CN112430610A - Low-temperature esterase functional gene DcaE and application thereof - Google Patents

Abstract

The invention discloses a gene DcaE with a low-temperature esterase function. The invention constructs a recombinant vector containing the gene and expresses the recombinant vector in prokaryotic host cells escherichia coli. Experiments prove that the gene can catalyze ester substrates to carry out ester bond hydrolysis reaction at low temperature after being expressed in prokaryotic host cells, and is applied to degradation of various esters.

Description

Low-temperature esterase functional gene DcaE and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and relates to a gene with an esterase function.

Background

Compared with mesophilic enzyme and thermophilic enzyme, the esterase with low temperature activity has higher catalytic activity at low temperature. The esterase can effectively improve the industrial production efficiency in a low-temperature environment and save energy with minimum energy consumption, so the low-temperature esterase has important commercial value in various aspects of industrial application.

In the activity assay of microbial esterases, the substrate of the common mode currently accepted in the art is p-nitrophenyl ester compounds. Such as p-nitrophenol acetate pNPA, p-nitrophenol butyrate pNPB, p-nitrophenol octanoate pNPC, p-nitrophenol laurate pNPL, p-nitrophenol palmitate pNPP, etc.

Adding a protein into ester model substrate nitrophenyl ester compounds, and determining the enzyme activity of esterase by measuring the content of generated hydrolysis product p-nitrophenol (pNP). If there is a hydrolytic function for the model substrate, the protein is considered to have an esterase function.

Disclosure of Invention

The invention aims to find a low-temperature esterase gene for degradation reaction of ester compounds in biocatalysis.

In order to find an esterase suitable for industrial production, the present invention screened the gene DcaE (ADeinococcus cold-adapted Esterase), constructing a recombinant vector, expressing and purifying, and finding that the DcaE gene can be used for biodegradation of ester compounds at low temperature for the first time. The specific study work was as follows:

1. obtaining recombinant engineering strain containing DcaE gene

1) The DcaE gene is amplified from the genome of the deinococcus radiodurans through PCR, the gene size is 939bp (the sequence is shown as SEQ ID NO.1), the gene codes 312 amino acids (the sequence is shown as SEQ ID NO.2), the gene is cloned on a carrier pET-32a, the plasmid contains a T7 promoter which can play a role in escherichia coli, and a recombinant plasmid pET32a-DcaE of the complete DcaE gene containing the T7 promoter is constructed;

2) transferring the recombinant plasmid pET32a-DcaE introduced with the DcaE gene into a receptor escherichia coli BL21 to obtain an engineering strain BL21-pET32a-DcaE (see example 1 for details);

2. induced expression and purification of protein DcaE coded by gene DcaE in colibacillus

Experiments prove that the DcaE gene can be expressed in Escherichia coli in a large amount of solubility, and the pure protein is purified by nickel column affinity chromatography

3. Detection experiment for degrading p-nitrophenyl ester substrate by protein DcaE

The invention adopts a general accepted mode substrate p-nitrophenyl ester compound for detecting functional genes of esterase, measures the amount of p-nitrophenol generated after the decomposition of the p-nitrophenyl ester compound by a colorimetric method, and identifies the activity of the esterase DcaE.

The ester substrates tested were:

p-nitrophenol acetate pNPA (C2)

P-nitrophenol butyrate pNPB (C4)

P-nitrophenol octanoate pNPC (C8)

pNPL p-nitrophenol laurate (C12).

Experimental results show that DcaE protein coded by the deinococcus radiodurans DcaE gene can degrade ester bonds of the p-nitrophenyl ester substrate to generate p-nitrophenol.

Wherein, the degradation of the pNPC8 is optimal, and the enzyme activity can reach 32.14U/mg (shown in figure 2).

The above experiments confirm that protein DcaE encoded by deinococcus radiodurans DcaE gene can degrade ester substrates and has esterase function.

4. The DcaE protein has higher stability and activity under low temperature (between 10 ℃ and 40 ℃). See the examples for details.

Sequence Listing information

SEQ ID NO. 1: the DNA sequence of the gene.

SEQ ID NO. 2: the amino acid sequence of DcaE.

Description of the drawings:

FIG. 1 protein DcaE purification gel diagram.

FIG. 2 the relative enzyme activities of the protein DcaE to degrade different substrates.

FIG. 3 Low temperature stability of protein DcaE enzyme activity.

Detailed Description

The plasmids, strains and objects of catalytic hydroxylation by microorganisms mentioned in the following examples are provided only for further illustration of the present invention, and do not limit the essence of the present invention. Where specific experimental conditions are not indicated, they are in accordance with conventional conditions well known to those skilled in the art or as recommended by the manufacturer. The plasmids and strains mentioned in the examples were derived from:

expression plasmid pET32 a: commercially available from merck, germany;

escherichia coli BL 21: is a product sold by Beijing Novozam company.

