CN115074341B - Application of 238 th serine residue modification in improvement of esterase DcaE4 activity - Google Patents

Abstract

Use of a serine residue at position 238 engineered to increase the activity of esterase DcaE4. The present disclosure relates to a method for increasing esterase activity, a protein having esterase activity, a gene encoding the protein, a recombinant vector into which the gene is inserted, a transformant transformed with the gene, a method for producing esterase, and an application of esterase in degrading p-nitrophenyl ester compounds. The method realizes amino acid optimization of key sites of the esterase and improves the use effect of the esterase in the fields of biopharmaceutical, bioremediation, low-temperature washing and the like.

Description

Application of 238 th serine residue modification in improvement of esterase DcaE4 activity

RELATED APPLICATIONS

The application relates to a division application of Chinese patent application with the application number of 202110469012.9, wherein the application date is 28 of 2021 and 04.

Technical Field

The present disclosure relates to biotechnology, and in particular, to a method for increasing esterase activity, a protein having esterase activity, a gene encoding the protein, a recombinant vector into which the gene is inserted, a transformant transformed with the gene, a method for preparing esterase, and an application of esterase in degrading p-nitrophenyl ester compounds.

Background

Esterases are a class of enzymes capable of catalyzing the cleavage and formation of various ester bonds, the structure of which generally consists of a cap domain at the N-terminus and an alpha/beta hydrolase catalytic domain at the C-terminus. The N-terminal cap domain is usually two alpha helices located directly above the active center, the C-terminal catalytic domain contains a Ser-Asp-His catalytic triplet of multiple phosphorylation sites, and an oxyanion hole that stabilizes the tetrahedral intermediate states, which are critical for the catalytic characteristics and engineering of the esterase. Most esterases have a certain stereoselectivity, regioselectivity and a wide substrate spectrum, and can be applied to various industrial fields, while cold adaptive esterases have the characteristics of stable products, energy conservation and environmental protection due to low-temperature activity, so that the esterases are widely focused on application in the fields of bio-pharmacy, bioremediation, low-temperature washing and the like.

The extreme microorganism adapts to extreme environments such as high temperature, low temperature, high pressure and the like in natural evolution, and is a high-quality source of extreme enzyme gene resources. The variety of the enzyme preparation produced at present is single, and the industrial requirement cannot be met, so that the development of enzyme resources with special performance is still required. The heat stability of the biological enzyme is generally poor, which is unfavorable for industrial application, so the improvement of the heat stability of the enzyme is particularly important.

Therefore, it is desirable to provide a method for optimizing esterases, increasing the efficiency of the degrading enzyme and enhancing the thermostability of the enzyme.

Disclosure of Invention

In order to further meet the demands of practical application, the disclosure provides a method for improving esterase activity, a protein with esterase activity, a gene for encoding the protein, a recombinant vector inserted with the gene, a transformant transformed with the gene, a method for preparing esterase and application of esterase in degrading p-nitrophenyl ester compounds.

A first aspect of the present disclosure provides a method for increasing esterase activity, the method comprising mutating one or more of the amino acid residues to be mutated of a wild-type esterase, wherein the amino acid sequence of the wild-type esterase is shown in SEQ ID No.2, and the amino acid residues to be mutated comprise a serine amino acid residue at position 132, a threonine residue at position 163, a serine residue at position 238, and a tyrosine residue at position 285; the mutations are engineered to be substitutions of amino acid residues.

In a second aspect, the disclosure provides a protein with esterase activity, wherein the protein is derived from a wild-type esterase shown in SEQ ID NO.2 by substitution of 1, 2, 3 or 4 amino acids in the amino acid sequence; and the amino acid sequence of the protein is shown as SEQ ID NO. 1.

In a third aspect of the present disclosure, there is provided a gene encoding the protein of the second aspect, wherein the gene is a DNA molecule having a nucleotide sequence shown in SEQ ID No.3, 4, 5 or 6.

In a fourth aspect of the present disclosure, there is provided a recombinant vector in which the gene according to the second aspect is inserted.

A fifth aspect of the present disclosure provides a transformant, wherein the host of the transformant is a genetically engineered bacterium; the gene introduced into the transformant includes the gene described in the second aspect, or the recombinant vector introduced into the transformant includes the recombinant vector described in the fourth aspect.

A sixth aspect of the present disclosure provides a method of preparing an esterase, wherein the method comprises: inoculating the transformant of the fifth aspect into a culture medium for culturing, and obtaining a cultured material.

In a seventh aspect, the disclosure provides an esterase for degrading p-nitrophenyl esters, wherein the esterase comprises a protein according to the second aspect.

Through the technical scheme, the disclosure provides a method for improving esterase activity, a protein with esterase activity, a gene for encoding the protein, a recombinant vector inserted with the gene, a transformant transformed with the gene, a method for preparing esterase and application of esterase in degrading p-nitrophenyl ester compounds, and has important application value in optimizing and modifying the esterase.

Additional features and advantages of the present disclosure will be set forth in the detailed description which follows.

Drawings

The accompanying drawings are included to provide a further understanding of the disclosure, and are incorporated in and constitute a part of this specification, illustrate the disclosure and together with the description serve to explain, but do not limit the disclosure. In the drawings:

FIG. 1 shows the enzymatic activities of the esterase DcaE4 and mutant S132.

FIG. 2 shows the enzymatic activities of the esterase DcaE4 and mutant T163.

FIG. 3 shows the enzymatic activity of the esterase DcaE4 and mutant S238.

FIG. 4 shows the enzymatic activities of the esterase DcaE4 and mutant Y285.

FIG. 5 is an optimal temperature (A) thermostability (B) and half-life measurements of esterase DcaE4 and mutants at 40℃and 50℃at C.

Detailed Description

Specific embodiments of the present disclosure are described in detail below with reference to the accompanying drawings. It should be understood that the detailed description and specific examples, while indicating and illustrating the disclosure, are not intended to limit the disclosure.

A first aspect of the present disclosure provides a method for increasing esterase activity, the method comprising mutating one or more of the amino acid residues to be mutated of a wild-type esterase, wherein the amino acid sequence of the wild-type esterase is shown in SEQ ID No.2, and the amino acid residues to be mutated comprise a serine amino acid residue at position 132, a threonine residue at position 163, a serine residue at position 238, and a tyrosine residue at position 285; the mutations are engineered to be substitutions of amino acid residues.

According to the present disclosure, wherein, optionally, the mutational alteration comprises at least one of the following (a) to (d):

(a) Mutating the 132 th silk amino acid residue to one of an alanine residue, a tryptophan residue, a valine residue, a proline residue, an arginine residue, a histidine residue, a glutamine residue, a glutamic acid residue and a tyrosine residue;

(b) Mutating threonine residue at 163 to one of alanine residue, histidine residue, leucine residue, aspartyl amino residue, arginine residue, lysine residue, cysteine residue, glutamic acid residue;

(c) Mutating serine residue at position 238 to one of asparagine residue, aspartic acid residue, arginine residue, histidine residue, lysine residue, asparagine residue, tyrosine residue, proline residue, valine residue, tryptophan residue;

(d) The 285 th tyrosine residue is mutated into one of tryptophan residue, phenylalanine residue, valine residue, arginine residue, histidine residue, serine residue, glutamic acid residue and cysteine residue.

Wherein the mutant modifications of (a) to (d) above may be arbitrarily combined in the same esterase.

Preferably, the mutant engineering includes any one of the following (i) to (iv):

(i) Mutating the amino acid residue at position 132 to an alanine residue;

(ii) Mutating threonine residue 163 to alanine residue;

(iii) Mutating serine residue 238 to asparagine residue;

(iv) The tyrosine residue at position 285 was mutated to phenylalanine residue.

In a second aspect, the disclosure provides a protein with esterase activity, wherein the protein is derived from a wild-type esterase shown in SEQ ID NO.2 by substitution of 1, 2, 3 or 4 amino acids in the amino acid sequence; and the amino acid sequence of the protein is shown as SEQ ID NO. 1.

