CN108865913B - Method for constructing recombinant bacterium capable of efficiently secreting and expressing chondroitin sulfate hydrolase - Google Patents
Method for constructing recombinant bacterium capable of efficiently secreting and expressing chondroitin sulfate hydrolase Download PDFInfo
- Publication number
- CN108865913B CN108865913B CN201810708252.8A CN201810708252A CN108865913B CN 108865913 B CN108865913 B CN 108865913B CN 201810708252 A CN201810708252 A CN 201810708252A CN 108865913 B CN108865913 B CN 108865913B
- Authority
- CN
- China
- Prior art keywords
- chondroitin sulfate
- sulfate hydrolase
- recombinant bacterium
- pichia pastoris
- hydrolase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
- C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y402/00—Carbon-oxygen lyases (4.2)
- C12Y402/02—Carbon-oxygen lyases (4.2) acting on polysaccharides (4.2.2)
- C12Y402/02005—Chondroitin AC lyase (4.2.2.5)
Abstract
The invention discloses a method for constructing recombinant bacteria for efficiently secreting and expressing chondroitin sulfate hydrolase, and belongs to the technical field of enzyme engineering. The invention adopts a pichia pastoris expression system to construct a method for expressing chondroitin sulfate hydrolase. The invention realizes the secretion expression of the chondroitin sulfate hydrolase in a pichia pastoris expression system, and plays an important role in promoting the industrial production of the chondroitin sulfate hydrolase.
Description
Technical Field
The invention relates to a method for constructing recombinant bacteria for efficiently secreting and expressing chondroitin sulfate hydrolase, belonging to the technical field of enzyme engineering.
Background
The polysaccharide is used as a macromolecular carbohydrate, widely exists in animals, plants and microorganisms, and has various biological activities of resisting tumors, viruses, oxidation, immunoregulation and the like. The polysaccharide mainly comprises disaccharide unit, including heparan sulfate, heparin, hyaluronic acid, chondroitin sulfate, and dermatan sulfate. The relative molecular mass of Chondroitin Sulfate (CS) has an important influence on its biological activity. Because macromolecular polysaccharide has large volume and is difficult to permeate cell membranes, so that various pharmacological functions of the macromolecular polysaccharide cannot be well exerted in a body, and low-molecular-weight CS has the characteristics of good solubility, small viscosity, easiness in absorption, high bioavailability and the like, the preparation and the application of the low-molecular-weight CS become hot points gradually in recent years.
At present, methods for reducing the relative molecular mass of polysaccharides are mainly biodegradation, chemical degradation, physical degradation and oxidative degradation. The biodegradation is mainly enzymatic degradation and is characterized by safety, high efficiency and higher cost; the chemical degradation can be divided into inorganic acid and organic acid, the inorganic acid degradation is simple and easy to implement, the cost is low, but the pollution is serious, the organic acid degradation is relatively safe, but the different organic acids have larger difference on the degradation efficiency of the polysaccharide; the removal rate of the low molecular sulfate radical obtained by acid degradation is high, unsaturated structures such as unsaturated uronic acid are generated, and the color of the product is orange. The physical degradation mainly comprises ultrasonic degradation and irradiation degradation, and is characterized in that the degradation process is easy to control and has no pollution; the oxidative degradation is mainly hydrogen peroxide degradation and is characterized by fewer byproducts and more concentrated relative molecular mass distribution.
Compared with other degradation methods, the enzymatic degradation method has the advantages of mild reaction conditions, no pollution, simple process, suitability for industrial production of CS oligosaccharide and greater advantage. However, the degradation mechanism of chondroitin sulfate by enzymes of different origins may be different, so that the structure and function of the finally produced CS oligosaccharide may also be different. The chondroitin sulfate lyase has the advantages that the cleavage effect contains unsaturated double bonds, and the chondroitin sulfate hydrolase has no unsaturated bonds.
Currently, there is no report of heterologous expression of chondroitinase: the gene for constructing recombinant strain secreting the chondroitin sulfate hydrolase is sourced from cattle, hosts Pichia pastoris GS115 and plasmids pPIC9K, and the defect fermentation period is long.
Disclosure of Invention
The first purpose of the invention is to provide a recombinant bacterium for constructing and efficiently secreting and expressing chondroitin sulfate hydrolase, wherein the recombinant bacterium takes Pichia pastoris GS115 as a host to express the chondroitin sulfate hydrolase derived from cattle.
