CN112430610B - Low-temperature esterase functional gene DcaE and application thereof - Google Patents

Abstract

The invention discovers a gene DcaE with low-temperature esterase function. The invention constructs a recombinant vector containing the gene, and expresses the recombinant vector in a prokaryotic host cell escherichia coli. Experiments prove that after the gene is expressed in a prokaryotic host cell, ester substrates can be catalyzed to carry out ester bond hydrolysis reaction at low temperature, and the gene is applied to degradation of various esters.

Description

Low-temperature esterase functional gene DcaE and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and relates to a gene with esterase function.

Background

The low temperature active esterase has higher catalytic activity at low temperature than the mesophilic and thermophilic enzymes. The esterase can not only effectively improve industrial production efficiency in a low-temperature environment, but also save energy with minimum energy consumption, so that the low-temperature esterase has important commercial value in various aspects of industrial application.

In the activity determination of microbial esterases, the currently accepted common mode substrate in the art is p-nitrophenyl esters. Such as p-nitrophenol acetate pNPA, p-nitrophenol butyrate pNPB, p-nitrophenol octanoate pNPC, p-nitrophenol laurate pNPL and p-nitrophenol palmitate pNPP, etc.

A protein is added into a nitrobenzene ester compound which is a model substrate of esters, and the enzyme activity of esterase is determined by measuring the content of p-nitrophenol (pNP) which is a hydrolysis product. If the model substrate has a hydrolytic function, the protein is considered to have an esterase function.

Disclosure of Invention

The invention aims to find a low-temperature esterase gene for degradation reaction of ester compounds in biocatalysis.

In order to find esterase suitable for industrial production, the invention screens the gene DcaE @Deinococcus cold-adapted Esterase), constructing a recombinant vector, carrying out expression purification, and finding that DcaE gene can be used for biodegradation of ester compounds at low temperature for the first time. The specific study work was as follows:

1. obtaining recombinant engineering strain containing DcaE gene

1) Amplifying DcaE gene from a genome of the deinococcus radiodurans by PCR, wherein the gene has the size of 939bp (the sequence is shown as SEQ ID NO. 1), encoding 312 amino acids (the sequence is shown as SEQ ID NO. 2), cloning the gene on a vector pET-32a, and constructing a recombinant plasmid pET32a-DcaE of the complete DcaE gene containing the T7 promoter, wherein the plasmid contains a T7 promoter which can play a role in escherichia coli;

2) Transferring the recombinant plasmid pET32a-DcaE introduced with the DcaE gene into receptor escherichia coli BL21 to obtain engineering strain BL21-pET32a-DcaE (see example 1 for details);

2. induced expression and purification of protein DcaE encoded by gene DcaE in E.coli

Experiments prove that the DcaE gene can be expressed in a large amount in escherichia coli, and purified to be pure protein by nickel column affinity chromatography

3. Detection experiment for degrading p-nitrophenyl ester substrate by protein DcaE

The invention adopts a universal accepted mode substrate p-nitrophenyl ester compound for detecting esterase functional genes, and determines the amount of p-nitrophenol generated after the p-nitrophenyl ester compound is decomposed by a colorimetric method, thereby identifying the activity of esterase DcaE.

The ester substrates measured were:

p-nitrophenylacetate pNPA (C2)

P-nitrophenol butyrate pNPB (C4)

P-nitrophenol octanoate pNPC (C8)

P-nitrophenol laurate pNPL (C12).

Experimental results show that DcaE protein coded by the D.radiodurans DcaE gene can degrade ester bonds of the p-nitrophenyl ester substrates so as to generate p-nitrophenol.

Wherein, the degradation of pNPC8 is optimal, and the enzyme activity can reach 32.14U/mg (see figure 2).

The experiment proves that the protein DcaE coded by the deinococcus radiodurans DcaE gene can degrade ester substrates and has esterase function.

4. DcaE protein has higher stability and activity under low temperature condition (between 10 ℃ and 40 ℃). See the examples for details.

Sequence list information

SEQ ID NO.1: DNA sequence of the gene.

SEQ ID NO.2: the amino acid sequence of DcaE.

Description of the drawings:

FIG. 1 protein DcaE purification gel.

FIG. 2 relative enzymatic activities of protein DcaE to degrade different substrates.

FIG. 3 Low temperature stability of protein DcaE enzyme activity.

Detailed Description

The plasmids, strains and objects of microorganism-catalyzed hydroxylation described in the examples below are only used for further details of the invention and are not limiting the substance of the invention. The specific experimental conditions are not specified, either according to conventional conditions well known to those skilled in the art or according to the manufacturer's recommendations. The plasmids, strain sources exemplified in the examples are as follows:

expression plasmid pET32a: commercial products are available from merck, germany;

coli BL21: is a commercial product of Beijing nuozan company.