Example 1 construction of recombinant engineering strains of Escherichia coli expressing the DcaE Gene of deinococcus radiodurans

First, experiment method

1. Designing 1 pair of PCR specific primers according to the published DcaE gene sequence in the genome of the deinococcus radiodurans:

DcaE-F：5′CCATGGCTGATATCGGATCCATGCCCGTAGACCCCAACCT 3′

DcaE-R：5′CTCGAGTGCGGCCGCAAGCTTTCAGCCGCGCAGTTGCTCG 3′

2. and amplifying a target gene sequence from the genome DNA of the deinococcus radiodurans by a PCR method.

PCR reaction procedure:

and 3, recovering the PCR product by using glue, and connecting the PCR product to a pET-32a vector containing a sticky end obtained by double enzyme digestion of BamHI/HindIII through a recombinase to construct an escherichia coli expression vector pET32 a-DcaE.

4. The expression vector is transformed into escherichia coli BL21, the correct insertion sequence is verified through PCR, enzyme digestion and sequencing, and the strain is named as BL21-pET32 a-DcaE. E.coli BL21 containing pET32a control empty plasmid was named BL21-pET32 a.

Second, experimental results

Successfully constructs a recombinant Escherichia coli engineering strain for expressing DcaE.

Example 2 esterase Activity test of recombinant engineered Strain containing deinococcus radiodurans DcaE Gene

Experimental Material

Recombinant engineering strains: DcaE gene-containing BL21-pET32a-DcaE strain obtained in example 1

Control strain: BL21-pET32a strain containing an empty plasmid as described in example 1.

First, experiment method

1. Inducible expression of esterase protein DcaE

(1) Inoculating the strain into 20mL LB liquid culture medium added with antibiotic by 1% of the inoculum size, and culturing overnight by a shaking table at 37 ℃;

(2) OD the next day₆₀₀Transferring the bacterial liquid into 500mL of LB liquid culture medium added with kanamycin for the inoculation amount of 0.1 initial concentration, and culturing at 37 ℃ until the bacterial liquid concentration is 0.6-0.8;

(3) adding IPTG (final concentration of 0.1 mu mol/L) to perform protein induction expression under the induction condition of 25 ℃ for 6-8 h;

2. affinity chromatography purification of recombinant esterase protein DcaE

(1) Centrifuging the induced bacterial liquid, collecting thalli at 5000rpm for 10min, and resuspending the thalli by NTA-0;

(2) ultrasonic crushing of bacterial liquid: placing a centrifugal tube containing suspended bacteria in a beaker of an ice-water mixture, placing the centrifugal tube in an ultrasonication instrument for ultrasonication for 5-10 min, wherein the ultrasonication instrument has the following setting procedures: stopping ultrasound for 3s and 5s, wherein the power is less than 400W;

(3) 13000rm of the sample after ultrasonic crushing is centrifuged for 30min, the supernatant and the precipitate of the crushing liquid are respectively collected by a centrifuge tube, and the crushing supernatant obtained by centrifugation is the crude enzyme liquid.

(4) Taking out the nickel column, after the ethanol flows out, firstly washing the nickel column twice by using deionized water, and then balancing the column by using NTA-0, wherein the flow rate is kept at 1 mL/min; hanging the crude enzyme solution on a column, penetrating twice, and keeping the flow rate the same as the above;

(5) gradient eluting with prepared NTA-10, NTA-30, NTA-50, NTA-80, NTA-100, NTA-150, NTA-200, NTA-250, and NTA-300, detecting protein with protein detection solution, and collecting elution peak; washing the nickel column with 20% ethanol solution, and storing the nickel column in a refrigerator at 4 deg.C; and (3) replacing the buffer solution of the protein solution by ultrafiltration centrifugation to remove imidazole in the protein solution, wherein the obtained protein solution is enzyme solution (esterase protein DcaE).

3. Determination of esterase protein DcaE Activity

The method is carried out by adopting a colorimetric method for measuring the activity of esterase and a general mode substrate p-nitrophenyl ester compound.

The detection principle is that p-nitrophenol (pNP) is generated by hydrolyzing a p-nitrophenyl ester compound substrate, the pNP is yellow and has an absorption peak at 410nm, and the enzyme activity of esterase is determined by detecting the content of the product pNP.

1 enzyme activity unit (U) is defined as: the amount of enzyme required to release 1. mu. mol of product pNP per unit time.