In one embodiment of the present invention, the nucleotide sequence of the chondroitin sulfate hydrolase is represented by SEQ ID NO. 1.
In one embodiment of the present invention, the amino acid sequence of the chondroitin sulfate hydrolase gene is represented by SEQ ID NO. 2.
The second purpose of the invention is to provide a construction method of the recombinant bacterium, which comprises the following steps: connecting the chondroitin sulfate hydrolase gene with the nucleotide sequence of SEQ ID NO.1 to an expression vector pPIC9K, then transforming the chondroitin sulfate hydrolase gene into Pichia pastoris GS115, and screening a correct transformant to obtain the recombinant Pichia pastoris GS115/pPIC 9K-CHARE.
In one embodiment of the present invention, the recombinant bacterium is constructed by adding a histidine tag to a chondroitin sulfate hydrolase gene.
The third purpose of the invention is to provide a method for producing the chondroitin sulfate hydrolase by fermenting the recombinant bacterium, wherein the method adopts a methanol induction strategy to produce the chondroitin sulfate hydrolase in a fermentation tank.
In one embodiment of the invention, the fermentation method comprises the following specific steps:
inoculating YPD seed solution cultured in shake flask into 3L full-automatic fermenter (LiLUS GMBioTRON, korea) at 10%, controlling temperature at 25-30 deg.C, adjusting pH to 5-6 with 25% ammonia water, and stirring at initial speed of 500-1000 r.min -1 The ventilation volume is 2-4 L.min -1 The dissolved oxygen is maintained at more than 30-35%. Culturing for about 20-40h 600 About 70-80% for glycerol depletion, and adding 30-50% (W.V) in exponential flow -1 ) Glycerol solution (containing 12 mL. L.) -1 PTM 1), the stirring speed is related to dissolved oxygen, and the rotating speed is controlled to be 500-1000 r.min -1 Feeding for 12h, stopping feeding until glycerol is exhausted again, and OD 600 About 250 (dry weight about 60.0 g.L) -1 ) The rotating speed is 600-1000 r.min -1 And adding 100% methanol (containing 12 mL. L) -1 PTM 1), the methanol concentration is controlled to be 18.0 g.L -1 The induction temperature adopts induction strategies of 30 ℃,25 ℃,22 ℃ and stage control temperature respectively.
The fourth purpose of the invention is to provide a method for separating and purifying chondroitin sulfate hydrolase, which comprises the following specific steps: centrifuging the fermentation liquor, collecting supernatant, and sampling; using a Ni column, and balancing 10 column volumes of the column by using a phosphate buffer solution; gradient eluting with imidazole prepared from the above phosphate buffer solution at a concentration of 10 mmol.L -1 ，30mmol·L -1 ，200mmol·L -1 Gradient elution.
The invention has the beneficial effects that:
(1) The gene engineering bacteria constructed by the method of the invention are expressed in pichia pastoris, and are a method for rapidly producing chondroitin sulfate hydrolase. The purification is carried out by adopting a nickel column, and the method is simple and convenient.
(2) Pichia pastoris has a strong promoter AOX, high expression level, high stability of recombinant strains, heterologous protein genes and expression plasmids are integrated on a P.pastoris genome through homologous recombination, are replicated and inherited along with chromosomes and are not easy to lose. Has the post-translational modification processing functions of glycosylation, protein phosphorylation, fat phthalylation and the like. High adaptability and low requirement for nutrients. The protein secreted to the outside of the cell is less, and the culture medium does not contain protein, so that the downstream product can be easily separated and purified. The high-density fermentation process is mature and is easy to carry out amplification culture.
(3) The chondroitin sulfate hydrolase secreted and expressed by pichia has high expression quantity, stable enzymology property, pH resistance and wide temperature range.
