

ccatttgctt gggatatttt atcaccacag tgtcagtacg gaagcatacc attcaccaag 5280

taccctgaag acatccctga ctatgtaaag cagtcattcc cggagggcta tacatgggag 5340

aggatcatga actttgaaga tggtgcagtg tgtactgtca gcaatgattc cagcatccaa 5400

ggcaactgtt tcatctacca tgtcaagttc tctggtttga actttcctcc caatggacct 5460

gtcatgcaga agaagacaca gggctgggaa cccaacactg agcgtctctt tgcacgagat 5520

ggaatgctgc taggaaacaa ctttatggct ctgaagttag aaggaggcgg tcactatttg 5580

tgtgaattta aaactactta caaggcaaag aagcctgtga agatgccagg gtatcactat 5640

gttgaccgca aactggatgt aaccaatcac aacaaggatt acacttcggt tgagcagtgt 5700

gaaatttcca ttgcacgcaa acctgtggtc gcctaataac tcgaggatcc ggctgctaac 5760

aaagcccgaa aggaagctga gttggctgct gccaccgctg agcaataact agcataaccc 5820

cttggggcct ctaaacgggt cttgaggggt tttttgctga aaggaggaac tatatccgga 5880

t 5881

<210> 3

<211> 6055

<212> DNA

<213> Artificial sequence

<400> 3

tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60

cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120

ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180

gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240

acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300

ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360

ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420

acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480

tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540

tccgctcatg aattaattct tagaaaaact catcgagcat caaatgaaac tgcaatttat 600

tcatatcagg attatcaata ccatattttt gaaaaagccg tttctgtaat gaaggagaaa 660

actcaccgag gcagttccat aggatggcaa gatcctggta tcggtctgcg attccgactc 720

gtccaacatc aatacaacct attaatttcc cctcgtcaaa aataaggtta tcaagtgaga 780

aatcaccatg agtgacgact gaatccggtg agaatggcaa aagtttatgc atttctttcc 840

agacttgttc aacaggccag ccattacgct cgtcatcaaa atcactcgca tcaaccaaac 900

cgttattcat tcgtgattgc gcctgagcga gacgaaatac gcgatcgctg ttaaaaggac 960

aattacaaac aggaatcgaa tgcaaccggc gcaggaacac tgccagcgca tcaacaatat 1020

tttcacctga atcaggatat tcttctaata cctggaatgc tgttttcccg gggatcgcag 1080

tggtgagtaa ccatgcatca tcaggagtac ggataaaatg cttgatggtc ggaagaggca 1140

taaattccgt cagccagttt agtctgacca tctcatctgt aacatcattg gcaacgctac 1200

ctttgccatg tttcagaaac aactctggcg catcgggctt cccatacaat cgatagattg 1260

tcgcacctga ttgcccgaca ttatcgcgag cccatttata cccatataaa tcagcatcca 1320

tgttggaatt taatcgcggc ctagagcaag acgtttcccg ttgaatatgg ctcataacac 1380

cccttgtatt actgtttatg taagcagaca gttttattgt tcatgaccaa aatcccttaa 1440

cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga 1500

gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg 1560

gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc 1620

agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag 1680

aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc 1740

agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg 1800

cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac 1860

accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga 1920

aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt 1980

ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag 2040

cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg 2100

gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgttctt tcctgcgtta 2160

tcccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc 2220

agccgaacga ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg cctgatgcgg 2280