EXAMPLE 1 construction of recombinant E.coli engineering Strain expressing the deinococcus radiodurans DcaE Gene

1. Experimental method

1. Designing a PCR specific primer pair of 1 according to the DcaE gene sequence in the published genome of the deinococcus radiodurans:

DcaE-F：5′CCATGGCTGATATCGGATCCATGCCCGTAGACCCCAACCT 3′

DcaE-R：5′CTCGAGTGCGGCCGCAAGCTTTCAGCCGCGCAGTTGCTCG 3′

2. the target gene sequence is amplified from the genome DNA of the deinococcus radiodurans by a PCR method.

PCR reaction procedure:

and 3, after the PCR product is recovered through glue, connecting the PCR product to a pET-32a vector containing a sticky end obtained through BamHI/HindIII double enzyme digestion through recombinase, and constructing an escherichia coli expression vector pET32a-DcaE.

4. The expression vector is transformed into escherichia coli BL21, the insertion sequence is verified to be correct through PCR and enzyme digestion and sequencing, and the strain is named BL21-pET32a-DcaE. E.coli BL21 containing pET32a control empty plasmid was designated BL21-pET32a.

2. Experimental results

Successfully constructs the recombinant escherichia coli engineering strain for expressing DcaE.

EXAMPLE 2 esterase Activity assay of recombinant engineering Strain containing deinococcus radiodurans DcaE Gene

Experimental materials

Recombinant engineering strain: BL21-pET32a-DcaE strain containing DcaE Gene obtained in example 1

Control strain: BL21-pET32a strain containing the empty plasmid described in example 1.

1. Experimental method

1. Inducible expression of esterase protein DcaE

(1) Inoculating the strain into 20mL LB liquid medium with antibiotics at an inoculum size of 1%, and culturing overnight at 37 ℃;

(2) On the next day by OD ₆₀₀ Transferring the bacterial liquid to 500mL LB liquid culture medium added with kanamycin for 0.1 of initial concentration inoculation amount, and culturing at 37 ℃ until the bacterial liquid concentration is 0.6-0.8;

(3) Adding IPTG (final concentration 0.1 mu mol/L) to carry out protein induction expression, wherein the induction condition is 25 ℃ for 6-8 h;

2. purification of recombinant esterase protein DcaE by affinity chromatography

(1) Centrifuging the induced bacterial liquid, collecting bacterial cells by 5000rpm for 10min, and re-suspending the bacterial cells by NTA-0;

(2) Ultrasonic crushing of bacterial liquid: placing a centrifuge tube containing suspended thalli in a beaker of an ice-water mixture, and placing the centrifuge tube in an ultrasonic breaker for ultrasonic treatment for 5-10 min, wherein the ultrasonic breaker is set with the following procedures: ultrasonic treatment is carried out for 3s and 5s, and the power is less than 400W;

(3) And (3) centrifuging the ultrasonically crushed sample 13000rm for 30min, respectively collecting supernatant and sediment of the crushed liquid by using a centrifuge tube, and obtaining the crushed supernatant which is crude enzyme liquid by centrifugation.

(4) Taking out the nickel column, washing the nickel column twice with deionized water after the ethanol flows out, and balancing the column with NTA-0, wherein the flow rate is kept at 1mL/min; the crude enzyme solution hangs the column, penetrates twice, and has the same flow rate;

(5) Gradient elution is carried out by using prepared NTA-10, NTA-30, NTA-50, NTA-80, NTA-100, NTA-150, NTA-200, NTA-250 and NTA-300, protein is detected by using protein detection liquid, and elution peaks are collected; washing the nickel column with 20% ethanol solution, and storing the nickel column in a refrigerator at 4deg.C; and (3) using ultrafiltration centrifugation to replace the buffer solution of the protein solution, so as to remove imidazole in the protein solution, wherein the obtained protein solution is enzyme solution (esterase protein DcaE).

3. Esterase protein DcaE Activity assay

The method is carried out by adopting a universal colorimetric method for measuring esterase activity and a universal substrate p-nitrophenyl ester compound.

The detection principle is that p-nitrophenyl phenol (pNP) is generated by hydrolyzing p-nitrophenyl ester compound substrate, the pNP is yellow and has an absorption peak at 410nm, and the enzyme activity of esterase is determined by detecting the content of the product pNP.

1 enzyme activity unit (U) is defined as: the amount of enzyme required to release 1. Mu. Mol of product pNP per unit time.