Drawings
FIG. 1 is a plasmid map for constructing Chase in Pichia pastoris;
FIG. 2 shows that the enzyme Chase has the activity of hydrolyzing heparin in Pichia pastoris: adding inactivated enzyme into a substrate heparin of a control group A and adding CHase into a substrate of an experimental group B;
FIG. 3 shows that the detection of the activity of the Chase to hydrolyze Chondroitin Sulfate A (CSA) in Pichia pastoris: adding inactivated enzyme into a substrate CSA of a control group A and adding CHase into a substrate of an experimental group B;
FIG. 4 shows that the detection of the activity of the Chase to hydrolyze Chondroitin Sulfate C (CSC) in Pichia pastoris: adding inactivated enzyme into a substrate CSC of a control group A and adding CHase into a substrate of an experimental group B;
FIG. 5 is the SDS-PAGE electrophoresis result of CHase chondroitin sulfate hydrolase constructed in Pichia pastoris;
Detailed Description
BMGY medium: yeast powder 10g L –1 Peptone 20g L –1 10mL of glycerol L –1 100mM potassium phosphate buffer, 0.34% (mass percent) ammonia-freeBasic Yeast Nitrogen Source (YNB), 1% (NH) 4 ) 2 SO 4 ，4x 10 –5 % biotin, pH =6.0.
The method for measuring the enzyme activity of the chondroitin sulfate hydrolase comprises the following steps: 300 μ L of the substrates Heparin (HP) -fluorescein FITC, chondroitin sulfate A (CSA-fluorescein FITC), chondroitin sulfate C (CSC-fluorescein FITC) (2 mg mL) -1 ) 100 mul fermentation broth was added, hydrolyzed at 37 ℃ for 1h, and enzyme activity was detected using a fluorescence detector of HPLC.
Example 1: construction of recombinant strain containing chondroitin sulfate hydrolase gene Pichia pastoris
A construction method of a gene engineering bacterium for producing chondroitin sulfate hydrolase comprises the steps of cloning a chondroitin sulfate hydrolase gene (a nucleotide sequence is shown as SEQ ID NO. 1) by taking pichia pastoris as a host and pPIC9K as a vector, and adding a 6-his tag after gene ATG. Introducing an EcoR I restriction site into the upstream primer; introducing Not I restriction enzyme cutting sites into the downstream primer; after the gene CSHYDRO and the plasmid pPIC9K are subjected to enzyme cutting and purification by restriction enzymes EcoR I and Not I, the genes are connected overnight at 16 ℃ and transferred into Escherichia coli JM109 for amplification, and the plasmid with correct sequencing is selected and transferred into Pichia pastoris GS115 for expression to obtain the gene engineering bacterium Pichia pastoris GS115/pPIC9K-CHASE for producing the chondroitin sulfate hydrolase. The upstream primer and the downstream primer are as follows:
F:CCGGAATTCATGCATCACCATCACCA(SEQ ID NO:3)
R:AAGGAAAAAAGCGGCCGCTTAAGGTGGTTTCAAGAA(SEQ ID NO:4)
by adopting a similar method, a 6-his tag is added after ATG of a gene (the accession number on NCBI is-NM-001008413.3) with the nucleotide sequence shown as SEQ ID NO.5, then the ATG is cloned into pPIC9K, and a plasmid with correct sequencing is selected and transformed into Pichia pastoris GS115 for expression, so that a recombinant strain Pichia pastoris GS115/pPIC9K-CHASEQ is obtained.
Example 2: production of chondroitin sulfate hydrolase by shake flask horizontal fermentation
Taking recombinant Pichia pastoris GS115/pPIC 9K-CHARE containing recombinant chondroitin sulfate hydrolase gene as a production strain, inoculating a single colony in a YPD culture medium, and culturing at 28 ℃ under 200rmp overnight to obtain a seed culture solution; inoculating the seed culture solution into 25mL BMGY culture medium according to the inoculation amount of 2% by mass, adding 1% methanol into the culture medium for induction, and performing induction expression for 70h at the induction temperature of 28 ℃. After the fermentation is finished, as can be seen from fig. 2, a is a control, B is the effect after the fermentation broth supernatant is used for treatment, the main peak moves backwards, and the hydrolysis effect on heparin HP is achieved; as can be seen from FIG. 3, A is the control, B is the effect after the supernatant of the fermentation broth, the main peak is shifted backwards, and the hydrolysis effect on CSA (chondroitin sulfate A) is achieved; as can be seen from FIG. 4, A is the control and B is the effect after treatment with the fermentation broth supernatant, with a main peak shifted backwards and having a hydrolytic effect on CSC (chondroitin sulfate C). The enzyme activities of substrates FITC-HP, CSA-FITC and CSC-FITC are measured to be 300FI/mL, 500FI/mL and 450FI/mL.
Comparison: the recombinant strain Pichia pastoris GS115/pPIC9K-CHASEQ is subjected to fermentation culture by the same method, and has no activity on heparin and chondroitin sulfate.