tattttctcc ttacgcatct gtgcggtatt tcacaccgca tatatggtgc actctcagta 2340

caatctgctc tgatgccgca tagttaagcc agtatacact ccgctatcgc tacgtgactg 2400

ggtcatggct gcgccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct 2460

gctcccggca tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag 2520

gttttcaccg tcatcaccga aacgcgcgag gcagctgcgg taaagctcat cagcgtggtc 2580

gtgaagcgat tcacagatgt ctgcctgttc atccgcgtcc agctcgttga gtttctccag 2640

aagcgttaat gtctggcttc tgataaagcg ggccatgtta agggcggttt tttcctgttt 2700

ggtcactgat gcctccgtgt aagggggatt tctgttcatg ggggtaatga taccgatgaa 2760

acgagagagg atgctcacga tacgggttac tgatgatgaa catgcccggt tactggaacg 2820

ttgtgagggt aaacaactgg cggtatggat gcggcgggac cagagaaaaa tcactcaggg 2880

tcaatgccag cgcttcgtta atacagatgt aggtgttcca cagggtagcc agcagcatcc 2940

tgcgatgcag atccggaaca taatggtgca gggcgctgac ttccgcgttt ccagacttta 3000

cgaaacacgg aaaccgaaga ccattcatgt tgttgctcag gtcgcagacg ttttgcagca 3060

gcagtcgctt cacgttcgct cgcgtatcgg tgattcattc tgctaaccag taaggcaacc 3120

ccgccagcct agccgggtcc tcaacgacag gagcacgatc atgcgcaccc gtggggccgc 3180

catgccggcg ataatggcct gcttctcgcc gaaacgtttg gtggcgggac cagtgacgaa 3240

ggcttgagcg agggcgtgca agattccgaa taccgcaagc gacaggccga tcatcgtcgc 3300

gctccagcga aagcggtcct cgccgaaaat gacccagagc gctgccggca cctgtcctac 3360

gagttgcatg ataaagaaga cagtcataag tgcggcgacg atagtcatgc cccgcgccca 3420

ccggaaggag ctgactgggt tgaaggctct caagggcatc ggtcgagatc ccggtgccta 3480

atgagtgagc taacttacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa 3540

cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat 3600

tgggcgccag ggtggttttt cttttcacca gtgagacggg caacagctga ttgcccttca 3660

ccgcctggcc ctgagagagt tgcagcaagc ggtccacgct ggtttgcccc agcaggcgaa 3720

aatcctgttt gatggtggtt aacggcggga tataacatga gctgtcttcg gtatcgtcgt 3780

atcccactac cgagatatcc gcaccaacgc gcagcccgga ctcggtaatg gcgcgcattg 3840

cgcccagcgc catctgatcg ttggcaacca gcatcgcagt gggaacgatg ccctcattca 3900

gcatttgcat ggtttgttga aaaccggaca tggcactcca gtcgccttcc cgttccgcta 3960

tcggctgaat ttgattgcga gtgagatatt tatgccagcc agccagacgc agacgcgccg 4020

agacagaact taatgggccc gctaacagcg cgatttgctg gtgacccaat gcgaccagat 4080

gctccacgcc cagtcgcgta ccgtcttcat gggagaaaat aatactgttg atgggtgtct 4140

ggtcagagac atcaagaaat aacgccggaa cattagtgca ggcagcttcc acagcaatgg 4200

catcctggtc atccagcgga tagttaatga tcagcccact gacgcgttgc gcgagaagat 4260

tgtgcaccgc cgctttacag gcttcgacgc cgcttcgttc taccatcgac accaccacgc 4320

tggcacccag ttgatcggcg cgagatttaa tcgccgcgac aatttgcgac ggcgcgtgca 4380

gggccagact ggaggtggca acgccaatca gcaacgactg tttgcccgcc agttgttgtg 4440

ccacgcggtt gggaatgtaa ttcagctccg ccatcgccgc ttccactttt tcccgcgttt 4500

tcgcagaaac gtggctggcc tggttcacca cgcgggaaac ggtctgataa gagacaccgg 4560

catactctgc gacatcgtat aacgttactg gtttcacatt caccaccctg aattgactct 4620

cttccgggcg ctatcatgcc ataccgcgaa aggttttgcg ccattcgatg gtgtccggga 4680

tctcgacgct ctcccttatg cgactcctgc attaggaagc agcccagtag taggttgagg 4740

ccgttgagca ccgccgccgc aaggaatggt gcatgcaagg agatggcgcc caacagtccc 4800

ccggccacgg ggcctgccac catacccacg ccgaaacaag cgctcatgag cccgaagtgg 4860

cgagcccgat cttccccatc ggtgatgtcg gcgatatagg cgccagcaac cgcacctgtg 4920

gcgccggtga tgccggccac gatgcgtccg gcgtagagga tcgagatctc gatcccgcga 4980

aattaatacg actcactata ggggaattgt gagcggataa caattcccct ctagaaataa 5040