According to the disclosure, the amino acid sequence of the protein is shown as SEQ ID NO.3, 4, 5 or 6.

In a third aspect the present disclosure provides a gene encoding the protein of the second aspect, wherein the gene is a DNA molecule having the nucleotide sequence shown in SEQ ID No.7, 8, 9 or 10.

In a fourth aspect of the present disclosure, there is provided a recombinant vector in which the gene according to the second aspect is inserted.

According to the present disclosure, the recombinant vector may be a recombinant expression vector or a recombinant cloning vector, and the recombinant expression vector is a DNA molecule having a nucleotide sequence shown as SEQ ID No.11, 12, 13 or 14.

Wherein SEQ ID NO.12 differs from SEQ ID NO.11 in that: the 5659 th base in the nucleotide sequence of SEQ ID NO.12 is G; SEQ ID NO.13 differs from SEQ ID NO.11 in that: the 6026 base in the nucleotide sequence of SEQ ID NO.13 is T; SEQ ID NO.14 differs from SEQ ID NO.11 in that: the 5885 base in the nucleotide sequence of SEQ ID NO.14 is A.

A fifth aspect of the present disclosure provides a transformant, wherein the host of the transformant is a genetically engineered bacterium; the gene introduced into the transformant includes the gene described in the second aspect, or the recombinant vector introduced into the transformant includes the recombinant vector described in the fourth aspect.

According to the present disclosure, the genetically engineered bacterium may be a wild-type genetically engineered bacterium or an artificially modified genetically engineered bacterium, for example, at least one of escherichia coli BL21 (DE 3) competent cells, bacillus subtilis, pichia pastoris, saccharomyces cerevisiae, and filamentous fungi.

A sixth aspect of the present disclosure provides a method of preparing an esterase, wherein the method comprises: inoculating the transformant of the fifth aspect into a culture medium for culturing, and obtaining a cultured material.

Among them, the medium and the culture conditions may be any of known various suitable choices. The cultured material contains the protein with esterase activity provided in the first aspect of the disclosure, so that the protein has esterase activity, can be directly used as an esterase composition according to the requirement, and can be purified according to the requirement for reuse.

In a seventh aspect, the disclosure provides an esterase for degrading p-nitrophenyl esters, wherein the esterase comprises a protein according to the second aspect.

The present disclosure is further illustrated by the following examples, but the present disclosure is not limited thereby.

Example 1

In the embodiment, recombinant escherichia coli engineering strains for expressing the deinococcus radiodurans DcaE4 gene and mutants are constructed.

The expression plasmid pET28a is a commercial product of German merck company in the present disclosure; coli BL21 (DE 3) is a commercial product of Beijing nuozan company; site-directed mutagenesis kit (Mut Express II Fast Mutagenesis Kit V2) was purchased from the company nankingiana.

1. PCR specific primers were designed based on DcaE4 gene sequence in the genome of deinococcus radiodurans: dcaE4-F:5'CCATGGCTGATATCGGATCCATGCCCGTAGACCCCAACCT 3' (SEQ ID NO. 12); dcaE4-R:5'CTCGAGTGCGGCCGCAAGCTTTCAGCCGCGCAGTTGCTCG 3' (SEQ ID NO. 13); site-directed saturation mutagenesis primer sequence: S132N-F:5'-GCGCCGGTAGACGACGCCCTGGCGNNKGTGGTCTGGGC-3' (SEQ ID NO. 14); S132N-R:5'-GGCGGCGTGCGCGGCGGCCCAGACCACMNNCGCCAGGG-3' (SEQ ID NO. 15); T163N-F:5'-GACAGCGCGGGGGCCAACCTCGCCNNKGTCACGGCG-3' (SEQ ID NO. 16); T163N-R:5'-CGTCACGCGACCGCAGCGCCGTGACMNNGGCGAGGT-3' (SEQ ID NO. 17); S238N-F:5'-ACGCCTCGCCGCTCAACGCTGAGNNKCTCGCGGGGTT-3' (SEQ ID NO. 18); S238N-R:5'-ACCAGGGCCGGCGGCAACCCCGCGAGMNNCTCAGCG-3' (SEQ ID NO. 19); Y285N-F:5'-GCATGATTCACGGTNNKGCCAACATGACCGCGTTT-3' (SEQ ID NO. 20); Y285N-R:5'-GGCGAAACCGTMNNTCATGCCGGGGCCGGGGCGGTA-3' (SEQ ID NO. 21); wherein m=a/C; k=g/T; n=a/G/C/T.

2. The target gene sequence is amplified from the genome DNA of the deinococcus radiodurans by a PCR method.

And 3, after the PCR product is recovered through glue, connecting the PCR product to a pET-28a vector containing a sticky end obtained through BamH I/HindIII double enzyme digestion through recombinase, and constructing an escherichia coli expression vector pET28a-DcaE4.

4. The expression vector is transformed into escherichia coli BL21, the insertion sequence is verified to be correct through PCR and enzyme digestion and sequencing, and the strain is named BL21-pET28a-DcaE4.

5. Site-directed saturation mutation is carried out according to selected mutation sites Ser238, ser132, thr163 and Tyr285, primers are designed, the primers contain mutation sites, and site-directed mutation kits are used for constructing mutant expression vectors. Inverse PCR was performed using the wild type plasmid (pET 28a-DcaE 4) as template, and the whole plasmid was amplified.

After the PCR reaction is finished, 2 mu L of the DNA is taken for agarose gel electrophoresis detection, if the band is correct, the DNA is purified, and the purified DNA is subjected to DpnI digestion and demethylation and then subjected to recombination reaction.

The recombinant product was transferred into E.coli BL21 (DE 3) and positive clones were identified by sequencing for subsequent experiments.

Experimental results of this example: the recombinant escherichia coli engineering strain expressing DcaE4 is successfully constructed, and recombinant expression escherichia coli engineering strains of DcaE4 mutants with site-directed saturation mutations of Ser238, ser132, thr163 and Tyr285 are obtained through screening. Mutants mutated to four different types of amino acids were selected by gene sequencing, and the mutant selected at the Ser132 site was S132A, S132W, S132V, S P, S132R, S132H, S132Q, S132E, S Y. The mutant selected at the Thr163 site was T163A, T163H, T163L, T163N, T163R, T163K, T163C, T163E. The mutant selected at the Tyr285 site is Y285W, Y285F, Y285V, Y285R, Y285H, Y285S, Y E, Y285C. The mutant selected at the Ser238 site is S238D, S238R, S238H, S238K, S238N, S238Y, S238P, S238V, S W.

The specific sequence is as follows:

example 2

The present example is an enzyme activity characterization test of the esterase DcaE4 mutant.

The experimental materials of this example include: recombinant engineering strain: recombinant expression strains of esterases DcaE4 and DcaE4 mutants obtained in example 1; enzyme activity assay reagent: substrate solution: respectively dissolving 0.3% of p-nitrophenol octanoate pNPC (C8)) in isopropanol, and preserving at 4 ℃; buffer solution: 20mM Tris-HCl buffer (pH 7.5,0.11% acacia); substrate test solution: the substrate solution is uniformly mixed with the buffer solution according to the proportion of 1:3 and then used as a substrate test solution.

The experimental method of this embodiment includes:

1. inducible expression and purification of recombinant proteins: inoculating the strain into 20mL LB liquid medium with antibiotics at an inoculum size of 1%, and culturing overnight at 37 ℃; at OD ₆₀₀ The inoculum size was 0.1 at the initial concentration, and the bacterial liquid was transferred to 500mL of LB liquid medium to which kanamycin was added. Culturing at 37 deg.c until the concentration of the bacterial liquid is 0.6-0.8, and adding IPTG at the final concentration of 0.1 mu mol/L to induce protein expression at 25 deg.c for 6-8 hr. And (3) centrifugally collecting the bacterial liquid after induction, and re-suspending the bacterial liquid by using NTA-0. And (3) performing ultrasonic crushing on the bacterial liquid, centrifuging the crushed sample for 30min, respectively collecting supernatant and sediment of the crushed liquid, and obtaining the crushed supernatant which is crude enzyme liquid after centrifugation, wherein the crushed sample is used for subsequent experiments.

