CN109735520B

CN109735520B - Iota-carrageenase with thermal stability and application thereof

Info

Publication number: CN109735520B
Application number: CN201811596818.9A
Authority: CN
Inventors: 于惠青; 李尚勇
Original assignee: Qingdao University
Current assignee: Qingdao University
Priority date: 2018-12-26
Filing date: 2018-12-26
Publication date: 2020-06-05
Anticipated expiration: 2038-12-26
Also published as: CN111088183A; CN109735520A; CN111088183B

Abstract

The invention relates to iota-carrageenase CgoV with heat stability and application thereof. The iota-carrageenase gene provided by the invention is derived from marine bacteria Vibrio sp.SY01, the strain is preserved in China center for type culture Collection, and the preservation number is CCTCC No: m2018769. The amino acid sequence of the iota-carrageenase CgiV is shown in SEQ ID NO. 1. The similarity of the amino acid sequence and the known functional iota-carrageenase is only 88 percent. The iota-carrageenase is obtained by purifying a recombinant expression engineering strain, has the thermal stability, has the active half-life period of 6.5 hours at 40 ℃ and 42 hours at 30 ℃, and has industrial application potential.

Description

Iota-carrageenase with thermal stability and application thereof

Technical Field

The invention relates to a novel iota-carrageenan CgoV with a thermal stability characteristic and application thereof, belonging to the technical field of biology.

Background

The carrageenan is linear polysaccharide sulfate formed by alternately connecting 1,4- α -D-galactopyranose and 1,3- β -D-galactopyranose serving as basic skeletons, the carrageenan which is produced and used industrially at present mainly comprises three types of i-type, i-type and lambda-type according to whether the carrageenan contains a 3, 6-diether galactose structure and the content of sulfate groups, and disaccharide units of the carrageenan respectively contain 1, 2 and 3 sulfate groups.

Iota-carrageenan is a carrageenan degrading enzyme which can degrade macromolecular carrageenan into oligosaccharide by breaking β -1,4 glycosidic bonds of the carrageenan, the traditional iota-carrageenan is directly separated and extracted from supernatant of fermentation liquor of marine bacteria, and is limited by low yield of natural iota-carrageenan, and iota-carrageenan for developing genetic engineering is imperative.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides iota-carrageenase CgoV with heat recovery characteristic and application thereof. The iota-carrageenase gene provided by the invention is derived from marine bacteria Vibrio sp.SY01, the strain is preserved in China center for type culture Collection, and the preservation number is CCTCC No: m2018769, depository address: wuhan university, preservation date: 11/12/2018. The amino acid similarity of the iota-carrageenase provided by the invention and the existing iota-carrageenase is only 88%. The optimal reaction temperature is 40 ℃; has the thermal stability, the activity half-life period at 40 ℃ is as long as 6.5h, and the activity half-life period at 30 ℃ is as long as 42 h. The enzymolysis main products are iota-carrageenan disaccharide and tetrasaccharide.

In one aspect, the invention provides a novel iota-carrageenan CgoV, the amino acid sequence of which is shown in SEQ ID No. 1.

SEQ ID NO.1：

MIKASDFYTDKIKEAKKTVNYTGYKVNNKDDQDDSKNLQKAIDDLTAIKKGGVINIPEGKYYFKNIILKSNVHIVIDEKATIYATYPGSDKNFMIMSFGEFGTHYVSVRAKKGMYTVDLSVSKNKNVRMFQVNNSENYKGQQRENILDDNTKFNGITLGYCKYNGKYVMPENGVIKNCRIEKAHYGYGLIQSQASTNVYYENIWGDGGVTLRLETDNLKMNDLQVGGNHNIHGKNIYCQNGNAASHYTHEMQNGHVEMDGVESVNCGFAVRIGKGYVSKKQKVANLKPGTYANQAVESKLGRGCAQGTYREWNGGTRWAARVTQKDACLDKAKLEYGIEPGSFGTVKVSNIKSTYGTTAQVKSKHFKYMPCPERKLIRVCLALMVSPHSIQNGHVEAENVEAVNCVNAKGKGGAPKGYWNVEITNVESVGYPHQSKDILYEQDAVKNCKEGK

In another aspect, the invention also provides a nucleic acid sequence corresponding to the iota-carrageenan CgiV, which is shown in SEQ ID No. 2.