Example 3: production of chondroitin sulfate hydrolase by horizontal fermentation in fermentation tank
Inoculating YPD seed solution cultured in shake flask into 3L automatic fermenter (LiLUS GM BioTRON, korea) at 10%, controlling temperature at 30 deg.C, adjusting pH to 5.5 with 25% ammonia water, and stirring at initial speed of 500 r.min -1 The ventilation rate is 2.5L/min -1 The dissolved oxygen is maintained above 30%. Culturing for about 28h 600 About 70-80% glycerol, 50% (W.V) in exponential flow -1 ) Glycerol solution (containing 12 mL. L) -1 PTM 1), the stirring speed is related to dissolved oxygen, and the rotating speed is controlled to be 500-1000 r.min -1 Feeding for 12h, stopping feeding until glycerol is exhausted again, and OD 600 About 250 (dry weight about 60.0 g.L) -1 ) The rotation speed is 1000 r.min -1 And 100% methanol (containing 12 mL. L) was fed-batch -1 PTM 1), the methanol concentration is controlled to be 18.0 g.L -1 The induction temperature adopts induction strategies of 30 ℃,25 ℃,22 ℃ and stage control temperature respectively, the highest enzyme activity of 96h fermentation is 5.5 times of the shake flask level, and the enzyme activities of substrates FITC-HP, CSA-FITC and CSC-FITC are determined to be 1650FI/mL, 2750FI/mL and 2475FI/mL.
Example 4: purification preparation of recombinant chondroitin sulfate hydrolase
Purifying the recombinant chondroitin sulfate hydrolase, comprising the following specific steps: using a 5mL Ni column, the column was purified by using a phosphate buffer (50 mmol. Multidot.L) -1 pH 7.0) column 10 column volumes. The fermentation supernatant was collected by centrifugation at 4 ℃ and 20mL of the supernatant was applied. Gradient elution with imidazole, imidazole prepared with the above phosphate buffer, at a concentration of 10 mmol. Multidot.L -1 ，30mmol·L -1 ，200mmo·L -1 Gradient elution is carried out, and the target protein is finally eluted. The eluted target protein is desalted and deimidazolated and stored at 4 ℃. The enzyme activity after purification is as follows: the activity of the enzyme on HP is 650FI/mL. As shown in FIG. 5, SDS-PAGE, lane 1 shows the chondroitin sulfate hydrolase in the supernatant of the fermentation broth, and lane 2 shows the band of the purified chondroitin sulfate hydrolase.
Example 5: determination of enzyme Properties
A series of solutions with pH values (4.0 to 11.0) were used to determine the optimum reaction pH for chondroitin sulfate hydrolase, and sodium acetate buffer (20mM, pH 4.0 to 5.0), phosphate buffer (20mM, pH 5.0 to 7.0), tris-HCl buffer (20mM, pH 7.0 to 9.0), and Gly-NaOH buffer (20mM, pH 9.0 to 11.0), respectively, were used to determine the optimum reaction pH of 4.5. The influence of different temperatures on the activity of the chondroitin sulfate hydrolase is mainly determined by adopting the temperature range of 20-70 ℃ and the optimal temperature of 37 ℃.