2. Purifying recombinant esterase protein by affinity chromatography: the nickel column was removed, and after ethanol was run out, the nickel column was first rinsed twice with deionized water, then equilibrated with NTA-0, and the flow rate was maintained at 1mL/min. The crude enzyme solution was hung on the column and penetrated twice. Gradient elution with prepared NTA-10, NTA-30, NTA-50, NTA-80, NTA-100, NTA-150, NTA-200, NTA-250, NTA-300, detection of protein with protein detection solution, collection of elution peak, and detection of the size and purity of the obtained protein with SDS-PAGE. And (3) using ultrafiltration centrifugation to replace the buffer solution of the protein solution, so as to remove imidazole in the protein solution, wherein the obtained protein solution is enzyme solution.

3. Measurement of the Activity of esterase protein: the method is carried out by a universal colorimetric method for measuring esterase activity and a universal substrate p-nitrophenyl ester compound. The detection principle is that p-nitrophenyl phenol (pNP) is generated by hydrolyzing p-nitrophenyl ester compound substrate, the pNP is yellow and has an absorption peak at 410nm, and the enzyme activity of esterase is determined by detecting the content of the product pNP. 1 enzyme activity unit (U) is defined as: the amount of enzyme required to release 1. Mu. Mol of product pNP per unit time. 600. Mu.L of substrate test solution is added into a 1.5mL centrifuge tube, and 25. Mu.L of enzyme solution after proper dilution is added; control group was added with 25 μl of Tris-HCl buffer at ph=8. After incubation for 5min at 30℃the reaction was stopped by adding 500. Mu.L of 95% ethanol. The absorbance was measured at 410nm and the enzyme activity was calculated.

Influence of temperature on enzyme activity and study of enzyme thermostability: enzyme solution is added into Tris-HCl buffer solution with pH value of 8, degradation activity of lipase/esterase is measured at different temperatures (5, 10, 20, 30, 40, 50, 60 and 70 ℃) respectively, and reaction is carried out for 5min, so that the optimal temperature of lipase is determined. Further study of the thermal stability of lipase/esterase: the purified enzyme solutions are respectively subjected to heat preservation for 6 hours at the temperature of 5, 10, 20, 30, 40 and 50 ℃, the activity of the residual enzyme is measured at the optimal temperature every 1 hour, and the relative enzyme activity is calculated by taking the highest enzyme activity as 100%.

Experimental results of this example:

the enzyme activities of DcaE4 wild-type and mutant proteins were measured, and the mutant proteins at Ser238, ser132, thr163 and Tyr285 sites of DcaE4 were purified and diluted to the same concentration (40. Mu.g/mL), and the enzyme activities were measured with the substrate pNPC8 at 30℃and pH=8, and the results are shown in FIGS. 1 to 4. Compared with the wild type DcaE4 esterase activity, the Ser132 locus is only changed obviously in S132A and S132V compared with the wild type, and the enzyme activities of the rest mutants are reduced to different degrees. Among mutations at the Thr163 site, mutations other than T163A, T163L and T163C all caused a different degree of decrease in enzyme activity. Only Y285F showed no significant change in enzyme activity compared with wild type in mutation at Tyr285 site, and other mutants were significantly decreased. The enzyme activity of the mutant S238N in the Ser238 site is obviously increased, the enzyme activities of the mutants S238P, S238V, S W and S238K are obviously reduced compared with the wild type, and the enzyme activities of the rest mutants are not obviously changed.

Mutants S132A, S132V, T163A, T163L, T163C, Y285F and S238N, which have no significant change in enzyme activity, were selected for temperature stability determination, and the optimum temperature (FIG. 5A), residual enzyme activity (FIG. 5B) after incubation at 20-60℃for 1 hour, and half-lives at 40℃and 50℃ (FIGS. 5C and 5D) were determined for each mutant and wild-type DcaE4, respectively. As shown, the optimum temperature for each mutant and wild-type esterase was still 30 ℃. Half-lives of each mutant and wild-type esterase DcaE4 were calculated by the primary inactivation model, and the results are shown in Table 1. The half-life of the mutant is improved at 40 ℃ and 50 ℃, wherein the half-life of S132A is improved by 44.29% and 89.89% respectively at 40 ℃ and 50 ℃, the half-life of T163A is improved by 89.59% and 119.11% respectively at 40 ℃ and 50 ℃, the half-life of Y285F is improved by 59.41% and 65.79% respectively at 40 ℃ and 50 ℃, and the half-life of S238N is improved by 47.15% and 70.10% respectively at 40 ℃ and 50 ℃. The highest improvement in thermostability in these mutants was T163A.

Table 1 half-lives of the mutants at 40℃and 50℃respectively

Example 3

This example is an analysis of the degradability of esterase DcaE4 mutants on pesticides.

The experimental materials of this example include: esterase protein: example 2 purification of obtained DcaE4 and mutants S132A, T163A, Y285F and S238N; and (3) an insecticide: carbaryl (CAR) was purchased from alaa Ding Gongsi; fenpropathrin (FEN), cyhalothrin (alpha-CYP), deltamethrin (DEL) are available from dr.

The experimental method of this embodiment includes:

1. esterase enzymolysis system: in order to determine the degradation condition of esterase DcaE4 and mutants on pesticides, purified enzyme protein is concentrated and then diluted to 40 mug/mL with Tris-HCl (50 mM, pH=8), carbaryl, fenpropathrin, cis-cypermethrin and deltamethrin (final concentration of 50 mug/mL) are respectively added into a certain amount of enzyme solution, pesticides with the same concentration are added into a control group by using high-temperature inactivated enzyme solution, and the reaction system is uniformly mixed and then is subjected to enzymolysis reaction after heat preservation for 8 hours at 30 ℃.

2. Sample preparation: adding the reaction solution into an equal volume of ethyl acetate, carrying out vortex oscillation extraction for 10min, then standing for 1h, taking a certain amount of upper organic phase nitrogen, blowing to dryness, adding methanol for redissolution, and filtering the obtained sample by using an organic filter membrane for chromatographic detection.

Chromatographic conditions: chromatographic column: agilent Poroshell 120SB-C18 (2.1 mm. Times.75 mm,2.7 μm); mobile phase a: water (containing 10mM ammonium formate and 0.1% formic acid); mobile phase B: methanol (containing 10mM ammonium formate and 0.1% formic acid); gradient elution (0-2 min,10% B; 2-6 min, 10%. Fwdarw.40% B; 6-10 min, 40%. Fwdarw.80% B; 10-12 min, 80%. Fwdarw.95% B; 12-16 min,95% B; 16-18 min 95%. Fwdarw.5% B; 18-20 min,5% B); flow rate: 0.2mL/min; column temperature: 25 ℃; sample injection amount: 10. Mu.L; run time: 20min;

mass spectrometry conditions: adopting Agilent jet flow electric spray ion source (ESI), positive ion MRM mode collection; drying gas temperature: 350 ℃; drying gas flow rate: 12L/min; atomizer pressure: 35psi; capillary voltage: 3500V;

experimental results of this example:

the result of measuring esterase degradation activity shows that DcaE4 has degradation function on four pesticides, wherein DcaE4 has the fastest degradation rate on carbaryl, the degradation rate of 8 hours reaches 100%, and the degradation rates on fenpropathrin, cis-cypermethrin and deltamethrin are sequentially reduced to 85.19%, 54.19% and 34.23% respectively.