SEQ ID NO.2：

ATGATTAAAGCATCTGATTTCTACACAGATAAAATTAAAGAAGCAAAAAAAACAGTAAACTACACAGGTTACAAAGTAAACAACAAAGATGATCAAGATGATTCTAAAAACTTACAAAAAGCAATTGATGATTTAACAGCAATTAAAAAAGGTGGTGTAATTAACATTCCAGAAGGTAAATACTACTTCAAAAACATTATTTTAAAATCTAACGTACATATTGTAATTGATGAAAAAGCAACAATTTACGCAACATACCCAGGTTCTGATAAAAACTTCATGATTATGTCTTTCGGTGAATTCGGTACACATTACGTATCTGTACGTGCAAAAAAAGGTATGTACACAGTAGATTTATCTGTATCTAAAAACAAAAACGTACGTATGTTCCAAGTAAACAACTCTGAAAACTACAAAGGTCAACAACGTGAAAACATTTTAGATGATAACACAAAATTCAACGGTATTACATTAGGTTACTGTAAATACAACGGTAAATACGTAATGCCAGAAAACGGTGTAATTAAAAACTGTCGTATTGAAAAAGCACATTACGGTTACGGTTTAATTCAATCTCAAGCATCTACAAACGTATACTACGAAAACATTTGGGGTGATGGTGGTGTAACATTACGTTTAGAAACAGATAACTTAAAAATGAACGATTTACAAGTAGGTGGTAACCATAACATTCATGGTAAAAACATTTACTGTCAAAACGGTAACGCAGCATCTCATTACACACATGAAATGCAAAACGGTCATGTAGAAATGGATGGTGTAGAATCTGTAAACTGTGGTTTCGCAGTACGTATTGGTAAAGGTTACGTATCTAAAAAACAAAAAGTAGCAAACTTAAAACCAGGTACATACGCAAACCAAGCAGTAGAATCTAAATTAGGTCGTGGTTGTGCACAAGGTACATACCGTGAATGGAACGGTGGTACACGTTGGGCAGCACGTGTAACACAAAAAGATGCATGTTTAGATAAAGCAAAATTAGAATACGGTATTGAACCAGGTTCTTTCGGTACAGTAAAAGTATCTAACATTAAATCTACATACGGTACAACAGCACAAGTAAAATCTAAACATTTCAAATACATGCCATGTCCAGAACGTAAATTAATTCGTGTATGTTTAGCATTAATGGTATCTCCACATTCTATTCAAAACGGTCATGTAGAAGCAGAAAACGTAGAAGCAGTAAACTGTGTAAACGCAAAAGGTAAAGGTGGTGCACCAAAAGGTTACTGGAACGTAGAAATTACAAACGTAGAATCTGTAGGTTACCCACATCAATCTAAAGATATTTTATACGAACAAGATGCAGTAAAAAACTGTAAAGAAGGTAAATAA

On the other hand, the invention also provides a preparation method of the novel iota-carrageenan CgoV.

In another aspect, the invention also provides the use of the iota-carrageenan enzyme CgiV in hydrolyzing carrageenan.

In another aspect, the invention also provides the application of the iota-carrageenan CgiV in the preparation of iota-carrageenan oligosaccharide.

In another aspect, the iota-carrageenan enzyme selected for use in a process for hydrolyzing iota-carrageenan is CgiV.

Preferably: the reaction temperature in the hydrolysis condition is 0-70 ℃. The optimum reaction temperature is 40 ℃.

Has the advantages that:

1. the iota-carrageenase CgoV is an iota-carrageenase with novel structure and function, belongs to polysaccharide hydrolase 82 th family (GH82), and has an amino acid sequence similarity of 88% with the existing iota-carrageenase sequence.

2. The invention provides a method for preparing iota-carrageenase CgiV, which is characterized in that a gene sequence of CgiV is heterologously recombined and expressed to escherichia coli by utilizing a technical method of genetic engineering, and the enzyme activity of fermentation liquor reaches 37.9U/mL after shaking flask fermentation. The enzyme purification method is simple, and the recovery rate and the protein purity of the enzyme are respectively up to 88.6% and 98.2% by one-step affinity purification by using a nickel column.