The preparation method of the p-nitrophenol (pNP) standard curve comprises the following steps: pNP 0.1391g was weighed and dissolved in 50mL of isopropyl alcohol to prepare a pNP mother liquor (20 mM), 10mL of the pNP mother liquor was taken and the volume was fixed to 100mL with isopropyl alcohol to obtain a pNP working liquor (2.0 mM). 8 groups of samples were added according to the addition amounts and operation steps of the various reagents in Table 1 (the volumes of the standard curves and the reaction conditions were the same as those of the actual measurement samples).

Enzyme activity assay reagent:

(1) Substrate solution: 0.3% of p-nitrophenylacetate pNPA (C2), p-nitrophenylacetate pNPB (C4), p-nitrophenylactoate pNPC (C8) and p-nitrophenylaurate pNPL (C12) were dissolved in isopropanol, respectively, and stored at 4 ℃.

(2) Buffer solution: 20mM Tris-HCl buffer (pH 7.5,0.11% acacia).

(3) Substrate test solution: the substrate solution is uniformly mixed with the buffer solution according to the proportion of 1:3 and then used as a substrate test solution.

Enzyme activity determination:

600. Mu.L of substrate test solution is added into a 1.5mL centrifuge tube, and 25. Mu.L of enzyme solution after proper dilution is added; control group was added with 25 μl of Tris-HCl buffer at ph=8;

after incubation at 30℃for 5min, the reaction was stopped by adding 500. Mu.L of 95% ethanol. The absorbance was measured at 410nm and the enzyme activity was calculated.

TABLE 1 pNP standard curve

Description: in the above experiments:

a. IPTG is an inducer that induces recombinant strains to express DcaE proteins and is not a substrate for a catalytic reaction;

b. the DcaE protein (33 kDa) is expressed as a fusion protein having a total molecular weight of approximately 53kDa as a fragment of a water-soluble protein (20 kDa) fused to the pET-32a vector (FIG. 1).

4. Influence of temperature on enzyme activity and thermostability of the enzyme

Enzyme solution is added into Tris-HCl buffer solution with pH value of 8, degradation activity of lipase/esterase is measured at different temperatures (5, 10, 20, 30, 40, 50, 60 and 70 ℃) respectively, and reaction is carried out for 5min, so that the optimal temperature of lipase is determined. Further study of the thermal stability of lipase/esterase: the purified enzyme solutions are respectively subjected to heat preservation for 6 hours at the temperature of 5, 10, 20, 30, 40 and 50 ℃, the activity of the residual enzyme is measured at the optimal temperature every 1 hour, and the relative enzyme activity is calculated by taking the highest enzyme activity as 100%.

3. Experimental results and conclusions

The p-nitrophenyl ester compound is a universal model substrate for detecting esterase functional genes, the amount of p-nitrophenol generated after the p-nitrophenyl ester compound is decomposed can be determined by a colorimetric method, and the activity of esterase is identified.

The DcaE protein coded by the deinococcus radiodurans DcaE gene can degrade ester bonds of p-nitrophenyl ester substrates (pNPC 2, pNPC4, pNPC8 and pNPC 12) to generate p-nitrophenol, wherein the degradation of the pNPC8 is optimal (figure 2), and the enzyme activity can reach 32.14U/mg.

DcaE protein shows higher stability between 10 ℃ and 40 ℃, retains over 80% of initial activity after incubation for 1h, and has 66.32% of residual activity after incubation for 6h at 40 ℃. However, after incubation for 1h at 50 ℃, the residual activity of DcaE drops sharply to about 56.31% (fig. 3).

Esters are widely present in nature, but esterases play a significant role in degrading natural substances, toxic substances, chiral drug separations, etc., for example esterases can improve the flavor of milk products, degrade pyrethrin pesticides, produce anti-inflammatory drugs such as ibuprofen, etc. Therefore, dcaE as a novel esterase has important application potential in the aspects of industrial production of detergents, food processing, cosmetics, pharmacy and the like, environmental restoration of degradation of ester pesticides and the like.