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
SEQUENCE LISTING
<110> university of south of the Yangtze river
<120> method for constructing recombinant bacterium capable of efficiently secreting and expressing chondroitin sulfate hydrolase
<130> 1
<160> 5
<170> PatentIn version 3.3
<210> 1
<211> 1425
<212> DNA
<213> Artificial sequence
<400> 1
atggggatgt tccggcggca tcatatctcc tttcggagct ttgctgggtc tagcggaaca 60
ccccaggcag tgttcacctt ccttctgctt ccgtgttgtt tggctctgga cttcagagca 120
ccccctctta tttcaaacac ttctttcctc tgggcctgga atgccccagt tgaacgttgt 180
gttaacagaa gatttcaact acctccagat ctgagactct tctctgtaaa aggaagcccc 240
cagaaaagtg ctaccggaca atttattaca ttattttatg ctgatagact tggctactat 300
cctcatatag atgaaaaaac aggcaaaacc gtattcggag gacataagtt gttgagaaag 360
tctactttca agaacgctaa gttgtacggt ccagatgttg gtcaacctag aagaaagact 420
gctaaaatgt tgaagtcttt cttgaaagct ggtggtgaag ttattgattc tgttacttgg 480
catcactact atttgaacgg tagaactgct actagagagg atttcttgaa ccctgatgtt 540
ttggatattt tcatttcttc tgttcaaaag gttttccaag ttgttgaatc tactagacca 600
ggtaaaaagg tttggttggg agagacttct tctgcttatg gtggtggtgc tccattgttg 660
tctgatactt ttgctgctgg tttcatgtgg ttggataaat tgggtttgtc tgctagaatg 720
ggtatcgaag ttgttatgag acaagttttc gagtggttgt ggaaggaaag cactgccctt 780
ttcccttctg tttatttgaa tatcaggtta aaatctactc aaaatgctgc cttgtatgtt 840
cgtaatcgtg tccaggaagc cattcggttg tctaaaatag cgagtgtcga aagtccactt 900
ccggtttttg tatatgcccg tccagttttt actgatgggt cttcaacata tctttctcag 960
ggtgaccttg tgaattcggt tggtgagatc gtttctctag gtgcctctgg gattataatg 1020
tggggcagtc tcaatctaag cttatctgtg caatcttgca tgaacctagg cacttacttg 1080
aacactacac tgaatcctta cataatcaac gtcaccctag ccgccaaaat gtgcagccaa 1140
gtgctttgcc atgatggagg agtgtgtaca aggaaacact ggaattcaag cgactatctt 1200
cacctgaacc caatgaattt tgctattcaa actggggaag gtggaaaata cacagtacct 1260
ggaacactga cacttgaaga cctgcagaaa ttttctgata cattttattg cagctgttat 1320
agcaacttga gttgtaagaa gagagttgat ataaaaaacg ttcattctgt tgatgtgtgt 1380
atggctgaag atgtctgtat agatgctttt ctaaaacctc cctga 1425
<210> 2
<211> 474
<212> PRT
<213> Artificial sequence
<400> 2
Met Gly Met Phe Arg Arg His His Ile Ser Phe Arg Ser Phe Ala Gly
1 5 10 15
Ser Ser Gly Thr Pro Gln Ala Val Phe Thr Phe Leu Leu Leu Pro Cys
20 25 30
Cys Leu Ala Leu Asp Phe Arg Ala Pro Pro Leu Ile Ser Asn Thr Ser
35 40 45
Phe Leu Trp Ala Trp Asn Ala Pro Val Glu Arg Cys Val Asn Arg Arg
50 55 60
Phe Gln Leu Pro Pro Asp Leu Arg Leu Phe Ser Val Lys Gly Ser Pro
65 70 75 80
Gln Lys Ser Ala Thr Gly Gln Phe Ile Thr Leu Phe Tyr Ala Asp Arg
85 90 95
Leu Gly Tyr Tyr Pro His Ile Asp Glu Lys Thr Gly Lys Thr Val Phe
100 105 110
Gly Gly His Lys Leu Leu Arg Lys Ser Thr Phe Lys Asn Ala Lys Leu
115 120 125
Tyr Gly Pro Asp Val Gly Gln Pro Arg Arg Lys Thr Ala Lys Met Leu
130 135 140
Lys Ser Phe Leu Lys Ala Gly Gly Glu Val Ile Asp Ser Val Thr Trp
145 150 155 160
His His Tyr Tyr Leu Asn Gly Arg Thr Ala Thr Arg Glu Asp Phe Leu
165 170 175
Asn Pro Asp Val Leu Asp Ile Phe Ile Ser Ser Val Gln Lys Val Phe
180 185 190
Gln Val Val Glu Ser Thr Arg Pro Gly Lys Lys Val Trp Leu Gly Glu
195 200 205
Thr Ser Ser Ala Tyr Gly Gly Gly Ala Pro Leu Leu Ser Asp Thr Phe
210 215 220
Ala Ala Gly Phe Met Trp Leu Asp Lys Leu Gly Leu Ser Ala Arg Met
225 230 235 240
Gly Ile Glu Val Val Met Arg Gln Val Phe Glu Trp Leu Trp Lys Glu
245 250 255
Ser Thr Ala Leu Phe Pro Ser Val Tyr Leu Asn Ile Arg Leu Lys Ser
260 265 270
Thr Gln Asn Ala Ala Leu Tyr Val Arg Asn Arg Val Gln Glu Ala Ile
275 280 285