3. The iota-carrageenase CgiV has excellent physicochemical property and thermal stability, and has an active half-life period of 0.7h at 50 ℃, an active half-life period of 6.5h at 40 ℃ and an active half-life period of 42h at 30 ℃. And (4) analyzing degradation products, wherein the main degradation products of the enzyme are iota-carrageenan disaccharide and tetrasaccharide.

In conclusion, the iota-carrageenan CgoV has good industrial application prospect.

The name of the depository: china center for type culture Collection;

the preservation date is as follows: 11/12/2018;

the preservation number is: CCTCC No: m2018769.

Drawings

FIG. 1 is a diagram showing the separation and purification of the iota-carrageenan CgiV protein of the invention (M, protein standard; 1, iota-carrageenan CgiV obtained by purification);

FIG. 2 is the optimum reaction temperature for the iota-carrageenan CgoV of the present invention;

fig. 3 is a graph of the temperature stability of iota-carrageenase CgiV of the present invention;

fig. 4 shows the activity half-life of iota-carrageenase CgiV of the present invention at 30 ℃;

fig. 5 shows the activity half-life of iota-carrageenase CgiV of the present invention at 40 ℃;

fig. 6 shows the activity half-life of iota-carrageenase CgiV of the present invention at 50 ℃;

FIG. 7 shows the Thin Layer Chromatography (TLC) method for detecting the enzymolysis products of the iota-carrageenase CgiV of the invention (M, iota-carrageenin oligosaccharide DP2, 4 sugar DP4 standard; 0, substrate before enzymolysis; 1, product after enzymolysis).

Detailed Description

Example 1 iota-Carragenase CgoV sequence analysis

The enzyme production gene CgiV of the iota-carrageenase CgiV is derived from marine bacteria Vibrio sp.SY01, the strain is preserved in China center for type culture Collection, and the preservation number is CCTCC No: m2018769. Comprises 1359 base sequences and codes 452 amino acid sequences. Conserved domain analysis (CDD) and multiple sequence alignment of Basic Local alignment search Tool (Blast) using the Conserved domain in the National Center for Biotechnology Information (NCBI) revealed that this sequence contains a Conserved region of the polysaccharide hydrolase (GH82) family. Of the iota-carrageenases reported, the iota-carrageenase (Genbank APX55175) derived from the GH82 family of Flavobacterium sp has the highest similarity to the CgiV amino acid sequence, and the amino acid sequence similarity (Identity) between the two is 88%.

Example 2 recombinant expression of iota-Carrageenase CgiV

The iota-carrageenan CgiV gene sequence of example 1 was cut with restriction enzymes Nco I and Xho I as cut sites, and recombinant primers were designed as follows (underlined restriction enzyme sites, italicized restriction enzyme protection bases):

a forward primer: SEQ ID NO. 3: PCgiVF:

5’-CATGCCATGGATGATTAAAGCATCTGATTTC-3’(Nco I)

reverse primer: SEQ ID NO. 4: PCgiVR:

5’-CCGCTCGAGTTTACCTTGTTTACAGTTTTTTAC-3’(Xho I)

the PCR amplification conditions were: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, and extension at 72 ℃ for 1.5 minutes for 30 cycles; extension at 72 ℃ for 5 min; the reaction was stabilized at 4 ℃ for 15 minutes. The DNA polymerase used for the PCR reaction was Primerstar HS, available from Dalibao Bio.

The PCR product was double-digested with restriction enzymes Nco I and Xho I, and the digested PCR product was recovered by agarose gel electrophoresis. pET22b (+) plasmid DNA (Invitrogen, USA) was also double-digested with restriction enzymes Nco I and Xho I, subjected to agarose gel electrophoresis, and the product fragment after the digestion was recovered. The enzyme and substrate reaction system (temperature, time, DNA dosage and the like) used in the enzyme digestion are operated according to the product instruction provided by the Dalianbao organism.