Through 8h dressing, dcaE4 and mutants thereof have degradation rates of 85.83% -93.26%, 54.01% -61.95%, 30.45% -40.96% and 26.64% -35.37% on Carbaryl (CAR), fenpropathrin (FEN), cis-CYP and Deltamethrin (DEL) with the concentration of 50 mug/mL respectively, the overall degradation trend of the mutants is similar to that of the wild type, the degradation rates of the CAR, the FEN, the alpha-CYP and the DEL are sequentially reduced, but the degradation rates of the mutants on different pesticides are different, wherein the degradation rate of S238N on four pesticides is obviously improved compared with that of the wild type, and the degradation rate is improved by 6.08% -7.94% (Table 2). In addition, other mutants did not have a significant effect on the degradation rate of the pesticide.

TABLE 2 degradation rate of DcaE4 and mutants on pesticides and toxins

Enzymes	CAR(％)	FEN(％)	α-CYP(％)	DEL(％)
					WT	87.18±0.44	54.01±2.39	33.29±2.04	27.29±2.68
S132A	85.83±0.71	56.25±1.12	30.45±0.62	28.22±5.14
					T163A	86.35±1.23	55.17±1.18	34.33±2.84	27.27±4.57
Y285F	88.42±0.52	58.84±1.25	34.61±4.08	26.64±2.32
					S238N	93.26±0.33	61.95±0.98	40.96±1.30	34.05±1.23

The method optimizes the amino acid of a key site of low-temperature esterase DcaE4 in deinococcus radiodurans Deinococcus radiodurans by utilizing a site-directed mutagenesis mode; mutation of Ser238 locus in DcaE4 esterase protein can obviously improve enzyme activity; the catalytic efficiency and stability of the mutant S238N are improved, and the degradation rate of four pesticides is obviously improved; the Ser132 site, the Thr163 site and the Tyr285 site are critical to the structure of the esterase, and mutants S132A, T163A and Y285F significantly improve the stability of the esterase.

The method for improving the esterase activity, the protein with lipase activity, the gene for encoding the protein, the recombinant vector inserted with the gene, the transformant transformed with the gene, the method for preparing the esterase and the application of the esterase in degrading p-nitrophenyl ester compounds are all used for laying a foundation for the application of the esterase in the fields of biological pharmacy, biological repair, low-temperature washing and the like, and the requirement of the esterase in industry is met.

The preferred embodiments of the present disclosure have been described in detail above with reference to the accompanying drawings, but the present disclosure is not limited to the specific details of the above embodiments, and various simple modifications may be made to the technical solutions of the present disclosure within the scope of the technical concept of the present disclosure, and all the simple modifications belong to the protection scope of the present disclosure.

In addition, the specific features described in the foregoing embodiments may be combined in any suitable manner, and in order to avoid unnecessary repetition, the present disclosure does not further describe various possible combinations.

Moreover, any combination between the various embodiments of the present disclosure is possible as long as it does not depart from the spirit of the present disclosure, which should also be construed as the disclosure of the present disclosure.

Sequence listing

<110> institute of biotechnology of national academy of agricultural sciences

<120> use of modification of serine residue at position 238 for increasing esterase DcaE4 activity

<130> 20217CAAS-B-ZW

<160> 21

<170> SIPOSequenceListing 1.0

<210> 1

<211> 312

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<220>

<221> UNSURE

<222> (132)..(132)

<223> The 'Xaa' at location 132 stands for Ala, Trp, Val, Pro, Arg, His, Gln, Glu, or Tyr.

<220>

<221> UNSURE

<222> (163)..(163)

<223> The 'Xaa' at location 163 stands for Ala, His, Leu, Asn, Arg, Lys, Cys, or Glu.

<220>

<221> UNSURE

<222> (238)..(238)

<223> The 'Xaa' at location 238 stands for Asn, Asp, Arg, His, Lys, Asn, Tyr, Pro, Val, or Trp.

<220>

<221> UNSURE

<222> (285)..(285)

<223> The 'Xaa' at location 285 stands for Phe, Trp, Val, Arg, His, Ser, Glu, or Cys.

<400> 1

Met Pro Val Asp Pro Asn Leu Tyr Gln Leu Leu Leu Gln Leu Ser Gln

1 5 10 15

Ala Pro Glu Pro Ala Gly Leu Glu Glu Leu Arg Ala Gly Val Ile Ala

20 25 30

Asn Ala Ala Arg Ser Pro Lys Arg Pro Val Thr Ile Gly Glu Val Arg

35 40 45

Asp Leu Ser Val Ala Gly Ala Glu Gly Ser Leu Pro Ala Arg Leu Tyr

50 55 60

His Pro Ala Gly Gln Ala Pro Ala Ser Gly Trp Pro Leu Thr Val Phe

65 70 75 80

Phe His Gly Gly Gly Phe Val Val Tyr Asp Leu Asp Thr His Asp Ala

85 90 95

Leu Cys Arg Glu Leu Cys Ala Thr Ser Gly Ala Ala Val Leu Ser Val

100 105 110

Ala Tyr Arg Leu Ala Pro Glu Ala Arg Phe Pro Ala Pro Val Asp Asp

115 120 125

Ala Leu Ala Xaa Val Val Trp Ala Ala Ala His Ala Ala Glu Leu Gly

130 135 140

Ala Asp Ala Gly Arg Leu Ala Val Ala Gly Asp Ser Ala Gly Ala Asn

145 150 155 160

Leu Ala Xaa Val Thr Ala Leu Arg Ser Arg Asp Glu Gly Gly Pro Ala

165 170 175

Leu Arg Ala Gln Leu Leu Ile Tyr Pro Ala Ala Asp Phe Glu His Pro

180 185 190

Glu Arg Tyr Pro Ser Arg Gln Glu Asn Gly Arg Gly Tyr Phe Leu Thr

195 200 205

Asp Glu Arg Met Arg Phe Phe Gly Gln Met Tyr Leu Ala Arg Pro Glu

210 215 220

Asp Ala Ala His Pro His Ala Ser Pro Leu Asn Ala Glu Xaa Leu Ala

225 230 235 240

Gly Leu Pro Pro Ala Leu Val Leu Thr Ala Glu Phe Asp Pro Leu Arg

245 250 255

Asp Glu Gly Ala Ala Tyr Ala Glu Ala Leu Lys Ala Ala Gly Val Ser

260 265 270

Ala Glu Tyr Arg Pro Gly Pro Gly Met Ile His Gly Xaa Ala Asn Met

275 280 285

Thr Ala Phe Ser Pro Val Ala Ala Gln Leu Ile Asp Glu Ala Gly Val

290 295 300

Trp Leu Gly Glu Gln Leu Arg Gly

305 310

<210> 2

<211> 312

<212> PRT

<213> radiation resistant deinococcus (Deinococcus radiodurans)