Arg Leu Ser Lys Ile Ala Ser Val Glu Ser Pro Leu Pro Val Phe Val
290 295 300
Tyr Ala Arg Pro Val Phe Thr Asp Gly Ser Ser Thr Tyr Leu Ser Gln
305 310 315 320
Gly Asp Leu Val Asn Ser Val Gly Glu Ile Val Ser Leu Gly Ala Ser
325 330 335
Gly Ile Ile Met Trp Gly Ser Leu Asn Leu Ser Leu Ser Val Gln Ser
340 345 350
Cys Met Asn Leu Gly Thr Tyr Leu Asn Thr Thr Leu Asn Pro Tyr Ile
355 360 365
Ile Asn Val Thr Leu Ala Ala Lys Met Cys Ser Gln Val Leu Cys His
370 375 380
Asp Gly Gly Val Cys Thr Arg Lys His Trp Asn Ser Ser Asp Tyr Leu
385 390 395 400
His Leu Asn Pro Met Asn Phe Ala Ile Gln Thr Gly Glu Gly Gly Lys
405 410 415
Tyr Thr Val Pro Gly Thr Leu Thr Leu Glu Asp Leu Gln Lys Phe Ser
420 425 430
Asp Thr Phe Tyr Cys Ser Cys Tyr Ser Asn Leu Ser Cys Lys Lys Arg
435 440 445
Val Asp Ile Lys Asn Val His Ser Val Asp Val Cys Met Ala Glu Asp
450 455 460
Val Cys Ile Asp Ala Phe Leu Lys Pro Pro
465 470
<210> 3
<211> 26
<212> DNA
<213> Artificial sequence
<400> 3
ccggaattca tgcatcacca tcacca 26
<210> 4
<211> 36
<212> DNA
<213> Artificial sequence
<400> 4
aaggaaaaaa gcggccgctt aaggtggttt caagaa 36
<210> 5
<211> 1662
<212> DNA
<213> Artificial sequence
<400> 5
atgagaatgc tgaggcgcca ccatatctcc tttcggagct ttgctgggtc tagcggaaca 60
ccccaggcag tgttcacctt ccttctgctt ccgtgttgtt tggctctgga cttcagagca 120
ccccctctta tttcaaacac ttctttcctc tgggcctgga atgccccagt tgaacgttgt 180
gttaacagaa gatttcaact acctccagat ctgagactct tctctgtaaa aggaagcccc 240
cagaaaagtg ctaccggaca atttattaca ttattttatg ctgatagact tggctactat 300
cctcatatag atgaaaaaac aggcaaaacc gtattcggag gaattcccca gttgggaaac 360
ttaaaaagtc atttggagaa agcaaaaaat gacattgcct attacatacc aaatgacagc 420
gtgggcttgg cggtcattga ctgggaaaac tggaggccta cctgggcaag aaactggaaa 480
cctaaagatg tttacaggga tgagtcagtt gagttggttc tgcaaaaaaa tccgcaactc 540
agtttcccag aggcttccaa gattgcaaaa gtggattttg agacagcagg aaagagtttc 600
atgcaagaga ctttaaaact gggaaaatta cttcggccaa atcacttatg gggttattat 660
ctttttcctg attgttacaa tcataatcat aaccaaccta cttacaatgg aaattgccct 720
gatgtagaaa aaaggagaaa tgatgatctc gagtggttgt ggaaggaaag cactgccctt 780
ttcccttctg tttatttgaa tatcaggtta aaatctactc aaaatgctgc cttgtatgtt 840
cgtaatcgtg tccaggaagc cattcggttg tctaaaatag cgagtgtcga aagtccactt 900
ccggtttttg tatatgcccg tccagttttt actgatgggt cttcaacata tctttctcag 960
ggtgaccttg tgaattcggt tggtgagatc gtttctctag gtgcctctgg gattataatg 1020
tggggcagtc tcaatctaag cttatctatg caatcttgca tgaacctagg cacttacttg 1080
aacactacac tgaatcctta cataatcaac gtcaccctag ccgccaaaat gtgcagccaa 1140
gtgctttgcc acaatgaagg agtgtgtaca aggaaacact ggaattcaag cgactatctt 1200
cacctgaacc caatgaattt tgctattcaa actggggaag gtggaaaata cacagtacct 1260
gggacagtca cacttgaaga cttgcaaaag ttttctgata cattttattg cagttgttat 1320
gccaacatcc actgtaagaa gagagttgat ataaaaaatg ttcatagtgt taacgtgtgt 1380
atggcagaag acatttgtat agacagccct gtgaagttac aacccagtga tcattcctcc 1440
agccaggagg catctactac caccttcagc agtatctcac cctccactac aactgccaca 1500
gtatctccat gtactcctga gaaacactcc cctgagtgcc tcaaagtcag gtgttcggaa 1560
gtcatcccca acgtcaccca aaaggcgtgt caaagtgtta aattgaagaa catttcctat 1620
cagtcaccta ttcaaaatat taaaaatcaa acaacctatt aa 1662
Claims (9)
1. The recombinant bacterium for secretory expression of chondroitin sulfate hydrolase is characterized in that the recombinant bacterium is pichia pastorisPichia pastoris GS115Expressing chondroitin sulfate hydrolase derived from cattle as a host, wherein an amino acid sequence coded by the chondroitin sulfate hydrolase gene is shown as SEQ ID NO. 2.