The ligation reaction was carried out by referring to DNA ligase (Darland Bio Inc.) for the PCR product and pET-22b (+) plasmid vector, the ligation product was transformed into E.coli DH5 α strain (Invitrogen, USA), and the strain was spread on a Luria-Bertani (LB) medium solid plate (containing 50. mu.g/mL ampicillin), cultured in a 37 ℃ incubator for 12-16 hours, and then a single clone was picked up, transferred into LB liquid medium (containing 50. mu.g/mL ampicillin), and cultured overnight in a 37 ℃ shaker at 180rpm, and the single clone was subjected to sequencing, and a positive clone was selected and named pET22 b-CgV.the recombinant plasmid was transformed into E.coli BL21(DE3) (purchased from Darland Bio Inc.), and the recombinant E.coli strain was named BL21(DE3)/pET22b-CgIV was stored at-80 ℃ for use.

Example 3 fermentation and purification preparation of iota-Carrageenase CgiV

Coli BL21(DE3)/pET22b-CgiV constructed in example 2 was transferred to LB liquid medium (50. mu.g/mL ampicillin) and cultured with shaking at 180rpm in a shaker at 37 ℃ to OD₆₀₀Adding 0.6 to 0.1mM of inducer isopropyl- β -D-thiogalactoside (IPTG) to induce the activity of the iota-carrageenan enzyme for 24h at 20 ℃, and determining the activity of the iota-carrageenan enzyme by using a DNS method, wherein 900 mu L of 0.3% iota-carrageenan substrate (20mM phosphate buffer solution, pH 7.0) is added to 100 mu L of enzyme solution, reacting for 10min at 40 ℃, adding 750 mu L of DNS reagent to stop the reaction, boiling the solution in boiling water for 10min, and determining the value of A520 by using a spectrophotometer.

After fermentation is stopped, centrifuging at 12000rpm for 10min, discarding thalli, and collecting supernatant; loading to nickel ion affinity chromatography column at flow rate of 5ml/min, eluting with 10mM imidazole to remove impurity protein, eluting with 150mM imidazole, and collecting eluate. Dialyzing the active ingredient to remove imidazole, packaging and storing at-20 deg.C for use. Through one-step affinity purification of nickel ions, the recovery rate of protein reaches 88.6%. The purified enzyme solution was subjected to polyacrylamide gel electrophoresis (SDS-PAGE), and as shown in FIG. 1, the molecular weight of purified CgiV was about 45kDa, which was consistent with the protein size predicted in the sequence analysis. The protein purity of the iota-carrageenase obtained by purification reaches 98.2 percent through gel analysis.

Example 4 Effect of temperature on iota-Carrageenase CgoV

In order to examine the optimum reaction temperature of carrageenase, 0.3% of carrageenase substrate was respectively placed at 0-70 ℃ and incubated for 10min, iota-carrageenase (dissolved in phosphate buffer solution of ph 7.0) purified in example 3 was added, the enzymatic activity was examined by DNS method, the optimum reaction temperature of the enzymatic reaction was determined according to the value of OD520, and the activity at the time of the highest enzymatic activity was defined as 100%. As shown in fig. 2, the optimum reaction temperature for iota-carrageenan CgiV is 40 ℃.

1mL of iota-carrageenase purified and obtained in example 3 is incubated for 1h at different temperatures (0-70 ℃), after being taken out, the enzyme activity of the iota-carrageenase is immediately detected at the optimal reaction temperature (40 ℃), and the activity before incubation is taken as 100%, as shown in figure 3, the temperature stability of the iota-carrageenase CgoV is good, 87.3% of activity can still be maintained after incubation for 1h at 40 ℃, and 37.2% of activity can still be maintained after incubation for 1h at 50 ℃.

Example 5 thermal stability assay of iota-Carragenase CgiV

Incubating iota-carrageenase CgoV purified in the example 3 at 30 ℃, 40 ℃ and 50 ℃ for different times respectively, detecting the residual enzyme activity respectively, taking the activity before incubation as 100%, and calculating the time for losing half of the enzyme activity at different temperatures, namely the activity half-life (t1/2) by utilizing origin software. As shown in FIG. 4, CgiV maintains good stability at 30 ℃ and has an activity half-life (t1/2) as long as 42 h; as shown in FIG. 5, the activity half-life of CgiV at 40 ℃ (t1/2) is 6.5 h; as shown in FIG. 6, the activity half-life of CgiV at 50 ℃ (t1/2) is 0.7 h. Half-life period detection shows that the iota-carrageenan CgoV has good thermal stability and has good application prospect in the transportation and catalysis process.