The method for preparing the p-nitrophenol (pNP) standard curve comprises the following steps: 0.1391g of pNP was weighed and dissolved in 50mL of isopropyl alcohol to prepare a pNP stock solution (20mM), and 10mL of the pNP stock solution was taken and made up to 100mL with isopropyl alcohol to obtain a pNP working solution (2.0 mM). 8 groups of samples were added according to the addition amounts of various reagents and the operation steps in Table 1 (the volume and the reaction conditions of the standard curve were consistent with those of the actual enzyme activity of the samples).

Enzyme activity determination reagent:

(1) substrate solution: 0.3% of p-nitrophenol acetate pNPA (C2), p-nitrophenol butyrate pNPB (C4), p-nitrophenol octanoate pNPC (C8), p-nitrophenol laurate pNPL (C12) were dissolved in isopropanol and stored at 4 ℃.

(2) Buffer solution: 20mM Tris-HCl buffer (pH7.5, 0.11% gum arabic).

(3) Substrate test solution: the substrate solution and the buffer solution are respectively mixed uniformly according to the proportion of 1:3 and then used as the substrate test solution.

And (3) enzyme activity determination:

adding 600 mu L of substrate test solution into a 1.5mL centrifuge tube, and adding 25 mu L of enzyme solution after appropriate dilution; control group was added with 25 μ L of Tris-HCl buffer at pH 8;

after incubation at 30 ℃ for 5min, 500. mu.L of 95% ethanol was added to terminate the reaction. And measuring the light absorption value at 410nm, and calculating the enzyme activity.

TABLE 1 pNP Standard Curve

Description of the drawings: in the above experiment:

a. IPTG is an inducer for inducing the recombinant strain to express DcaE protein and is not a substrate for catalyzing reaction;

b. the DcaE protein (33kDa) is expressed as a fusion protein, fused to a water-soluble protein (20kDa) of the pET-32a vector, having a total molecular weight of about 53kDa (FIG. 1).

4. Influence of temperature on enzyme Activity and thermal stability of enzymes

Adding the enzyme solution into Tris-HCl buffer solution with pH 8, respectively measuring the degradation activity of lipase/esterase at different temperatures (5, 10, 20, 30, 40, 50, 60 and 70 ℃), reacting for 5min, and determining the optimal temperature of the lipase. The thermostability of the lipase/esterase was further investigated: and (3) respectively keeping the purified enzyme solution at 5, 10, 20, 30, 40 and 50 ℃ for 6h, measuring the residual enzyme activity at the optimum temperature every 1h, and calculating the relative enzyme activity by taking the highest enzyme activity as 100%.

Third, experimental results and conclusions

The p-nitrophenyl ester compound is a universal mode substrate for detecting functional genes of the esterase, and the quantity of p-nitrophenol generated after the decomposition of the p-nitrophenyl ester compound can be measured by a colorimetric method to identify the activity of the esterase.

The DcaE protein coded by the deinococcus radiodurans DcaE gene can degrade ester bonds of p-nitrophenyl ester substrates (pNPC2, pNPC4, pNPC8 and pNPC12) to generate p-nitrophenol, wherein the degradation of the pNPC8 is optimal (figure 2), and the enzyme activity can reach 32.14U/mg.

The DcaE protein shows higher stability between 10 ℃ and 40 ℃, more than 80 percent of initial activity is kept after 1h of incubation, and 66.32 percent of residual activity is still kept after 6h of incubation at 40 ℃. However, after 1h incubation at 50 ℃, the residual activity of DcaE dropped dramatically to about 56.31% (fig. 3).

Esters are widely present in nature, and esterases have important roles in degrading natural substances, toxic substances, splitting chiral drugs and the like, for example, esterases can improve the flavor of milk products, degrade pyrethroid pesticides, produce anti-inflammatory drugs such as ibuprofen and the like. Therefore, DcaE as a novel esterase has important application potential in the aspects of industrial production of detergents, food processing, cosmetics, pharmacy and the like, environmental remediation of degradation of ester pesticides and the like.

Sequence listing

<110> institute of biotechnology of Chinese academy of agricultural sciences

<120> low-temperature esterase functional gene DcaE and application thereof

<160> 2

<170> PatentIn version 3.1

<210> 1

<211> 939

<212> DNA

<213> Deinococcus radiodurans (Deinococcus radiodurans)