ttttgtttaa ctttaagaag gagatatacc atgggcagca gccatcatca tcatcatcac 5100

agcagcggcc tggtgccgcg cggcagccat atggctagca tgactggtgg acagcaaatg 5160

ggtcgcggat ccatggtgag caagggcgag gagctgttca ccggggtggt gcccatcctg 5220

gtcgagctgg acggcgacgt aaacggccac aagttcagcg tgtccggcga gggcgagggc 5280

gatgccacct acggcaagct gaccctgaag ttcatctgca ccaccggcaa gctgcccgtg 5340

ccctggccca ccctcgtgac caccttcggc tacggcctgc agtgcttcgc ccgctacccc 5400

gaccacatga agcagcacga cttcttcaag tccgccatgc ccgaaggcta cgtccaggag 5460

cgcaccatct tcttcaagga cgacggcaac tacaagaccc gcgccgaggt gaagttcgag 5520

ggcgacaccc tggtgaaccg catcgagctg aagggcatcg acttcaagga ggacggcaac 5580

atcctggggc acaagctgga gtacaactac aacagccaca acgtctatat catggccgac 5640

aagcagaaga acggcatcaa ggtgaacttc aagatccgcc acaacatcga ggacggcagc 5700

gtgcagctcg ccgaccacta ccagcagaac acccccatcg gcgacggccc cgtgctgctg 5760

cccgacaacc actacctgag ctaccagtcc gccctgagca aagaccccaa cgagaagcgc 5820

gatcacatgg tcctgctgga gttcgtgacc gccgccggga tcactctcgg catggacgag 5880

ctgtacaagt aactcgagca ccaccaccac caccactgag atccggctgc taacaaagcc 5940

cgaaaggaag ctgagttggc tgctgccacc gctgagcaat aactagcata accccttggg 6000

gcctctaaac gggtcttgag gggttttttg ctgaaaggag gaactatatc cggat 6055

<210> 4

<211> 3158

<212> DNA

<213> Artificial sequence

<400> 4

aaaaataaac aaataggggt tccgcgcaca tttccccgaa aagtgccacc tgacgtctaa 60

gaaaccatta ttatcatgac attaacctat aaaaataggc gtatcacgag gccctttcgt 120

tgtaaaacga cggccagtcg aaccacgcaa tgcgtctcga tccgcagtgt cttgcgtctc 180

tcataacatt caaatccaaa atggttttgt ccgatcatcg gacagttgta atgctaatcg 240

gataattttg agccttgatt atagatgtct ttttaatgag gcggtacttt aaaaatagaa 300

aatagcaagg atgatgttat gaattcagat atggtttcaa aaggggagga ggataatatg 360

gcgattatca aggaatttat gcggtttaaa gtgcatatgg aagggtcggt caatggtcat 420

gaatttgaga ttgaaggtga gggcgaaggg cgtccgtatg aaggtacgca gacggcgaag 480

ttaaaagtca ctaagggagg tccgctgcca tttgcttggg atattttgag tccacagttc 540

atgtatggat cgaaagctta cgtaaagcac cctgccgata ttccggatta tttgaagtta 600

agttttccag aaggatttaa gtgggaacgt gttatgaact ttgaagacgg tggcgttgtt 660

acagtaactc aagattcttc gttgcaagat ggtgaattta tttacaaggt taagttgcga 720

ggtacgaatt ttccgtcaga tggaccagta atgcaaaaga aaactatggg ttgggaagcg 780

agcagtgaac gcatgtatcc agaagatggc gctttgaaag gtgaaattaa acagcggttg 840

aaattaaaag atggtggtca ctatgatgcg gaagtcaaaa cgacttataa agctaagaaa 900

ccagttcaac tgccaggcgc atataacgtc aatattaagc tggatatcac gagtcataat 960

gaagactata cgatcgtcga acagtatgaa cgagcagagg gacgacactc aacaggtggc 1020

atggacgaat tatataaatg attaacctag gctgctgcca ccgctgagca ataactagca 1080

taaccccttg gggcctctaa acgggtcttg aggggttttt tgctgaaacc tcaggcattt 1140

gagaagcaca cggtcacaca tcggatcccg ggcccgtcga ctgcagaggc ctgcatgcaa 1200

gcttggcgta atcatggtca tagctgtttc ctggagacgg agtcactgcc aaccgagacg 1260

gtcatagctg tttcctgtgt gccgcttcct cgctcactga ctcgctgcgc tcggtcgttc 1320

ggctgcggcg agcggtatca gctcactcaa aggcggtaat acggttaccc acagaatcag 1380

gggataacgc aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa 1440

aggccgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc 1500

gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc 1560

ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg 1620

cctttctccc ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg tatctcagtt 1680

cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc 1740

gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc 1800

cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag 1860

agttcttgaa gtggtggcct aactacggct acactagaag aacagtattt ggtatctgcg 1920

ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa 1980

ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag 2040

gatctcaaga agatcctttg atcttttcta cggggtctga cgctcagtgg aacgaaaact 2100

cacgttaagg gattttggtc atgagattat caaaaaggat cttcacctag atccttttaa 2160

attaaaaatg aagttttaaa tcaatctaaa gtatatatga gtaaacttgg tctgacagtt 2220

accaatgctt aatcagtgag gcacctatct cagcgatctg tctctttcgt tcatccatag 2280

ttgcctgact ccccgtcgtg tagataacta cgatacggga gggcttacca tctggcccca 2340

gtgctgcaat aataccgcgg gacccacgct caccggctcc agatttatca gcaataaacc 2400

agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt 2460

ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg 2520

ttgttgccat cgctacaggc atcgtggtat cacgctcgtc gtttggtatg gcttcattca 2580

gctccggttc ccaacgatca aggcgagtta catgatcccc catgttgcgc aaaaaagcgg 2640

ttagctcctt cggtcctccg atcgttgtca gaagtaagtt ggccgccgtg ttatcactca 2700

tggttatggc agcactacat aattctctta ctgtcatgcc atccgtaaga tgcttttctg 2760

tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct 2820

cttgcccggc gtcaatacgg gataataccg cgccacatag cagaacttta aaagtgctca 2880

tcattggaaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca 2940

gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact ttcaccagcg 3000

tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata agggcgacac 3060

ggaaatgttg aatactcata ctcttccttt ttcaatatta ttgaagcatt tatcagggtt 3120

attgtctcat gagcggatac atatttgaat gtatttag 3158

<210> 5

<211> 3085

<212> DNA

<213> Artificial sequence

<400> 5

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120

ttggcgggtg tcggggctgg cttaatcatt tatataattc gtccatgcca cctgttgagt 180

gtcgtccctc tgctcgttca tactgttcga cgatcgtata gtcttcatta tgactcgtga 240

tatccagctt aatattgacg ttatatgcgc ctggcagttg aactggtttc ttagctttat 300

aagtcgtttt gacttccgca tcatagtgac caccatcttt taatttcaac cgctgtttaa 360

tttcaccttt caaagcgcca tcttctggat acatgcgttc actgctcgct tcccaaccca 420

tagttttctt ttgcattact ggtccatctg acggaaaatt cgtacctcgc aacttaacct 480

tgtaaataaa ttcaccatct tgcaacgaag aatcttgagt tactgtaaca acgccaccgt 540

cttcaaagtt cataacacgt tcccacttaa atccttctgg aaaacttaac ttcaaataat 600

ccggaatatc ggcagggtgc tttacgtaag ctttcgatcc atacatgaac tgtggactca 660

aaatatccca agcaaatggc agcggacctc ccttagtgac ttttaacttc gccgtctgcg 720

taccttcata cggacgccct tcgccctcac cttcaatctc aaattcatga ccattgaccg 780

acccttccat atgcacttta aaccgcataa attccttgat aatcgccata ttatcctcct 840

ccccttttga aaccatatct gaattcatag ctgtttcctg tgtgaaattg ttatccgctc 900

acaattccac acaacatacg agccggaagc ataaagtgta aagcctgggg tgcctaatga 960

gtgagctaac tcacattaat tgcgttgcgc tcactgcccg ctttccagtc gggaaacctg 1020

tcgtgccagc tgcattaatg aatcggccaa cgcgcgggga gaggcggttt gcgtattggg 1080

cgctcttccg cttcctcgct cactgactcg ctgcgctcgg tcgttcggct gcggcgagcg 1140

gtatcagctc actcaaaggc ggtaatacgg ttatccacag aatcagggga taacgcagga 1200

aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg 1260

gcgtttttcc ataggctccg cccccctgac gagcatcaca aaaatcgacg ctcaagtcag 1320

aggtggcgaa acccgacagg actataaaga taccaggcgt ttccccctgg aagctccctc 1380

gtgcgctctc ctgttccgac cctgccgctt accggatacc tgtccgcctt tctcccttcg 1440

ggaagcgtgg cgctttctca atgctcacgc tgtaggtatc tcagttcggt gtaggtcgtt 1500

cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc 1560

ggtaactatc gtcttgagtc caacccggta agacacgact tatcgccact ggcagcagcc 1620

actggtaaca ggattagcag agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg 1680