Example 6 thin layer chromatography analysis of the iota-Carrageenase CgoV enzymatic hydrolysate

The iota-carrageenan CgiV pure enzyme (20U) purified in example 3 was incubated with 0.1% iota-carrageenan at 40 ℃ for 6h and then checked on a high performance thin layer chromatography plate (HPTLC). The method specifically comprises the following steps: TLC cutting HPTLC chromatographic plate which is activated in an oven at 100 ℃ for 2h in advance into samples with a width of 7cm and a proper size, spotting the samples before and after incubation at an origin, placing the samples in a developing tank with a developing agent (n-butyl alcohol: glacial acetic acid: water: 2:1:1) for 20min, drying the chromatographic plate by blowing, immersing the plate in a color developing agent (phenylaniline diphenylamine) for 2s, taking out and drying by blowing, and baking at high temperature until the samples appear. As shown in fig. 7, compared with the standard product migration rate, the main products of the iota-carrageenase CgiV enzymolysis are disaccharide (DP2) and tetrasaccharide (DP 4).

Sequence listing

<110> Qingdao university

<120> iota-carrageenase with heat stability and application thereof

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>452

<212>PRT

<213>Vibrio sp. SY08

<400>1

Met Ile Lys Ala Ser Asp Phe Tyr Thr Asp Lys Ile Lys Glu Ala Lys

1 5 10 15

Lys Thr Val Asn Tyr Thr Gly Tyr Lys Val Asn Asn Lys Asp Asp Gln

20 25 30

Asp Asp Ser Lys Asn Leu Gln Lys Ala Ile Asp Asp Leu Thr Ala Ile

35 40 45

Lys Lys Gly Gly Val Ile Asn Ile Pro Glu Gly Lys Tyr Tyr Phe Lys

50 55 60

Asn Ile Ile Leu Lys Ser Asn Val His Ile Val Ile Asp Glu Lys Ala

65 70 75 80

Thr Ile Tyr Ala Thr Tyr Pro Gly Ser Asp Lys Asn Phe Met Ile Met

85 90 95

Ser Phe Gly Glu Phe Gly Thr His Tyr Val Ser Val Arg Ala Lys Lys

100 105 110

Gly Met Tyr Thr Val Asp Leu Ser Val Ser Lys Asn Lys Asn Val Arg

115 120 125

Met Phe Gln Val Asn Asn Ser Glu Asn Tyr Lys Gly Gln Gln Arg Glu

130 135 140

Asn Ile Leu Asp Asp Asn Thr Lys Phe Asn Gly Ile Thr Leu Gly Tyr

145 150 155 160

Cys Lys Tyr Asn Gly Lys Tyr Val Met Pro Glu Asn Gly Val Ile Lys

165 170 175

Asn Cys Arg Ile Glu Lys Ala His Tyr Gly Tyr Gly Leu Ile Gln Ser

180 185 190

Gln Ala Ser Thr Asn Val Tyr Tyr Glu Asn Ile Trp Gly Asp Gly Gly

195 200 205

Val Thr Leu Arg Leu Glu Thr Asp Asn Leu Lys Met Asn Asp Leu Gln

210 215 220

Val Gly Gly Asn His Asn Ile His Gly Lys Asn Ile Tyr Cys Gln Asn

225 230 235 240

Gly Asn Ala Ala Ser His Tyr Thr His Glu Met Gln Asn Gly His Val

245 250 255

Glu Met Asp Gly Val Glu Ser Val Asn Cys Gly Phe Ala Val Arg Ile

260 265 270

Gly Lys Gly Tyr Val Ser Lys Lys Gln Lys Val Ala Asn Leu Lys Pro