<400> 2

Met Pro Val Asp Pro Asn Leu Tyr Gln Leu Leu Leu Gln Leu Ser Gln

1 5 10 15

Ala Pro Glu Pro Ala Gly Leu Glu Glu Leu Arg Ala Gly Val Ile Ala

20 25 30

Asn Ala Ala Arg Ser Pro Lys Arg Pro Val Thr Ile Gly Glu Val Arg

35 40 45

Asp Leu Ser Val Ala Gly Ala Glu Gly Ser Leu Pro Ala Arg Leu Tyr

50 55 60

His Pro Ala Gly Gln Ala Pro Ala Ser Gly Trp Pro Leu Thr Val Phe

65 70 75 80

Phe His Gly Gly Gly Phe Val Val Tyr Asp Leu Asp Thr His Asp Ala

85 90 95

Leu Cys Arg Glu Leu Cys Ala Thr Ser Gly Ala Ala Val Leu Ser Val

100 105 110

Ala Tyr Arg Leu Ala Pro Glu Ala Arg Phe Pro Ala Pro Val Asp Asp

115 120 125

Ala Leu Ala Ser Val Val Trp Ala Ala Ala His Ala Ala Glu Leu Gly

130 135 140

Ala Asp Ala Gly Arg Leu Ala Val Ala Gly Asp Ser Ala Gly Ala Asn

145 150 155 160

Leu Ala Thr Val Thr Ala Leu Arg Ser Arg Asp Glu Gly Gly Pro Ala

165 170 175

Leu Arg Ala Gln Leu Leu Ile Tyr Pro Ala Ala Asp Phe Glu His Pro

180 185 190

Glu Arg Tyr Pro Ser Arg Gln Glu Asn Gly Arg Gly Tyr Phe Leu Thr

195 200 205

Asp Glu Arg Met Arg Phe Phe Gly Gln Met Tyr Leu Ala Arg Pro Glu

210 215 220

Asp Ala Ala His Pro His Ala Ser Pro Leu Asn Ala Glu Ser Leu Ala

225 230 235 240

Gly Leu Pro Pro Ala Leu Val Leu Thr Ala Glu Phe Asp Pro Leu Arg

245 250 255

Asp Glu Gly Ala Ala Tyr Ala Glu Ala Leu Lys Ala Ala Gly Val Ser

260 265 270

Ala Glu Tyr Arg Pro Gly Pro Gly Met Ile His Gly Tyr Ala Asn Met

275 280 285

Thr Ala Phe Ser Pro Val Ala Ala Gln Leu Ile Asp Glu Ala Gly Val

290 295 300

Trp Leu Gly Glu Gln Leu Arg Gly

305 310

<210> 3

<211> 312

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 3

Met Pro Val Asp Pro Asn Leu Tyr Gln Leu Leu Leu Gln Leu Ser Gln

1 5 10 15

Ala Pro Glu Pro Ala Gly Leu Glu Glu Leu Arg Ala Gly Val Ile Ala

20 25 30

Asn Ala Ala Arg Ser Pro Lys Arg Pro Val Thr Ile Gly Glu Val Arg

35 40 45

Asp Leu Ser Val Ala Gly Ala Glu Gly Ser Leu Pro Ala Arg Leu Tyr

50 55 60

His Pro Ala Gly Gln Ala Pro Ala Ser Gly Trp Pro Leu Thr Val Phe

65 70 75 80

Phe His Gly Gly Gly Phe Val Val Tyr Asp Leu Asp Thr His Asp Ala

85 90 95

Leu Cys Arg Glu Leu Cys Ala Thr Ser Gly Ala Ala Val Leu Ser Val

100 105 110

Ala Tyr Arg Leu Ala Pro Glu Ala Arg Phe Pro Ala Pro Val Asp Asp

115 120 125

Ala Leu Ala Ala Val Val Trp Ala Ala Ala His Ala Ala Glu Leu Gly

130 135 140

Ala Asp Ala Gly Arg Leu Ala Val Ala Gly Asp Ser Ala Gly Ala Asn

145 150 155 160

Leu Ala Thr Val Thr Ala Leu Arg Ser Arg Asp Glu Gly Gly Pro Ala

165 170 175

Leu Arg Ala Gln Leu Leu Ile Tyr Pro Ala Ala Asp Phe Glu His Pro

180 185 190

Glu Arg Tyr Pro Ser Arg Gln Glu Asn Gly Arg Gly Tyr Phe Leu Thr

195 200 205

Asp Glu Arg Met Arg Phe Phe Gly Gln Met Tyr Leu Ala Arg Pro Glu

210 215 220

Asp Ala Ala His Pro His Ala Ser Pro Leu Asn Ala Glu Ser Leu Ala

225 230 235 240

Gly Leu Pro Pro Ala Leu Val Leu Thr Ala Glu Phe Asp Pro Leu Arg

245 250 255

Asp Glu Gly Ala Ala Tyr Ala Glu Ala Leu Lys Ala Ala Gly Val Ser

260 265 270

Ala Glu Tyr Arg Pro Gly Pro Gly Met Ile His Gly Tyr Ala Asn Met

275 280 285

Thr Ala Phe Ser Pro Val Ala Ala Gln Leu Ile Asp Glu Ala Gly Val

290 295 300

Trp Leu Gly Glu Gln Leu Arg Gly

305 310

<210> 4

<211> 312

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 4

Met Pro Val Asp Pro Asn Leu Tyr Gln Leu Leu Leu Gln Leu Ser Gln

1 5 10 15

Ala Pro Glu Pro Ala Gly Leu Glu Glu Leu Arg Ala Gly Val Ile Ala

20 25 30

Asn Ala Ala Arg Ser Pro Lys Arg Pro Val Thr Ile Gly Glu Val Arg

35 40 45

Asp Leu Ser Val Ala Gly Ala Glu Gly Ser Leu Pro Ala Arg Leu Tyr

50 55 60

His Pro Ala Gly Gln Ala Pro Ala Ser Gly Trp Pro Leu Thr Val Phe

65 70 75 80

Phe His Gly Gly Gly Phe Val Val Tyr Asp Leu Asp Thr His Asp Ala

85 90 95

Leu Cys Arg Glu Leu Cys Ala Thr Ser Gly Ala Ala Val Leu Ser Val

100 105 110

Ala Tyr Arg Leu Ala Pro Glu Ala Arg Phe Pro Ala Pro Val Asp Asp

115 120 125

Ala Leu Ala Ser Val Val Trp Ala Ala Ala His Ala Ala Glu Leu Gly

130 135 140

Ala Asp Ala Gly Arg Leu Ala Val Ala Gly Asp Ser Ala Gly Ala Asn

145 150 155 160

Leu Ala Ala Val Thr Ala Leu Arg Ser Arg Asp Glu Gly Gly Pro Ala

165 170 175

Leu Arg Ala Gln Leu Leu Ile Tyr Pro Ala Ala Asp Phe Glu His Pro

180 185 190

Glu Arg Tyr Pro Ser Arg Gln Glu Asn Gly Arg Gly Tyr Phe Leu Thr

195 200 205

Asp Glu Arg Met Arg Phe Phe Gly Gln Met Tyr Leu Ala Arg Pro Glu

210 215 220

Asp Ala Ala His Pro His Ala Ser Pro Leu Asn Ala Glu Ser Leu Ala

225 230 235 240

Gly Leu Pro Pro Ala Leu Val Leu Thr Ala Glu Phe Asp Pro Leu Arg

245 250 255

Asp Glu Gly Ala Ala Tyr Ala Glu Ala Leu Lys Ala Ala Gly Val Ser

260 265 270

Ala Glu Tyr Arg Pro Gly Pro Gly Met Ile His Gly Tyr Ala Asn Met

275 280 285

Thr Ala Phe Ser Pro Val Ala Ala Gln Leu Ile Asp Glu Ala Gly Val

290 295 300

Trp Leu Gly Glu Gln Leu Arg Gly

305 310

<210> 5

<211> 312

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 5

Met Pro Val Asp Pro Asn Leu Tyr Gln Leu Leu Leu Gln Leu Ser Gln

1 5 10 15

Ala Pro Glu Pro Ala Gly Leu Glu Glu Leu Arg Ala Gly Val Ile Ala

20 25 30

Asn Ala Ala Arg Ser Pro Lys Arg Pro Val Thr Ile Gly Glu Val Arg

35 40 45

Asp Leu Ser Val Ala Gly Ala Glu Gly Ser Leu Pro Ala Arg Leu Tyr

50 55 60

His Pro Ala Gly Gln Ala Pro Ala Ser Gly Trp Pro Leu Thr Val Phe

65 70 75 80

Phe His Gly Gly Gly Phe Val Val Tyr Asp Leu Asp Thr His Asp Ala

85 90 95

Leu Cys Arg Glu Leu Cys Ala Thr Ser Gly Ala Ala Val Leu Ser Val

100 105 110

Ala Tyr Arg Leu Ala Pro Glu Ala Arg Phe Pro Ala Pro Val Asp Asp

115 120 125

Ala Leu Ala Ser Val Val Trp Ala Ala Ala His Ala Ala Glu Leu Gly

130 135 140

Ala Asp Ala Gly Arg Leu Ala Val Ala Gly Asp Ser Ala Gly Ala Asn

145 150 155 160

Leu Ala Thr Val Thr Ala Leu Arg Ser Arg Asp Glu Gly Gly Pro Ala

165 170 175