tggcctaact acggctacac tagaaggaca gtatttggta tctgcgctct gctgaagcca 1740

gttaccttcg gaaaaagagt tggtagctct tgatccggca aacaaaccac cgctggtagc 1800

ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat 1860

cctttgatct tttctacggg gtctgacgct cagtggaacg aaaactcacg ttaagggatt 1920

ttggtcatga gattatcaaa aaggatcttc acctagatcc ttttaaatta aaaatgaagt 1980

tttaaatcaa tctaaagtat atatgagtaa acttggtctg acagttacca atgcttaatc 2040

agtgaggcac ctatctcagc gatctgtcta tttcgttcat ccatagttgc ctgactcccc 2100

gtcgtgtaga taactacgat acgggagggc ttaccatctg gccccagtgc tgcaatgata 2160

ccgcgagacc cacgctcacc ggctccagat ttatcagcaa taaaccagcc agccggaagg 2220

gccgagcgca gaagtggtcc tgcaacttta tccgcctcca tccagtctat taattgttgc 2280

cgggaagcta gagtaagtag ttcgccagtt aatagtttgc gcaacgttgt tgccattgct 2340

acaggcatcg tggtgtcacg ctcgtcgttt ggtatggctt cattcagctc cggttcccaa 2400

cgatcaaggc gagttacatg atcccccatg ttgtgcaaaa aagcggttag ctccttcggt 2460

cctccgatcg ttgtcagaag taagttggcc gcagtgttat cactcatggt tatggcagca 2520

ctgcataatt ctcttactgt catgccatcc gtaagatgct tttctgtgac tggtgagtac 2580

tcaaccaagt cattctgaga atagtgtatg cggcgaccga gttgctcttg cccggcgtca 2640

atacgggata ataccgcgcc acatagcaga actttaaaag tgctcatcat tggaaaacgt 2700

tcttcggggc gaaaactctc aaggatctta ccgctgttga gatccagttc gatgtaaccc 2760

actcgtgcac ccaactgatc ttcagcatct tttactttca ccagcgtttc tgggtgagca 2820

aaaacaggaa ggcaaaatgc cgcaaaaaag ggaataaggg cgacacggaa atgttgaata 2880

ctcatactct tcctttttca atattattga agcatttatc agggttattg tctcatgagc 2940

ggatacatat ttgaatgtat ttagaaaaat aaacaaatag gggttccgcg cacatttccc 3000

cgaaaagtgc cacctgacgt ctaagaaacc attattatca tgacattaac ctataaaaat 3060

aggcgtatca cgaggccctt tcgtc 3085

<210> 6

<211> 3031

<212> DNA

<213> Artificial sequence

<400> 6

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120

ttggcgggtg tcggggctgg cttaattatt aggcgaccac aggtttgcgt gcaatggaaa 180

tttcacactg ctcaaccgaa gtgtaatcct tgttgtgatt ggttacatcc agtttgcggt 240

caacatagtg ataccctggc atcttcacag gcttctttgc cttgtaagta gttttaaatt 300

cacacaaata gtgaccgcct ccttctaact tcagagccat aaagttgttt cctagcagca 360

ttccatctcg tgcaaagaga cgctcagtgt tgggttccca gccctgtgtc ttcttctgca 420

tgacaggtcc attgggagga aagttcaaac cagagaactt gacatggtag atgaaacagt 480

tgccttggat gctggaatca ttgctgacag tacacactgc accatcttca aagttcatga 540

tcctctccca tgtatagccc tccgggaatg actgctttac atagtcaggg atgtcttcag 600

ggtacttggt gaatggtatg cttccgtact gacactgtgg tgataaaata tcccaagcaa 660

atggcagagg tccgcccttg gtgacagtga gctttaccgt ctgctccccc tcgtagggct 720

taccttttcc atcgccttcg acctcaaagt agtgtccatt gaccgtgcct gacatataaa 780

ccttgtaggt catttgttta gcgatcacac tcatagctgt ttcctgtgtg aaattgttat 840

ccgctcacaa ttccacacaa catacgagcc ggaagcataa agtgtaaagc ctggggtgcc 900

taatgagtga gctaactcac attaattgcg ttgcgctcac tgcccgcttt ccagtcggga 960