Sequence listing

<110> institute of biotechnology of national academy of agricultural sciences

<120> Low temperature esterase functional gene DcaE and application thereof

<160> 2

<170> PatentIn version 3.1

<210> 1

<211> 939

<212> DNA

<213> radiation resistant deinococcus (Deinococcus radiodurans)

<400> 1

atgcccgtag accccaacct gtaccaactt ctgctgcaac tctcgcaggc gcctgaaccc 60

gccggactgg aagaactgcg ggcgggcgtg atcgccaacg cggcgcgcag ccccaaacgt 120

ccggtgacta ttggcgaagt ccgtgacctg agcgtggcgg gcgcggaggg ctccctgccc 180

gcccgcctgt accaccccgc cgggcaggcc cccgcgtccg gctggccgct gacggtgttc 240

ttccacggtg gcggcttcgt ggtctacgac ctcgacaccc acgacgcgct gtgccgcgag 300

ctgtgcgcga cgtcgggcgc ggcggtgctg agcgtggcct accgcctcgc gcccgaagcc 360

cgctttcccg cgccggtaga cgacgccctg gcgagtgtgg tctgggccgc cgcgcacgcc 420

gccgaactcg gcgcagacgc ggggcgactc gcggtggcgg gcgacagcgc gggggccaac 480

ctcgccaccg tcacggcgct gcggtcgcgt gacgagggcg gcccggcttt gcgggcgcag 540

cttctcattt accccgccgc cgatttcgag caccccgaac gctaccccag ccgccaggaa 600

aacggacgcg gctatttcct cactgacgag cggatgcgct ttttcggaca gatgtacctt 660

gctcgcccgg aagacgccgc gcatccccac gcctcgccgc tcaacgctga gagtctcgcg 720

gggttgccgc cggccctggt cctgaccgcc gaattcgacc ccctgcgcga tgaaggcgcc 780

gcttacgccg aagctctcaa ggccgctggc gtaagcgccg agtaccgccc cggccccggc 840

atgattcacg gttacgccaa catgaccgcg ttttcgcccg tcgccgcaca actgattgac 900

gaggcgggcg tatggctcgg cgagcaactg cgcggctga 939

<210> 2

<211> 312

<212> PRT

<213> radiation resistant deinococcus (Deinococcus radiodurans)

<400> 2

Met Pro Val Asp Pro Asn Leu Tyr Gln Leu Leu Leu Gln Leu Ser Gln

1 5 10 15

Ala Pro Glu Pro Ala Gly Leu Glu Glu Leu Arg Ala Gly Val Ile Ala

20 25 30

Asn Ala Ala Arg Ser Pro Lys Arg Pro Val Thr Ile Gly Glu Val Arg

35 40 45

Asp Leu Ser Val Ala Gly Ala Glu Gly Ser Leu Pro Ala Arg Leu Tyr

50 55 60

His Pro Ala Gly Gln Ala Pro Ala Ser Gly Trp Pro Leu Thr Val Phe

65 70 75 80

Phe His Gly Gly Gly Phe Val Val Tyr Asp Leu Asp Thr His Asp Ala

85 90 95

Leu Cys Arg Glu Leu Cys Ala Thr Ser Gly Ala Ala Val Leu Ser Val

100 105 110

Ala Tyr Arg Leu Ala Pro Glu Ala Arg Phe Pro Ala Pro Val Asp Asp

115 120 125

Ala Leu Ala Ser Val Val Trp Ala Ala Ala His Ala Ala Glu Leu Gly

130 135 140

Ala Asp Ala Gly Arg Leu Ala Val Ala Gly Asp Ser Ala Gly Ala Asn

145 150 155 160

Leu Ala Thr Val Thr Ala Leu Arg Ser Arg Asp Glu Gly Gly Pro Ala

165 170 175

Leu Arg Ala Gln Leu Leu Ile Tyr Pro Ala Ala Asp Phe Glu His Pro

180 185 190

Glu Arg Tyr Pro Ser Arg Gln Glu Asn Gly Arg Gly Tyr Phe Leu Thr

195 200 205

Asp Glu Arg MET Arg Phe Phe Gly Gln MET Tyr Leu Ala Arg Pro Glu

210 215 220

Asp Ala Ala His Pro His Ala Ser Pro Leu Asn Ala Glu Ser Leu Ala

225 230 235 240

Gly Leu Pro Pro Ala Leu Val Leu Thr Ala Glu Phe Asp Pro Leu Arg

245 250 255

Asp Glu Gly Ala Ala Tyr Ala Glu Ala Leu Lys Ala Ala Gly Val Ser

260 265 270

Ala Glu Tyr Arg Pro Gly Pro Gly MET Ile His Gly Tyr Ala Asn MET

275 280 285

Thr Ala Phe Ser Pro Val Ala Ala Gln Leu Ile Asp Glu Ala Gly Val

290 295 300

Trp Leu Gly Glu Gln Leu Arg Gly

305 310

Claims (1)

1. The use of a gene having the sequence shown in SEQ ID NO:1 in a degradation reaction of an ester compound, wherein the degradation reaction is an ester bond hydrolysis reaction using an ester substrate and is performed at a low temperature.

Images