Leu Arg Ala Gln Leu Leu Ile Tyr Pro Ala Ala Asp Phe Glu His Pro

180 185 190

Glu Arg Tyr Pro Ser Arg Gln Glu Asn Gly Arg Gly Tyr Phe Leu Thr

195 200 205

Asp Glu Arg Met Arg Phe Phe Gly Gln Met Tyr Leu Ala Arg Pro Glu

210 215 220

Asp Ala Ala His Pro His Ala Ser Pro Leu Asn Ala Glu Asn Leu Ala

225 230 235 240

Gly Leu Pro Pro Ala Leu Val Leu Thr Ala Glu Phe Asp Pro Leu Arg

245 250 255

Asp Glu Gly Ala Ala Tyr Ala Glu Ala Leu Lys Ala Ala Gly Val Ser

260 265 270

Ala Glu Tyr Arg Pro Gly Pro Gly Met Ile His Gly Tyr Ala Asn Met

275 280 285

Thr Ala Phe Ser Pro Val Ala Ala Gln Leu Ile Asp Glu Ala Gly Val

290 295 300

Trp Leu Gly Glu Gln Leu Arg Gly

305 310

<210> 6

<211> 312

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 6

Met Pro Val Asp Pro Asn Leu Tyr Gln Leu Leu Leu Gln Leu Ser Gln

1 5 10 15

Ala Pro Glu Pro Ala Gly Leu Glu Glu Leu Arg Ala Gly Val Ile Ala

20 25 30

Asn Ala Ala Arg Ser Pro Lys Arg Pro Val Thr Ile Gly Glu Val Arg

35 40 45

Asp Leu Ser Val Ala Gly Ala Glu Gly Ser Leu Pro Ala Arg Leu Tyr

50 55 60

His Pro Ala Gly Gln Ala Pro Ala Ser Gly Trp Pro Leu Thr Val Phe

65 70 75 80

Phe His Gly Gly Gly Phe Val Val Tyr Asp Leu Asp Thr His Asp Ala

85 90 95

Leu Cys Arg Glu Leu Cys Ala Thr Ser Gly Ala Ala Val Leu Ser Val

100 105 110

Ala Tyr Arg Leu Ala Pro Glu Ala Arg Phe Pro Ala Pro Val Asp Asp

115 120 125

Ala Leu Ala Ser Val Val Trp Ala Ala Ala His Ala Ala Glu Leu Gly

130 135 140

Ala Asp Ala Gly Arg Leu Ala Val Ala Gly Asp Ser Ala Gly Ala Asn

145 150 155 160

Leu Ala Thr Val Thr Ala Leu Arg Ser Arg Asp Glu Gly Gly Pro Ala

165 170 175

Leu Arg Ala Gln Leu Leu Ile Tyr Pro Ala Ala Asp Phe Glu His Pro

180 185 190

Glu Arg Tyr Pro Ser Arg Gln Glu Asn Gly Arg Gly Tyr Phe Leu Thr

195 200 205

Asp Glu Arg Met Arg Phe Phe Gly Gln Met Tyr Leu Ala Arg Pro Glu

210 215 220

Asp Ala Ala His Pro His Ala Ser Pro Leu Asn Ala Glu Ser Leu Ala

225 230 235 240

Gly Leu Pro Pro Ala Leu Val Leu Thr Ala Glu Phe Asp Pro Leu Arg

245 250 255

Asp Glu Gly Ala Ala Tyr Ala Glu Ala Leu Lys Ala Ala Gly Val Ser

260 265 270

Ala Glu Tyr Arg Pro Gly Pro Gly Met Ile His Gly Phe Ala Asn Met

275 280 285

Thr Ala Phe Ser Pro Val Ala Ala Gln Leu Ile Asp Glu Ala Gly Val

290 295 300

Trp Leu Gly Glu Gln Leu Arg Gly

305 310

<210> 7

<211> 939

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

atgcccgtag accccaacct gtaccaactt ctgctgcaac tctcgcaggc gcctgaaccc 60

gccggactgg aagaactgcg ggcgggcgtg atcgccaacg cggcgcgcag ccccaaacgt 120

ccggtgacta ttggcgaagt ccgtgacctg agcgtggcgg gcgcggaggg ctccctgccc 180

gcccgcctgt accaccccgc cgggcaggcc cccgcgtccg gctggccgct gacggtgttc 240

ttccacggtg gcggcttcgt ggtctacgac ctcgacaccc acgacgcgct gtgccgcgag 300

ctgtgcgcga cgtcgggcgc ggcggtgctg agcgtggcct accgcctcgc gcccgaagcc 360

cgctttcccg cgccggtaga cgacgccctg gcggctgtgg tctgggccgc cgcgcacgcc 420

gccgaactcg gcgcagacgc ggggcgactc gcggtggcgg gcgacagcgc gggggccaac 480

ctcgccaccg tcacggcgct gcggtcgcgt gacgagggcg gcccggcttt gcgggcgcag 540

cttctcattt accccgccgc cgatttcgag caccccgaac gctaccccag ccgccaggaa 600

aacggacgcg gctatttcct cactgacgag cggatgcgct ttttcggaca gatgtacctt 660

gctcgcccgg aagacgccgc gcatccccac gcctcgccgc tcaacgctga gagtctcgcg 720

gggttgccgc cggccctggt cctgaccgcc gaattcgacc ccctgcgcga tgaaggcgcc 780

gcttacgccg aagctctcaa ggccgctggc gtaagcgccg agtaccgccc cggccccggc 840

atgattcacg gttacgccaa catgaccgcg ttttcgcccg tcgccgcaca actgattgac 900

gaggcgggcg tatggctcgg cgagcaactg cgcggctga 939

<210> 8

<211> 939

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

atgcccgtag accccaacct gtaccaactt ctgctgcaac tctcgcaggc gcctgaaccc 60

gccggactgg aagaactgcg ggcgggcgtg atcgccaacg cggcgcgcag ccccaaacgt 120

ccggtgacta ttggcgaagt ccgtgacctg agcgtggcgg gcgcggaggg ctccctgccc 180

gcccgcctgt accaccccgc cgggcaggcc cccgcgtccg gctggccgct gacggtgttc 240

ttccacggtg gcggcttcgt ggtctacgac ctcgacaccc acgacgcgct gtgccgcgag 300

ctgtgcgcga cgtcgggcgc ggcggtgctg agcgtggcct accgcctcgc gcccgaagcc 360

cgctttcccg cgccggtaga cgacgccctg gcgagtgtgg tctgggccgc cgcgcacgcc 420

gccgaactcg gcgcagacgc ggggcgactc gcggtggcgg gcgacagcgc gggggccaac 480

ctcgccgccg tcacggcgct gcggtcgcgt gacgagggcg gcccggcttt gcgggcgcag 540

cttctcattt accccgccgc cgatttcgag caccccgaac gctaccccag ccgccaggaa 600

aacggacgcg gctatttcct cactgacgag cggatgcgct ttttcggaca gatgtacctt 660

gctcgcccgg aagacgccgc gcatccccac gcctcgccgc tcaacgctga gagtctcgcg 720

gggttgccgc cggccctggt cctgaccgcc gaattcgacc ccctgcgcga tgaaggcgcc 780

gcttacgccg aagctctcaa ggccgctggc gtaagcgccg agtaccgccc cggccccggc 840

atgattcacg gttacgccaa catgaccgcg ttttcgcccg tcgccgcaca actgattgac 900

gaggcgggcg tatggctcgg cgagcaactg cgcggctga 939

<210> 9

<211> 939

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

atgcccgtag accccaacct gtaccaactt ctgctgcaac tctcgcaggc gcctgaaccc 60

gccggactgg aagaactgcg ggcgggcgtg atcgccaacg cggcgcgcag ccccaaacgt 120

ccggtgacta ttggcgaagt ccgtgacctg agcgtggcgg gcgcggaggg ctccctgccc 180

gcccgcctgt accaccccgc cgggcaggcc cccgcgtccg gctggccgct gacggtgttc 240

ttccacggtg gcggcttcgt ggtctacgac ctcgacaccc acgacgcgct gtgccgcgag 300

ctgtgcgcga cgtcgggcgc ggcggtgctg agcgtggcct accgcctcgc gcccgaagcc 360

cgctttcccg cgccggtaga cgacgccctg gcgagtgtgg tctgggccgc cgcgcacgcc 420

gccgaactcg gcgcagacgc ggggcgactc gcggtggcgg gcgacagcgc gggggccaac 480

ctcgccaccg tcacggcgct gcggtcgcgt gacgagggcg gcccggcttt gcgggcgcag 540

cttctcattt accccgccgc cgatttcgag caccccgaac gctaccccag ccgccaggaa 600

aacggacgcg gctatttcct cactgacgag cggatgcgct ttttcggaca gatgtacctt 660

gctcgcccgg aagacgccgc gcatccccac gcctcgccgc tcaacgctga gaatctcgcg 720

gggttgccgc cggccctggt cctgaccgcc gaattcgacc ccctgcgcga tgaaggcgcc 780

gcttacgccg aagctctcaa ggccgctggc gtaagcgccg agtaccgccc cggccccggc 840