aacctgtcgt gccagctgca ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt 1020

attgggcgct cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg 1080

cgagcggtat cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac 1140

gcaggaaaga acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg 1200

ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca 1260

agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc 1320

tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc 1380

ccttcgggaa gcgtggcgct ttctcaatgc tcacgctgta ggtatctcag ttcggtgtag 1440

gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc 1500

ttatccggta actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca 1560

gcagccactg gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg 1620

aagtggtggc ctaactacgg ctacactaga aggacagtat ttggtatctg cgctctgctg 1680

aagccagtta ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct 1740

ggtagcggtg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa 1800

gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa 1860

gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa 1920

tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc 1980

ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga 2040

ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca 2100

atgataccgc gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc 2160

ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat 2220

tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc 2280

attgctacag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt 2340

tcccaacgat caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc 2400

ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg 2460

gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt 2520

gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg 2580

gcgtcaatac gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga 2640

aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg 2700

taacccactc gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg 2760

tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt 2820

tgaatactca tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc 2880

atgagcggat acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca 2940

tttccccgaa aagtgccacc tgacgtctaa gaaaccatta ttatcatgac attaacctat 3000

aaaaataggc gtatcacgag gccctttcgt c 3031

Claims

1. A whole-cell biosensor for detecting p-nitrophenol, comprising a host cell and a pPNP-mrfp plasmid or a pPNP-amilCP plasmid located in the host cell, wherein the pPNP-mrfp plasmid has a nucleotide sequence shown in SEQ ID NO: 1, the nucleotide sequence of the pPNP-amilCP plasmid is shown as SEQ ID NO: 2, and the physical maps of the pPNP-mrfp plasmid and the pPNP-amilCP plasmid are shown in FIG. 1.