275 280 285

Gly Thr Tyr Ala Asn Gln Ala Val Glu Ser Lys Leu Gly Arg Gly Cys

290 295 300

Ala Gln Gly Thr Tyr Arg Glu Trp Asn Gly Gly Thr Arg Trp Ala Ala

305 310 315 320

Arg Val Thr Gln Lys Asp Ala Cys Leu Asp Lys Ala Lys Leu Glu Tyr

325 330 335

Gly Ile Glu Pro Gly Ser Phe Gly Thr Val Lys Val Ser Asn Ile Lys

340 345 350

Ser Thr Tyr Gly Thr Thr Ala Gln Val Lys Ser Lys His Phe Lys Tyr

355 360 365

Met Pro Cys Pro Glu Arg Lys Leu Ile Arg Val Cys Leu Ala Leu Met

370 375 380

Val Ser Pro His Ser Ile Gln Asn Gly His Val Glu Ala Glu Asn Val

385 390 395 400

Glu Ala Val Asn Cys Val Asn Ala Lys Gly Lys Gly Gly Ala Pro Lys

405 410 415

Gly Tyr Trp Asn Val Glu Ile Thr Asn Val Glu Ser Val Gly Tyr Pro

420 425 430

His Gln Ser Lys Asp Ile Leu Tyr Glu Gln Asp Ala Val Lys Asn Cys

435 440 445

Lys Glu Gly Lys

450

<210>2

<211>1359

<212>DNA

<213>Vibrio sp. SY08

<400>2

atgattaaag catctgattt ctacacagat aaaattaaag aagcaaaaaa aacagtaaac 60

tacacaggtt acaaagtaaa caacaaagat gatcaagatg attctaaaaa cttacaaaaa 120

gcaattgatg atttaacagc aattaaaaaa ggtggtgtaa ttaacattcc agaaggtaaa 180

tactacttca aaaacattat tttaaaatct aacgtacata ttgtaattga tgaaaaagca 240

acaatttacg caacataccc aggttctgat aaaaacttca tgattatgtc tttcggtgaa 300

ttcggtacac attacgtatc tgtacgtgca aaaaaaggta tgtacacagt agatttatct 360

gtatctaaaa acaaaaacgt acgtatgttc caagtaaaca actctgaaaa ctacaaaggt 420

caacaacgtg aaaacatttt agatgataac acaaaattca acggtattac attaggttac 480

tgtaaataca acggtaaata cgtaatgcca gaaaacggtg taattaaaaa ctgtcgtatt 540

gaaaaagcac attacggtta cggtttaatt caatctcaag catctacaaa cgtatactac 600

gaaaacattt ggggtgatgg tggtgtaaca ttacgtttag aaacagataa cttaaaaatg 660

aacgatttac aagtaggtgg taaccataac attcatggta aaaacattta ctgtcaaaac 720

ggtaacgcag catctcatta cacacatgaa atgcaaaacg gtcatgtaga aatggatggt 780

gtagaatctg taaactgtgg tttcgcagta cgtattggta aaggttacgt atctaaaaaa 840

caaaaagtag caaacttaaa accaggtaca tacgcaaacc aagcagtaga atctaaatta 900

ggtcgtggtt gtgcacaagg tacataccgt gaatggaacg gtggtacacg ttgggcagca 960

cgtgtaacac aaaaagatgc atgtttagat aaagcaaaat tagaatacgg tattgaacca 1020

ggttctttcg gtacagtaaa agtatctaac attaaatcta catacggtac aacagcacaa 1080

gtaaaatcta aacatttcaa atacatgcca tgtccagaac gtaaattaat tcgtgtatgt 1140

ttagcattaa tggtatctcc acattctatt caaaacggtc atgtagaagc agaaaacgta 1200

gaagcagtaa actgtgtaaa cgcaaaaggt aaaggtggtg caccaaaagg ttactggaac 1260

gtagaaatta caaacgtaga atctgtaggt tacccacatc aatctaaaga tattttatac 1320

gaacaagatg cagtaaaaaa ctgtaaagaa ggtaaataa 1359

<210>3

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

catgccatgg atgattaaag catctgattt c 31

<210>4

<211>33

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ccgctcgagt ttaccttgtt tacagttttt tac 33