atgattcacg gttacgccaa catgaccgcg ttttcgcccg tcgccgcaca actgattgac 900

gaggcgggcg tatggctcgg cgagcaactg cgcggctga 939

<210> 10

<211> 939

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

atgcccgtag accccaacct gtaccaactt ctgctgcaac tctcgcaggc gcctgaaccc 60

gccggactgg aagaactgcg ggcgggcgtg atcgccaacg cggcgcgcag ccccaaacgt 120

ccggtgacta ttggcgaagt ccgtgacctg agcgtggcgg gcgcggaggg ctccctgccc 180

gcccgcctgt accaccccgc cgggcaggcc cccgcgtccg gctggccgct gacggtgttc 240

ttccacggtg gcggcttcgt ggtctacgac ctcgacaccc acgacgcgct gtgccgcgag 300

ctgtgcgcga cgtcgggcgc ggcggtgctg agcgtggcct accgcctcgc gcccgaagcc 360

cgctttcccg cgccggtaga cgacgccctg gcgagtgtgg tctgggccgc cgcgcacgcc 420

gccgaactcg gcgcagacgc ggggcgactc gcggtggcgg gcgacagcgc gggggccaac 480

ctcgccaccg tcacggcgct gcggtcgcgt gacgagggcg gcccggcttt gcgggcgcag 540

cttctcattt accccgccgc cgatttcgag caccccgaac gctaccccag ccgccaggaa 600

aacggacgcg gctatttcct cactgacgag cggatgcgct ttttcggaca gatgtacctt 660

gctcgcccgg aagacgccgc gcatccccac gcctcgccgc tcaacgctga gagtctcgcg 720

gggttgccgc cggccctggt cctgaccgcc gaattcgacc ccctgcgcga tgaaggcgcc 780

gcttacgccg aagctctcaa ggccgctggc gtaagcgccg agtaccgccc cggccccggc 840

atgattcacg gtttcgccaa catgaccgcg ttttcgcccg tcgccgcaca actgattgac 900

gaggcgggcg tatggctcgg cgagcaactg cgcggctga 939

<210> 11

<211> 6289

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60

cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120

ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180

gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240

acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300

ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360

ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420

acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480

tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540

tccgctcatg aattaattct tagaaaaact catcgagcat caaatgaaac tgcaatttat 600

tcatatcagg attatcaata ccatattttt gaaaaagccg tttctgtaat gaaggagaaa 660

actcaccgag gcagttccat aggatggcaa gatcctggta tcggtctgcg attccgactc 720

gtccaacatc aatacaacct attaatttcc cctcgtcaaa aataaggtta tcaagtgaga 780

aatcaccatg agtgacgact gaatccggtg agaatggcaa aagtttatgc atttctttcc 840

agacttgttc aacaggccag ccattacgct cgtcatcaaa atcactcgca tcaaccaaac 900

cgttattcat tcgtgattgc gcctgagcga gacgaaatac gcgatcgctg ttaaaaggac 960

aattacaaac aggaatcgaa tgcaaccggc gcaggaacac tgccagcgca tcaacaatat 1020

tttcacctga atcaggatat tcttctaata cctggaatgc tgttttcccg gggatcgcag 1080

tggtgagtaa ccatgcatca tcaggagtac ggataaaatg cttgatggtc ggaagaggca 1140

taaattccgt cagccagttt agtctgacca tctcatctgt aacatcattg gcaacgctac 1200

ctttgccatg tttcagaaac aactctggcg catcgggctt cccatacaat cgatagattg 1260

tcgcacctga ttgcccgaca ttatcgcgag cccatttata cccatataaa tcagcatcca 1320

tgttggaatt taatcgcggc ctagagcaag acgtttcccg ttgaatatgg ctcataacac 1380

cccttgtatt actgtttatg taagcagaca gttttattgt tcatgaccaa aatcccttaa 1440

cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga 1500

gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg 1560

gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc 1620

agagcgcaga taccaaatac tgtccttcta gtgtagccgt agttaggcca ccacttcaag 1680

aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc 1740

agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg 1800

cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac 1860

accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga 1920

aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt 1980

ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag 2040

cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg 2100

gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgttctt tcctgcgtta 2160

tcccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac cgctcgccgc 2220

agccgaacga ccgagcgcag cgagtcagtg agcgaggaag cggaagagcg cctgatgcgg 2280

tattttctcc ttacgcatct gtgcggtatt tcacaccgca tatatggtgc actctcagta 2340

caatctgctc tgatgccgca tagttaagcc agtatacact ccgctatcgc tacgtgactg 2400

ggtcatggct gcgccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct 2460

gctcccggca tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag 2520

gttttcaccg tcatcaccga aacgcgcgag gcagctgcgg taaagctcat cagcgtggtc 2580

gtgaagcgat tcacagatgt ctgcctgttc atccgcgtcc agctcgttga gtttctccag 2640

aagcgttaat gtctggcttc tgataaagcg ggccatgtta agggcggttt tttcctgttt 2700

ggtcactgat gcctccgtgt aagggggatt tctgttcatg ggggtaatga taccgatgaa 2760

acgagagagg atgctcacga tacgggttac tgatgatgaa catgcccggt tactggaacg 2820

ttgtgagggt aaacaactgg cggtatggat gcggcgggac cagagaaaaa tcactcaggg 2880

tcaatgccag cgcttcgtta atacagatgt aggtgttcca cagggtagcc agcagcatcc 2940

tgcgatgcag atccggaaca taatggtgca gggcgctgac ttccgcgttt ccagacttta 3000

cgaaacacgg aaaccgaaga ccattcatgt tgttgctcag gtcgcagacg ttttgcagca 3060

gcagtcgctt cacgttcgct cgcgtatcgg tgattcattc tgctaaccag taaggcaacc 3120

ccgccagcct agccgggtcc tcaacgacag gagcacgatc atgcgcaccc gtggggccgc 3180

catgccggcg ataatggcct gcttctcgcc gaaacgtttg gtggcgggac cagtgacgaa 3240

ggcttgagcg agggcgtgca agattccgaa taccgcaagc gacaggccga tcatcgtcgc 3300

gctccagcga aagcggtcct cgccgaaaat gacccagagc gctgccggca cctgtcctac 3360

gagttgcatg ataaagaaga cagtcataag tgcggcgacg atagtcatgc cccgcgccca 3420

ccggaaggag ctgactgggt tgaaggctct caagggcatc ggtcgagatc ccggtgccta 3480

atgagtgagc taacttacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa 3540

cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat 3600

tgggcgccag ggtggttttt cttttcacca gtgagacggg caacagctga ttgcccttca 3660

ccgcctggcc ctgagagagt tgcagcaagc ggtccacgct ggtttgcccc agcaggcgaa 3720