2. The recombinant bacterium according to claim 1, wherein the nucleotide sequence of the chondroitin sulfate hydrolase gene is represented by SEQ ID No. 1.
3. The recombinant bacterium according to claim 1, wherein the recombinant bacterium is constructed by a method comprising: the chondroitin sulfate hydrolase gene with the nucleotide sequence of SEQ ID NO.1 is connected to an expression vector pPIC9K and then is transformed into pichia pastorisPichia pastoris GS115Screening correct transformant to obtain recombinant Pichia pastorisPichia pastoris GS115/pPIC9K-CHASE。
4. The recombinant bacterium according to claim 3, wherein the recombinant bacterium is constructed by adding a nucleotide sequence encoding a histidine tag to the chondroitin sulfate hydrolase gene.
5. A method for producing a chondroitin sulfate hydrolase, which comprises using the recombinant bacterium according to any one of claims 1 to 4.
6. The method of claim 5, wherein the chondroitin sulfate hydrolase is produced fermentatively in a fermentor using a methanol induction strategy.
7. The method according to claim 5, characterized in that the method comprises the following specific steps:
inoculating YPD seed liquid cultured in shake flask into 3L full-automatic fermentation tank at 10 vol%, controlling temperature at 25-30 deg.C, adjusting pH to 5-6 with 25% ammonia water, and stirring at initial rotation speed of 500-1000 r.min -1 The ventilation rate is 2-4 L.min -1 The dissolved oxygen is maintained at more than 30 percent to 35 percent, the culture is carried out for 20 to 40 hours 600 70-80 until the glycerol is exhausted, the mass volume ratio of the exponential flow and the addition is 30-50%, and the glycerol content is 12 mL.L -1 Stirring speed of glycerol solution of PTM1 is related to dissolved oxygen, and the control speed is 500-1000 r.min -1 Feeding for 12h, stopping feeding until glycerol is exhausted again, and OD 600 About 250 g.L dry weight of about 60.0 g.L -1 The rotating speed is 600-1000 r.min -1 And 100% of the mixture is fed-batch and contains 12 mL.L -1 The methanol concentration of PTM1 is controlled at 18.0 g.L -1 The induction temperature adopts 30 ℃,25 ℃ and 22 ℃ and a stage control temperature induction strategy respectively.