Claims

1. The amino acid sequence of the novel iota-carrageenase is shown in SEQ ID NO. 1.

2. The iota-carrageenan enzyme of claim 1, wherein the nucleotide sequence is represented by SEQ ID No. 2.

3. The iota-carrageenase production and purification process according to claim 1, characterized in that: the method comprises the following specific steps:

transferring Escherichia coli BL21(DE3)/pET22b-CgiV into LB liquid medium containing 50. mu.g/mL ampicillin, shaking-culturing at 180rpm in a shaker at 37 ℃ until OD600 becomes 0.6, adding inducer isopropyl- β -D-thiogalactoside to the medium to a final concentration of 0.1mM, inducing the medium at 20 ℃ for 24 hours,

after fermentation is stopped, centrifuging at 12000rpm for 10min, discarding thalli, and collecting supernatant; loading onto nickel ion affinity chromatography column at flow rate of 5ml/min, eluting with 10mM imidazole to remove impure protein, eluting with 150mM imidazole, collecting eluate, dialyzing active ingredient to remove imidazole,

the preparation method of the Escherichia coli BL21(DE3)/pET22b-CgiV is as follows:

taking the sequence of the iota-carrageenase CgiV gene and restriction enzymes Nco I and Xho I as enzyme cutting sites, designing recombinant primers as follows:

a forward primer: SEQ ID NO. 3: PCgiVF:

5’-CATGCCATGGATGATTAAAGCATCTGATTTC-3’ (Nco I)

reverse primer: SEQ ID NO. 4: PCgiVR:

5’-CCGCTCGAGTTTACCTTGTTTACAGTTTTTTAC-3’ (Xho I)

PCR amplification conditions are pre-denaturation at 94 ℃ for 3 minutes, denaturation at 94 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, extension at 72 ℃ for 1.5 minutes for 30 cycles, extension at 72 ℃ for 5 minutes, stabilization at 4 ℃ for 15 minutes, PCR reaction using Primerstart HS, PCR products obtained by restriction enzymes Nco I and Xho I, double digestion using restriction enzymes Nco I and Xho I, agarose gel electrophoresis and recovery of product fragments obtained by digestion, pET22b (+) plasmid DNA, obtained from Invitrogen, similarly double digestion using restriction enzymes Nco I and Xho I, PCR products obtained by digestion and substrate reaction system, reference DNA ligase from PectionProv, named pEJOB, ligation reaction, E.coli strain 5 α, obtained by cloning PCR products from PectionProv, PCR products obtained by PCR products and PCR products obtained by PCR products from PectionProv, PCR products obtained by PCR products and pET-22b (+) vector reference ligase, obtained by cloning and cultured in a single colony cloning cassette containing ampicillin DNA, plasmid DNA, cloned at 50. sup./plasmid DNA, cloned in PCR amplification medium, transferred from Bl 50 mL-22 b, cultured at 50 mL, agar medium (LB-10 mL), cultured overnight, LB-96 mL) and cultured at 94 ℃ for 50 mL, after culturing, the temperature of a single colony amplification medium (LB-32 mL) to obtain plasmid containing ampicillin-96 hours, and containing plasmid containing ampicillin, and plasmid containing plasmid, and plasmid transferred in a plasmid transferred from Bl strain, and cultured in a plasmid transferred in agar medium (48 mL);

the enzyme production gene CgiV of the iota-carrageenase CgiV is derived from marine bacteria Vibrio sp.SY01, the strain is preserved in China center for type culture Collection, and the preservation number is CCTCC No: m2018769.

4. Use of iota-carrageenan enzyme according to claim 1 for degrading carrageenan.

5. Use of iota-carrageenan enzyme according to claim 1 for the preparation of carrageenan oligosaccharides.

6. A method for hydrolyzing carrageenan is characterized by comprising the following steps: placing a carrageenan substrate at 0-70 ℃ and keeping the temperature for 10min, and then adding the iota-carrageenase with the heat stability as claimed in claim 1, wherein the iota-carrageenase is dissolved in a phosphate buffer solution with the pH value of 7.0.

7. The process according to claim 5, characterized in that the iota-carrageenan enzyme having heat-stable properties according to claim 1 is added after incubation of the carrageenan substrate at 0-70 ℃ for 10min, said iota-carrageenan enzyme being dissolved in a phosphate buffer at pH 7.0.