aatcctgttt gatggtggtt aacggcggga tataacatga gctgtcttcg gtatcgtcgt 3780

atcccactac cgagatatcc gcaccaacgc gcagcccgga ctcggtaatg gcgcgcattg 3840

cgcccagcgc catctgatcg ttggcaacca gcatcgcagt gggaacgatg ccctcattca 3900

gcatttgcat ggtttgttga aaaccggaca tggcactcca gtcgccttcc cgttccgcta 3960

tcggctgaat ttgattgcga gtgagatatt tatgccagcc agccagacgc agacgcgccg 4020

agacagaact taatgggccc gctaacagcg cgatttgctg gtgacccaat gcgaccagat 4080

gctccacgcc cagtcgcgta ccgtcttcat gggagaaaat aatactgttg atgggtgtct 4140

ggtcagagac atcaagaaat aacgccggaa cattagtgca ggcagcttcc acagcaatgg 4200

catcctggtc atccagcgga tagttaatga tcagcccact gacgcgttgc gcgagaagat 4260

tgtgcaccgc cgctttacag gcttcgacgc cgcttcgttc taccatcgac accaccacgc 4320

tggcacccag ttgatcggcg cgagatttaa tcgccgcgac aatttgcgac ggcgcgtgca 4380

gggccagact ggaggtggca acgccaatca gcaacgactg tttgcccgcc agttgttgtg 4440

ccacgcggtt gggaatgtaa ttcagctccg ccatcgccgc ttccactttt tcccgcgttt 4500

tcgcagaaac gtggctggcc tggttcacca cgcgggaaac ggtctgataa gagacaccgg 4560

catactctgc gacatcgtat aacgttactg gtttcacatt caccaccctg aattgactct 4620

cttccgggcg ctatcatgcc ataccgcgaa aggttttgcg ccattcgatg gtgtccggga 4680

tctcgacgct ctcccttatg cgactcctgc attaggaagc agcccagtag taggttgagg 4740

ccgttgagca ccgccgccgc aaggaatggt gcatgcaagg agatggcgcc caacagtccc 4800

ccggccacgg ggcctgccac catacccacg ccgaaacaag cgctcatgag cccgaagtgg 4860

cgagcccgat cttccccatc ggtgatgtcg gcgatatagg cgccagcaac cgcacctgtg 4920

gcgccggtga tgccggccac gatgcgtccg gcgtagagga tcgagatctc gatcccgcga 4980

aattaatacg actcactata ggggaattgt gagcggataa caattcccct ctagaaataa 5040

ttttgtttaa ctttaagaag gagatatacc atgggcagca gccatcatca tcatcatcac 5100

agcagcggcc tggtgccgcg cggcagccat atggctagca tgactggtgg acagcaaatg 5160

ggtcgcggat ccatgcccgt agaccccaac ctgtaccaac ttctgctgca actctcgcag 5220

gcgcctgaac ccgccggact ggaagaactg cgggcgggcg tgatcgccaa cgcggcgcgc 5280

agccccaaac gtccggtgac tattggcgaa gtccgtgacc tgagcgtggc gggcgcggag 5340

ggctccctgc ccgcccgcct gtaccacccc gccgggcagg cccccgcgtc cggctggccg 5400

ctgacggtgt tcttccacgg tggcggcttc gtggtctacg acctcgacac ccacgacgcg 5460

ctgtgccgcg agctgtgcgc gacgtcgggc gcggcggtgc tgagcgtggc ctaccgcctc 5520

gcgcccgaag cccgctttcc cgcgccggta gacgacgccc tggcggctgt ggtctgggcc 5580

gccgcgcacg ccgccgaact cggcgcagac gcggggcgac tcgcggtggc gggcgacagc 5640

gcgggggcca acctcgccac cgtcacggcg ctgcggtcgc gtgacgaggg cggcccggct 5700

ttgcgggcgc agcttctcat ttaccccgcc gccgatttcg agcaccccga acgctacccc 5760

agccgccagg aaaacggacg cggctatttc ctcactgacg agcggatgcg ctttttcgga 5820

cagatgtacc ttgctcgccc ggaagacgcc gcgcatcccc acgcctcgcc gctcaacgct 5880

gagagtctcg cggggttgcc gccggccctg gtcctgaccg ccgaattcga ccccctgcgc 5940

gatgaaggcg ccgcttacgc cgaagctctc aaggccgctg gcgtaagcgc cgagtaccgc 6000

cccggccccg gcatgattca cggttacgcc aacatgaccg cgttttcgcc cgtcgccgca 6060

caactgattg acgaggcggg cgtatggctc ggcgagcaac tgcgcggctg aaagcttgcg 6120

gccgcactcg agcaccacca ccaccaccac tgagatccgg ctgctaacaa agcccgaaag 6180

gaagctgagt tggctgctgc caccgctgag caataactag cataacccct tggggcctct 6240

aaacgggtct tgaggggttt tttgctgaaa ggaggaacta tatccggat 6289

<210> 12

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

ccatggctga tatcggatcc atgcccgtag accccaacct 40

<210> 13

<211> 40

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

ctcgagtgcg gccgcaagct ttcagccgcg cagttgctcg 40

<210> 14

<211> 38

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

gcgccggtag acgacgccct ggcgnnkgtg gtctgggc 38

<210> 15

<211> 38

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

ggcggcgtgc gcggcggccc agaccacmnn cgccaggg 38

<210> 16

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

gacagcgcgg gggccaacct cgccnnkgtc acggcg 36

<210> 17

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 17

cgtcacgcga ccgcagcgcc gtgacmnngg cgaggt 36

<210> 18

<211> 37

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 18

acgcctcgcc gctcaacgct gagnnkctcg cggggtt 37

<210> 19

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 19

accagggccg gcggcaaccc cgcgagmnnc tcagcg 36

<210> 20

<211> 35

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 20

gcatgattca cggtnnkgcc aacatgaccg cgttt 35

<210> 21

<211> 36

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 21

ggcgaaaccg tmnntcatgc cggggccggg gcggta 36

Claims (7)

1. A method for improving esterase activity, which comprises mutating one of amino acid residues to be mutated of a wild-type esterase, and is characterized in that the amino acid sequence of the wild-type esterase is shown as SEQ ID NO.2, and the amino acid residue to be mutated is serine residue at position 238; the mutation was engineered to mutate serine residue 238 to asparagine residue.

2. A protein with esterase activity, wherein the protein is derived by substituting 1 amino acid in the amino acid sequence of wild esterase shown in SEQ ID NO. 2; and the amino acid sequence of the protein is shown as SEQ ID NO. 5.

3. A gene encoding the protein of claim 2, wherein the gene is a DNA molecule having the nucleotide sequence shown in SEQ ID No. 9.

4. A recombinant vector, wherein the recombinant vector is inserted with the gene of claim 3.

5. A transformant, wherein the host of the transformant is a genetically engineered bacterium; the gene introduced into the transformant includes the gene of claim 3, or the recombinant vector introduced into the transformant includes the recombinant vector of claim 4.

6. A method of preparing an esterase, wherein the method comprises: the transformant according to claim 5 is inoculated into a medium and cultured to obtain a cultured material.

7. Use of an esterase for degrading p-nitrophenyl esters, wherein the esterase comprises the protein of claim 2.