2. The whole-cell biosensor for detecting p-nitrophenol according to claim 1, wherein the host cell is Escherichia coli.

3. The whole-cell biosensor for detecting p-nitrophenol according to claim 1, wherein said E.coli is E.

4. A method for preparing a whole-cell biosensor for detecting p-nitrophenol as claimed in any of claims 1-3, comprising the steps of:

cloning the gene sequence of the gene fragment of pobRO-m-mrfp from the pClone007_ pobRO-m-mrfp plasmid;

transferring the ligation product into an E.coliDH5 alpha competent cell to obtain an E.coliDH5 alpha/pPNP-mrfp strain;

inoculating the E.coliDH5 alpha/pPNP-mrfp strain into a liquid culture medium containing kanamycin and p-nitrophenol, collecting thalli after culture, then extracting pPNP-mrfp plasmid, and introducing the extracted pPNP-mrfp plasmid into the E.coliBL21 strain by a plasmid heat shock conversion method to obtain the whole-cell biosensor E.coliBL21/pPNP-mrfp for detecting p-nitrophenol.

5. The production method according to claim 4,

primers used for amplifying the pnp gene fragment:

the forward primer sequence is: GAGATCCGGCTGCTAACAAAGC, respectively;

the reverse primer sequence is as follows: GGATCCGCGACCCATTTGC, respectively;

primers used for amplifying the pobRO-m reporter gene fragment:

the forward primer sequence is: TTATACCAGATTGCGCAGTTCGTTG, respectively;

the reverse primer sequence is as follows: AAACCATTTTGGATTTGAATGTTATGATGGAACAACACCATCAGTATTTGG, respectively;

the primers used for amplifying the mrfp reporter gene fragment are as follows:

the forward primer sequence was: CCAAATACTGATGGTGTTGTTCCATCATAACATTCAAATCCAAAATGGTTT, respectively;

forward primer sequence: TTATACCAGATTGCGCAGTTCGTTG, respectively;

6. A method for preparing a whole-cell biosensor for detecting p-nitrophenol as claimed in any of claims 1-3, comprising the steps of:

using the obtained mixture of the amplification products of the pobRO-a reporter gene fragment and the amiCP reporter gene fragment as a template, and performing polymerase chain reaction by using a primer to obtain a pobRO-a-amiCP gene;

transferring the ligation product into an E.coli DH5 alpha competent cell to obtain an E.coli DH5 alpha/pPNP-amilCP strain;

inoculating the E.coli DH5 alpha/pPNP-amilCP strain into a liquid culture medium containing kanamycin and paranitrophenol, collecting thalli after culture, then extracting pPNP-amilCP plasmid, and introducing the extracted pPNP-amilCP plasmid into the E.coli BL21 strain through a plasmid heat shock transformation method to obtain the whole cell biosensor E.coli BL21/pPNP-amilCP for detecting paranitrophenol.

7. The production method according to claim 6,

primers used for amplifying the pnp gene fragment:

the forward primer sequence is: GAGATCCGGCTGCTAACAAAGC, respectively;

the reverse primer sequence is as follows: GGATCCGCGACCCATTTGC, respectively;

primers used for amplifying the pobRO-a reporter gene fragment:

forward primer sequence: TTATACCAGATTGCGCAGTTCGTTG, respectively;

reverse primer sequence: ATGTATATCTCCTTGCTATTTTCTATTTT, respectively;

primers used for amplifying amilCP reporter gene fragment:

forward primer sequence: AAAATAGAAAATAGCAAGGAGATATACATATGAGTGTGATCGCTAAACAAATG;

reverse primer sequence: TTATTAGGCGACCACAGGTTTG;

forward primer sequence: TTATACCAGATTGCGCAGTTCGTTG;

8. A method for detecting p-nitrophenol, which is characterized by comprising the following steps:

inoculating the whole cell biosensor according to any one of claims 1 to 7 into a culture medium containing kanamycin, collecting the whole cell biosensor after culturing, and adding the whole cell biosensor into a culture medium containing lactose and polymyxin B for resuscitation;

9. The method for detecting p-nitrophenol according to claim 9, wherein the whole cell biosensor is inoculated into LB liquid medium containing 50mg/L kanamycin antibiotic, cultured for 4-5 hours and collected.

10. The method for detecting p-nitrophenol according to claim 9, wherein the ratio of the whole cell biosensor added to the lactose and polymyxin B containing medium for resuscitation to the lactose and polymyxin B containing medium is (3-4) mg: 100 μ L.