<400> 1

atgcccgtag accccaacct gtaccaactt ctgctgcaac tctcgcaggc gcctgaaccc 60

gccggactgg aagaactgcg ggcgggcgtg atcgccaacg cggcgcgcag ccccaaacgt 120

ccggtgacta ttggcgaagt ccgtgacctg agcgtggcgg gcgcggaggg ctccctgccc 180

gcccgcctgt accaccccgc cgggcaggcc cccgcgtccg gctggccgct gacggtgttc 240

ttccacggtg gcggcttcgt ggtctacgac ctcgacaccc acgacgcgct gtgccgcgag 300

ctgtgcgcga cgtcgggcgc ggcggtgctg agcgtggcct accgcctcgc gcccgaagcc 360

cgctttcccg cgccggtaga cgacgccctg gcgagtgtgg tctgggccgc cgcgcacgcc 420

gccgaactcg gcgcagacgc ggggcgactc gcggtggcgg gcgacagcgc gggggccaac 480

ctcgccaccg tcacggcgct gcggtcgcgt gacgagggcg gcccggcttt gcgggcgcag 540

cttctcattt accccgccgc cgatttcgag caccccgaac gctaccccag ccgccaggaa 600

aacggacgcg gctatttcct cactgacgag cggatgcgct ttttcggaca gatgtacctt 660

gctcgcccgg aagacgccgc gcatccccac gcctcgccgc tcaacgctga gagtctcgcg 720

gggttgccgc cggccctggt cctgaccgcc gaattcgacc ccctgcgcga tgaaggcgcc 780

gcttacgccg aagctctcaa ggccgctggc gtaagcgccg agtaccgccc cggccccggc 840

atgattcacg gttacgccaa catgaccgcg ttttcgcccg tcgccgcaca actgattgac 900

gaggcgggcg tatggctcgg cgagcaactg cgcggctga 939

<210> 2

<211> 312

<212> PRT

<213> Deinococcus radiodurans (Deinococcus radiodurans)

<400> 2

Met Pro Val Asp Pro Asn Leu Tyr Gln Leu Leu Leu Gln Leu Ser Gln

1 5 10 15

Ala Pro Glu Pro Ala Gly Leu Glu Glu Leu Arg Ala Gly Val Ile Ala

20 25 30

Asn Ala Ala Arg Ser Pro Lys Arg Pro Val Thr Ile Gly Glu Val Arg

35 40 45

Asp Leu Ser Val Ala Gly Ala Glu Gly Ser Leu Pro Ala Arg Leu Tyr

50 55 60

His Pro Ala Gly Gln Ala Pro Ala Ser Gly Trp Pro Leu Thr Val Phe

65 70 75 80

Phe His Gly Gly Gly Phe Val Val Tyr Asp Leu Asp Thr His Asp Ala

85 90 95

Leu Cys Arg Glu Leu Cys Ala Thr Ser Gly Ala Ala Val Leu Ser Val

100 105 110

Ala Tyr Arg Leu Ala Pro Glu Ala Arg Phe Pro Ala Pro Val Asp Asp

115 120 125

Ala Leu Ala Ser Val Val Trp Ala Ala Ala His Ala Ala Glu Leu Gly

130 135 140

Ala Asp Ala Gly Arg Leu Ala Val Ala Gly Asp Ser Ala Gly Ala Asn

145 150 155 160

Leu Ala Thr Val Thr Ala Leu Arg Ser Arg Asp Glu Gly Gly Pro Ala

165 170 175

Leu Arg Ala Gln Leu Leu Ile Tyr Pro Ala Ala Asp Phe Glu His Pro

180 185 190

Glu Arg Tyr Pro Ser Arg Gln Glu Asn Gly Arg Gly Tyr Phe Leu Thr

195 200 205

Asp Glu Arg MET Arg Phe Phe Gly Gln MET Tyr Leu Ala Arg Pro Glu

210 215 220

Asp Ala Ala His Pro His Ala Ser Pro Leu Asn Ala Glu Ser Leu Ala

225 230 235 240

Gly Leu Pro Pro Ala Leu Val Leu Thr Ala Glu Phe Asp Pro Leu Arg

245 250 255

Asp Glu Gly Ala Ala Tyr Ala Glu Ala Leu Lys Ala Ala Gly Val Ser

260 265 270

Ala Glu Tyr Arg Pro Gly Pro Gly MET Ile His Gly Tyr Ala Asn MET

275 280 285

Thr Ala Phe Ser Pro Val Ala Ala Gln Leu Ile Asp Glu Ala Gly Val

290 295 300

Trp Leu Gly Glu Gln Leu Arg Gly

305 310

Claims (7)

1, the application of the gene of the sequence shown in SEQ ID NO.1 in catalyzing the degradation of esters by microorganisms.

2. The use as claimed in claim 1 as an esterase for the biocatalytic degradation of ester compounds.

3. The use according to claim 2, wherein the ester compound degradation reaction is an ester bond hydrolysis reaction using an ester substrate.

4. The use according to claim 2, wherein the degradation reaction of the ester compound is carried out at low temperature.

5. The use according to claim 1, wherein the microorganism is a prokaryote.

6. The DNA sequence of claim 1 encoding an amino acid sequence as set forth in SEQ ID NO 2.

7. Use of a protein according to the amino acid sequence of claim 5 in microbial catalysis of ester degradation.

Images