8. The method for separating and purifying chondroitin sulfate hydrolase according to claim 1.
9. The separation and purification method according to claim 8, comprising the following steps: centrifuging the fermentation liquor, collecting supernatant, and sampling; using a Ni column, and using a phosphate buffer solution to balance the volume of the column by 10 columns; gradient eluting with imidazole prepared from the above phosphate buffer solution at a concentration of 10 mmol.L -1 ，30 mmol·L -1 ，200 mmol·L -1 Gradient elution.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810708252.8A CN108865913B (en) | 2018-07-02 | 2018-07-02 | Method for constructing recombinant bacterium capable of efficiently secreting and expressing chondroitin sulfate hydrolase |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810708252.8A CN108865913B (en) | 2018-07-02 | 2018-07-02 | Method for constructing recombinant bacterium capable of efficiently secreting and expressing chondroitin sulfate hydrolase |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108865913A CN108865913A (en) | 2018-11-23 |
| CN108865913B true CN108865913B (en) | 2022-10-11 |
Family
ID=64297990
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810708252.8A Active CN108865913B (en) | 2018-07-02 | 2018-07-02 | Method for constructing recombinant bacterium capable of efficiently secreting and expressing chondroitin sulfate hydrolase |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108865913B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109988723B (en) * | 2018-11-27 | 2021-07-27 | 常熟理工学院 | Recombinant yeast for producing chondroitin sulfate ABC lyase and construction method and application thereof |
| CN113637599B (en) * | 2021-09-06 | 2023-04-28 | 江南大学 | Food-grade safe saccharomycete for producing chondroitin sulfate lyase ABCI and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001039795A2 (en) * | 1999-12-02 | 2001-06-07 | Ibex Technologies, Inc. | Attenuation of fibroblast proliferation |
| CN107312738A (en) * | 2017-07-26 | 2017-11-03 | 江南大学 | A kind of recombination bacillus coli and its construction method of efficient production fructose chondroitin |
-
2018
- 2018-07-02 CN CN201810708252.8A patent/CN108865913B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001039795A2 (en) * | 1999-12-02 | 2001-06-07 | Ibex Technologies, Inc. | Attenuation of fibroblast proliferation |
| CN107312738A (en) * | 2017-07-26 | 2017-11-03 | 江南大学 | A kind of recombination bacillus coli and its construction method of efficient production fructose chondroitin |
Non-Patent Citations (3)
| Title |
|---|
| Cloning and characterization of a novel chondroitin sulfate/dermatan sulfate 4-O-endosulfatase from a marine bacterium;Wenshuang Wang;《J Biol Chem》;20150203;第290卷(第12期);第7823-7832页 * |
| Role of hyaluronidases in the catabolism of chondroitin sulfate;Shuhei Yamada;《Adv Exp Med Biol》;20151231;第188页表12.2，第2段第5-7行 * |
| 糖胺聚糖的结构修饰及其衍生物应用的研究进展;高娜;《中国生化药物杂志》;20121231;第33卷(第3期);第307-311页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108865913A (en) | 2018-11-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108285900B (en) | Recombinant alginate lyase and construction method and application thereof | |
| CN107574159B (en) | Mutant of glutamine transaminase expressed in active form | |
| CN107739734B (en) | Glutamine transaminase mutant with improved enzyme activity | |
| CN106995811B (en) | A kind of algin catenase, preparation method and application | |
| CN112725319B (en) | Alginate lyase FaAly7 with polyG substrate specificity and application thereof | |
| CN110106156B (en) | Feruloyl esterase EpFAE1 and coding gene and application thereof | |
| CN110713996B (en) | Trehalase, and carrier and application thereof | |
| WO2022183542A1 (en) | Gene for efficiently expressing hyaluronic acid hydrolase and expression method thereof | |
| CN108865913B (en) | Method for constructing recombinant bacterium capable of efficiently secreting and expressing chondroitin sulfate hydrolase | |
| CN111996205A (en) | Chitinase gene, chitinase and preparation method and application thereof | |
| CN107746836B (en) | Glutamine transaminase mutant expressed in active form | |
| CN111041013B (en) | Algin lyase or pectinase and application thereof in cooperative degradation of brown algae | |
| CN111424048A (en) | Gene for expressing acidic β -mannase, vector and application thereof | |
| CN114761553A (en) | Nucleic acids, vectors, host cells and methods for producing beta-fructofuranosidase from aspergillus niger | |
| CN108410903B (en) | The endo-xylanase and its encoding gene of a kind of resistance to low ph value and application | |
| CN112522125B (en) | Hyaluronidase engineering bacterium and construction method and application thereof | |
| CN110951716B (en) | Circumscribed alginate lyase VsAly7D, recombinant strain thereof and application thereof | |
| CN110564748B (en) | Poria cocos cellulose endonuclease gene and expression vector and protein thereof | |
| CN108165540B (en) | Rhizomucor miehei alpha-amylase and coding gene and application thereof | |
| CN103667212B (en) | Glucoamylase and application thereof | |
| CN106978410B (en) | Bifunctional glucanase with chitosan hydrolysis activity, gene, vector, engineering bacterium and application thereof | |
| CN114746548A (en) | Nucleic acids, vectors, host cells and methods for producing fructosyltransferase from aspergillus japonicus | |
| CN114807094B (en) | Chitosan SvChiAJ54 and encoding gene and application thereof | |
| CN115232805B (en) | Chondroitin sulfate lyase, recombinant strain and application thereof | |
| CN112831511B (en) | Exo-algin lyase, and coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |