CN109762799B

CN109762799B - Kappa-carrageenase and application thereof

Info

Publication number: CN109762799B
Application number: CN201811596638.0A
Authority: CN
Inventors: 于惠青; 李尚勇
Original assignee: Qingdao University
Current assignee: Qingdao University
Priority date: 2018-12-26
Filing date: 2018-12-26
Publication date: 2020-06-05
Anticipated expiration: 2038-12-26
Also published as: CN109762799A

Abstract

The invention relates to an endo-kappa-carrageenase CgkA with heat recovery characteristic and application thereof. The kappa-carrageenase gene provided by the invention is derived from marine bacteria Vibrio sp.SY08, and the strain is preserved in China center for type culture Collection with the preservation number of CCTCC No: m2018769. The amino acid sequence of the kappa-carrageenase CgkA is shown in SEQ ID NO. 1. The amino acid sequence has only 87% similarity to known functional kappa-carrageenases. The kappa-carrageenase is obtained by purifying a recombinant expression engineering strain, has the heat recovery characteristic, and can recover 58.4 percent of activity after the enzyme solution is boiled for 5 minutes and placed in ice water (0 ℃) for 30 minutes. The kappa-carrageenase has good physicochemical property and industrial application potential.

Description

Kappa-carrageenase and application thereof

Technical Field

The invention relates to an endo-type novel kappa-carrageenase CgkA with heat recovery characteristics and application thereof, belonging to the technical field of biology.

Background

The carrageenan is linear polysaccharide sulfate formed by alternately connecting 1,4- α -D-galactopyranose and 1,3- β -D-galactopyranose serving as basic skeletons, the carrageenan which is produced and used industrially at present mainly comprises three types of kappa-type, iota-type and lambda-type according to whether 3, 6-lactonic galactose structure is contained or not and the content of sulfate groups is different, and disaccharide units of the carrageenan oligosaccharide respectively comprise 1, 2 and 3 sulfate groups.

The carrageenin degrading enzyme is an enzyme for degrading macromolecular carrageenin into oligosaccharide by breaking β -1,4 glycosidic bonds of the carrageenin, wherein the kappa-carrageenin is carrageenin for specifically degrading the kappa-carrageenin, the traditional kappa-carrageenin is directly separated and extracted from supernatant of fermentation liquor of marine bacteria, the production of the kappa-carrageenin is limited by low yield of natural kappa-carrageenin, and the kappa-carrageenin for developing genetic engineering is imperative.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides an endo-kappa-carrageenase CgkA with heat recovery characteristics and application thereof. The kappa-carrageenase gene provided by the invention is derived from marine bacteria Vibrio sp.SY01, and is classified and named as follows: the Vibrio SY01(Vibrio sp.SY01) is preserved in China center for type culture Collection with the preservation number of CCTCC No: m2018769, depository address: wuhan university, preservation date: 11/12/2018. The amino acid similarity of the kappa-carrageenase provided by the invention and the existing kappa-carrageenase is only 87%. The optimal reaction temperature is 40 ℃; after the enzyme solution was boiled for 5 minutes, it was allowed to stand in ice water (0 ℃ C.) for 30 minutes, and 58.4% of its activity was recovered. The enzyme degradation mode is endo-cutting, and the main products of enzymolysis are kappa-carrageenan disaccharide and tetrasaccharide.

In one aspect, the invention provides a novel kappa-carrageenase CgkA, the amino acid sequence of which is shown in SEQ ID No. 1.

SEQ ID NO.1：

MLGTPSLARSQSGDNAKPLTAKPGEKWTIKWNRSDDFDGDLVDWKKWNFQTENYGVWSWRNENATVSNGKLKLTTKRETHNRTFWDGCNQQQVANYPLYYTSGVAKSRATGNYGYYEARIKGASTFPGVSPAFWMYSTIDRSLTKEGDVQYSEIDVVELTQKSAVRESDHDLHNIVVKNGKPTWMRPGSFPQTNHNGYHLPFDPRNDFHTYGVNVTKDDITWYVDGVQVGYKKNLYWHRQMNLTLSQGLRAPHTEWRCNQFYPSANKSAEGFPTSMEVDYVRTWVKVGNNNSDPGEGQSCPNTFVAVNSVQLSAAKQTLRKGQSTTLNTNVLPACATNKNVVYSTSNKNVATVTNEGVVKAKNKGSATITVKTKNKGKTDTVMITVN

On the other hand, the invention also provides a nucleic acid sequence corresponding to the kappa-carrageenase CgkA, which is shown as SEQ ID NO. 2.

SEQ ID NO.2：

ATGCTGGGCACCCCGAGCCTGGCCCGCAGCCAGAGCGGCGACAACGCCAAGCCGCTGACCGCCAAGCCGGGCGAAAAGTGGACCATCAAGTGGAACCGCAGCGACGACTTCGACGGCGACCTGGTGGACTGGAAGAAGTGGAACTTCCAGACCGAAAACTACGGCGTGTGGAGCTGGCGCAACGAAAACGCCACCGTGAGCAACGGCAAGCTGAAGCTGACCACCAAGCGCGAAACCCACAACCGCACCTTCTGGGACGGCTGCAACCAGCAGCAGGTGGCCAACTACCCGCTGTACTACACCAGCGGCGTGGCCAAGAGCCGCGCCACCGGCAACTACGGCTACTACGAAGCCCGCATCAAGGGCGCCAGCACCTTCCCGGGCGTGAGCCCGGCCTTCTGGATGTACAGCACCATCGACCGCAGCCTGACCAAGGAAGGCGACGTGCAGTACAGCGAAATCGACGTGGTGGAACTGACCCAGAAGAGCGCCGTGCGCGAAAGCGACCACGACCTGCACAACATCGTGGTGAAGAACGGCAAGCCGACCTGGATGCGCCCGGGCAGCTTCCCGCAGACCAACCACAACGGCTACCACCTGCCGTTCGACCCGCGCAACGACTTCCACACCTACGGCGTGAACGTGACCAAGGACGACATCACCTGGTACGTGGACGGCGTGCAGGTGGGCTACAAGAAGAACCTGTACTGGCACCGCCAGATGAACCTGACCCTGAGCCAGGGCCTGCGCGCCCCGCACACCGAATGGCGCTGCAACCAGTTCTACCCGAGCGCCAACAAGAGCGCCGAAGGCTTCCCGACCAGCATGGAAGTGGACTACGTGCGCACCTGGGTGAAGGTGGGCAACAACAACAGCGACCCGGGCGAAGGCCAGAGCTGCCCGAACACCTTCGTGGCCGTGAACAGCGTGCAGCTGAGCGCCGCCAAGCAGACCCTGCGCAAGGGCCAGAGCACCACCCTGAACACCAACGTGCTGCCGGCCTGCGCCACCAACAAGAACGTGGTGTACAGCACCAGCAACAAGAACGTGGCCACCGTGACCAACGAAGGCGTGGTGAAGGCCAAGAACAAGGGCAGCGCCACCATCACCGTGAAGACCAAGAACAAGGGCAAGACCGACACCGTGATGATCACCGTGAACTAA

On the other hand, the invention also provides a preparation method of the novel kappa-carrageenase CgkA.

On the other hand, the invention also provides application of the kappa-carrageenase CgkA in hydrolyzing carrageenans.

On the other hand, the invention also provides application of the kappa-carrageenase CgkA in preparation of kappa-carrageenase oligosaccharide.

In another aspect, a method of hydrolyzing kappa-carrageenan, the kappa-carrageenan enzyme selected is CgkA.

Preferably: the reaction temperature in the hydrolysis condition is 0-70 ℃. The optimum reaction temperature is 40 ℃.

Has the advantages that:

1. the kappa-carrageenase CgkA is a kappa-carrageenase with novel structure and function, belongs to polysaccharide hydrolase family 16 (GH16), and has an amino acid sequence with 87 percent of similarity with the existing kappa-carrageenase sequence.

2. The invention provides a method for preparing kappa-carrageenase CgkA, which is characterized in that a gene sequence of CgkA is heterologously recombined and expressed to escherichia coli by utilizing a technical method of genetic engineering, and the enzyme activity of fermentation liquor reaches 19.7U/mL after shaking flask fermentation. The enzyme purification method is simple, and the recovery rate and the protein purity of the enzyme are respectively up to 87.5% and 93.5% by one-step affinity purification by using a nickel column.

3. The kappa-carrageenase CgkA has excellent physicochemical properties, has the characteristic of heat recovery (Thermo-comfort), and can recover 58.4 percent of activity after the enzyme solution is boiled for 5 minutes and placed in ice water (0 ℃) for 30 minutes. And (4) analyzing degradation products, wherein the main degradation products of the enzyme are kappa-carrageenan disaccharide and tetrasaccharide.

In conclusion, the kappa-carrageenase CgkA has good industrial application prospect.

The name of the depository: china center for type culture Collection;

the preservation date is as follows: 11/12/2018;

the preservation number is: CCTCC No: m2018769.

Drawings

FIG. 1 is a diagram showing the separation and purification of kappa-carrageenase CgkA protein of the present invention (M, protein standard; 1, purified kappa-carrageenase CgkA);

FIG. 2 is the optimum reaction temperature for the kappa-carrageenase CgkA of the present invention;

FIG. 3 is a graph of the temperature stability of the kappa-carrageenase CgkA of the present invention;

FIG. 4 is a graph of the thermal recovery effect on kappa-carrageenan CgkA of the present invention after incubation for 1h at different temperatures on ice for 0 and 30 min;

FIG. 5 is a graph of the effect of boiling for various periods of time on the thermal recovery of the kappa-carrageenase CgkA of the present invention;

FIG. 6 is a graph of the thermal recovery effect of different incubation temperatures on the kappa-carrageenase CgkA of the present invention;

FIG. 7 shows the degradation pattern of kappa-carrageenase CgkA according to the present invention measured by the viscometry;

FIG. 8 shows the Thin Layer Chromatography (TLC) assay of the enzymatic products of kappa-carrageenase CgkA of the present invention (M, kappa-carrageenin oligosaccharide DP2, 4 sugar DP4 standards; 0, substrate before enzymatic hydrolysis; 1, product after enzymatic hydrolysis).

Detailed Description

Example 1 CgkA sequence analysis of kappa-Carragenase

The enzyme production gene cgkA of the kappa-carrageenase CgkA is derived from marine bacteria Vibrio sp.SY01, the strain is preserved in China center for type culture Collection, and the preservation number is CCTCC No: m2018769. Comprises 1164 base sequences and 387 amino acid sequences. Conserved domain analysis (CDD) and multiple sequence alignment of Basic Local alignment search Tool (Blast) using the Conserved domain in the National Center for Biotechnology Information (NCBI) revealed that this sequence contains a Conserved region of the polysaccharide hydrolase (GH16) family. Among the kappa-carrageenases that have been reported to have the highest similarity to the CgkA amino acid sequence is the kappa-carrageenase of GH16 family derived from pseudoalteromonas tetraodonis (Genbank BAJ61957), and the amino acid sequence similarity (Identity) between the two is 87%.

Example 2 recombinant expression of kappa-Carrageenase CgkA

The sequence of the kappa-carrageenase CgkA gene in example 1 was cut with restriction enzymes Nco I and Xho I as cut sites, and recombinant primers were designed as follows (restriction enzyme sites underlined, restriction enzyme protection bases in italics):

a forward primer: SEQ ID NO. 3: PcgkAF:

5’-CATGCCATGGATGCTGGGCACCCCGAGCC-3’(Nco I)

reverse primer: SEQ ID NO. 4: PcgkAR:

5’-CCGCTCGAGGTTCACGGTGATCATCA-3’(Xho I)

the PCR amplification conditions were: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, and extension at 72 ℃ for 1 minute for 30 cycles; extension at 72 ℃ for 5 min; the reaction was stabilized at 4 ℃ for 15 minutes. The DNA polymerase used for the PCR reaction was Primerstar HS, available from Dalibao Bio.

The PCR product was double-digested with restriction enzymes Nco I and Xho I, and the digested PCR product was recovered by agarose gel electrophoresis. pET22b (+) plasmid DNA (Invitrogen, USA) was also double-digested with restriction enzymes Nco I and Xho I, subjected to agarose gel electrophoresis, and the product fragment after the digestion was recovered. The enzyme and substrate reaction system (temperature, time, DNA dosage and the like) used in the enzyme digestion are operated according to the product instruction provided by the Dalianbao organism.

The ligation reaction was carried out by using the PCR product obtained by the double digestion treatment and the pET-22b (+) plasmid vector in accordance with the DNA ligase (Dagaibao Bio) protocol, the ligation product was transformed into E.coli DH5 α strain (Invitrogen, USA), the strain was spread on a Luria-Bertani (LB) medium solid plate (containing 50. mu.g/mL ampicillin), and after culturing at 37 ℃ in an incubator for 12 to 16 hours, a single clone was picked up, the single clone was transferred into an LB liquid medium (containing 50. mu.g/mL ampicillin), and cultured overnight in a shaker at 37 ℃ at a rotation speed of 180rpm, the single clone was subjected to sequencing, a positive clone was selected and named pET22b-cgkA, the recombinant plasmid was transformed into E.coli BL21(DE3) (available from Dagaibao Bio), the recombinant E.coli strain was named BL21(DE3)/pET22b-cgkA, and was stored at-80 ℃ for use.

Example 3 fermentation and purification preparation of kappa-Carrageenase CgkA

Escherichia coli BL21(DE3)/pET22b-cgkA constructed in example 2 was transferred to LB liquid medium (50. mu.g/mL ampicillin) and cultured with shaking at 180rpm in a shaker at 37 ℃ to OD₆₀₀Adding 0.6 to 0.1mM of inducer isopropyl- β -D-thiogalactoside (IPTG), inducing for 24h at 20 ℃, and measuring the activity of kappa-carrageenase by using a DNS method, wherein the specific method comprises the steps of adding 900 mu L of 0.3% kappa-carrageenase substrate (20mM phosphate buffer solution, pH 7.3) to 100 mu L of enzyme solution, reacting for 10min at 40 ℃, adding 750 mu L of DNS reagent to stop the reaction, boiling for 10min in boiling water, measuring the value of A520 by using a spectrophotometer, directly adding 750 mu L of DNS reagent after adding a control group to a sample, boiling for 10min, and detecting the activity of the enzyme, wherein the enzyme dosage required for catalyzing and generating 1 mu mol of reducing sugar per minute is defined as one enzyme activity unit (U), and the activity of the kappa-carrageenase in fermentation liquor is 19.7U/mL.

After fermentation is stopped, centrifuging at 12000rpm for 10min, discarding thalli, and collecting supernatant; loading to nickel ion affinity chromatography column at flow rate of 5ml/min, eluting with 10mM imidazole to remove impurity protein, eluting with 150mM imidazole, and collecting eluate. Dialyzing the active ingredient to remove imidazole, packaging and storing at-20 deg.C for use. Through one-step affinity purification of nickel ions, the recovery rate of protein reaches 87.5 percent. The purified enzyme solution was subjected to polyacrylamide gel electrophoresis (SDS-PAGE), and as shown in FIG. 1, the molecular weight of CgkA obtained by purification was about 38kDa, which was consistent with the protein size predicted in the sequence analysis. The protein purity of the purified kappa-carrageenase was found to reach 93.5% by gel analysis.

Example 4 Effect of temperature on kappa-Carragenase CgkA

In order to detect the optimum reaction temperature of carrageenase, 0.3% of carrageenase substrate is respectively placed at 0-70 ℃ and is kept warm for 10min, then kappa-carrageenase (dissolved in phosphate buffer solution with pH 7.3) obtained by purification in example 3 is added, the DNS method is used for detecting the enzyme activity, the optimum reaction temperature of the enzymatic reaction is determined according to the value of OD520, and the activity when the enzyme activity is the highest is defined as 100%. As shown in FIG. 2, the optimum reaction temperature for the kappa-carrageenase CgkA is 40 ℃.

1mL of the kappa-carrageenase purified and obtained in the example 3 is incubated for 1h at different temperatures (0-70 ℃), after being taken out, the enzyme activity of the kappa-carrageenase is immediately detected at the optimal reaction temperature (40 ℃), the activity before incubation is taken as 100%, as shown in figure 3, the temperature stability of the kappa-carrageenase CgkA is good, and 72.8% of activity can still be maintained after incubation for 1h at 40 ℃.

Example 5 Heat-recovery assay for kappa-Carrageenase CgkA

The kappa-carrageenase CgkA purified in example 3 was incubated at different temperatures (0-70 ℃) for 1h, respectively incubated on ice for 0min and 30min, and the enzyme activity was measured at 40 ℃. As shown in fig. 4, the activity measured by incubation on ice for 30min was significantly higher than that measured directly without incubation.

The kappa-carrageenase CgkA purified in example 3 was boiled for various times (5-60min), and then incubated on ice for 0min and 30min, and then its enzyme activity was measured at 40 ℃. As shown in FIG. 5, after boiling for 5-30min, the enzyme activity was partially recovered by incubating on ice for 30min, wherein the shorter the boiling time, the stronger the recovery.

Boiling the kappa-carrageenase CgkA purified in the embodiment 3 in boiling water at 100 ℃ for 5min, taking out, immediately placing at 0-50 ℃ for incubation for 30min, and detecting the residual enzyme activity, wherein the activity of the enzyme solution without boiling is 100%; enzyme activity obtained by direct detection after boiling is used as negative control; detecting the influence of different incubation temperatures on the thermal recovery of the incubation temperatures; as shown in fig. 6, after boiling 5min, kappa-carrageenase CgkA was incubated at 0 ℃ for 30min, with the best effect, it could recover 58.4% of its activity.

Example 6 viscosity determination of the CgkA degradation mode of kappa-Carragenase

The degradation mode was determined using Ubbelohde viscometer, adding 9.9ml of 0.1% kappa-carrageenan substrate to 100. mu.l of enzyme solution (30U), reacting at 30 ℃ for 0-60min, boiling for 10min to terminate the reaction. And calculating the product viscosity at different enzymolysis times by using an Ubbelohde viscometer under the condition of room temperature. Meanwhile, the DNS method is used for determining the absorbance change of products with different enzymolysis time, and the corresponding enzyme activity is determined. From the measurement results (fig. 7), it was found that the viscosity of the product rapidly decreased in the initial stage (1 to 5 minutes) of the enzymatic hydrolysis reaction, indicating that the enzymatic hydrolysis pattern of CgkA was endo-cleavage.

Example 7 thin layer chromatography analysis of CgkA enzymatic hydrolysate of kappa-Carrageenase

The purified kappa-carrageenase CgkA purified enzyme (20U) from example 3 was incubated with 0.1% kappa-carrageenase at 40 ℃ for 6h and then checked on High Performance Thin Layer Chromatography (HPTLC). The method specifically comprises the following steps: TLC cutting HPTLC chromatographic plate which is activated in an oven at 100 ℃ for 2h in advance into samples with a width of 7cm and a proper size, spotting the samples before and after incubation at an origin, placing the samples in a developing tank with a developing agent (n-butyl alcohol: glacial acetic acid: water: 2:1:1) for 20min, drying the chromatographic plate by blowing, immersing the plate in a color developing agent (phenylaniline diphenylamine) for 2s, taking out and drying by blowing, and baking at high temperature until the samples appear. As shown in fig. 8, compared with the standard product migration rate, the main products of the k-carrageenase CgkA enzymolysis are disaccharide (DP2) and tetrasaccharide (DP 4).

Sequence listing

<110> Qingdao university

<120> kappa-carrageenase and application thereof

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>387

<212>PRT

<213>Vibrio sp. SY08

<400>1

Met Leu Gly Thr Pro Ser Leu Ala Arg Ser Gln Ser Gly Asp Asn Ala

1 5 10 15

Lys Pro Leu Thr Ala Lys Pro Gly Glu Lys Trp Thr Ile Lys Trp Asn

20 25 30

Arg Ser Asp Asp Phe Asp Gly Asp Leu Val Asp Trp Lys Lys Trp Asn

3540 45

Phe Gln Thr Glu Asn Tyr Gly Val Trp Ser Trp Arg Asn Glu Asn Ala

50 55 60

Thr Val Ser Asn Gly Lys Leu Lys Leu Thr Thr Lys Arg Glu Thr His

65 70 75 80

Asn Arg Thr Phe Trp Asp Gly Cys Asn Gln Gln Gln Val Ala Asn Tyr

85 90 95

Pro Leu Tyr Tyr Thr Ser Gly Val Ala Lys Ser Arg Ala Thr Gly Asn

100 105 110

Tyr Gly Tyr Tyr Glu Ala Arg Ile Lys Gly Ala Ser Thr Phe Pro Gly

115 120 125

Val Ser Pro Ala Phe Trp Met Tyr Ser Thr Ile Asp Arg Ser Leu Thr

130 135 140

Lys Glu Gly Asp Val Gln Tyr Ser Glu Ile Asp Val Val Glu Leu Thr

145 150 155 160

Gln Lys Ser Ala Val Arg Glu Ser Asp His Asp Leu His Asn Ile Val

165 170 175

Val Lys Asn Gly Lys Pro Thr Trp Met Arg Pro Gly Ser Phe Pro Gln

180 185 190

Thr Asn His Asn Gly Tyr His Leu Pro Phe Asp Pro Arg Asn Asp Phe

195 200205

His Thr Tyr Gly Val Asn Val Thr Lys Asp Asp Ile Thr Trp Tyr Val

210 215 220

Asp Gly Val Gln Val Gly Tyr Lys Lys Asn Leu Tyr Trp His Arg Gln

225 230 235 240

Met Asn Leu Thr Leu Ser Gln Gly Leu Arg Ala Pro His Thr Glu Trp

245 250 255

Arg Cys Asn Gln Phe Tyr Pro Ser Ala Asn Lys Ser Ala Glu Gly Phe

260 265 270

Pro Thr Ser Met Glu Val Asp Tyr Val Arg Thr Trp Val Lys Val Gly

275 280 285

Asn Asn Asn Ser Asp Pro Gly Glu Gly Gln Ser Cys Pro Asn Thr Phe

290 295 300

Val Ala Val Asn Ser Val Gln Leu Ser Ala Ala Lys Gln Thr Leu Arg

305 310 315 320

Lys Gly Gln Ser Thr Thr Leu Asn Thr Asn Val Leu Pro Ala Cys Ala

325 330 335

Thr Asn Lys Asn Val Val Tyr Ser Thr Ser Asn Lys Asn Val Ala Thr

340 345 350

Val Thr Asn Glu Gly Val Val Lys Ala Lys Asn Lys Gly Ser Ala Thr

355 360365

Ile Thr Val Lys Thr Lys Asn Lys Gly Lys Thr Asp Thr Val Met Ile

370 375 380

Thr Val Asn

385

<210>2

<211>1164

<212>DNA

<213>Vibrio sp. SY08

<400>2

atgctgggca ccccgagcct ggcccgcagc cagagcggcg acaacgccaa gccgctgacc 60

gccaagccgg gcgaaaagtg gaccatcaag tggaaccgca gcgacgactt cgacggcgac 120

ctggtggact ggaagaagtg gaacttccag accgaaaact acggcgtgtg gagctggcgc 180

aacgaaaacg ccaccgtgag caacggcaag ctgaagctga ccaccaagcg cgaaacccac 240

aaccgcacct tctgggacgg ctgcaaccag cagcaggtgg ccaactaccc gctgtactac 300

accagcggcg tggccaagag ccgcgccacc ggcaactacg gctactacga agcccgcatc 360

aagggcgcca gcaccttccc gggcgtgagc ccggccttct ggatgtacag caccatcgac 420

cgcagcctga ccaaggaagg cgacgtgcag tacagcgaaa tcgacgtggt ggaactgacc 480

cagaagagcg ccgtgcgcga aagcgaccac gacctgcaca acatcgtggt gaagaacggc 540

aagccgacct ggatgcgccc gggcagcttc ccgcagacca accacaacgg ctaccacctg 600

ccgttcgacc cgcgcaacga cttccacacc tacggcgtga acgtgaccaa ggacgacatc 660

acctggtacg tggacggcgt gcaggtgggc tacaagaaga acctgtactg gcaccgccag 720

atgaacctga ccctgagcca gggcctgcgc gccccgcaca ccgaatggcg ctgcaaccag 780

ttctacccga gcgccaacaa gagcgccgaa ggcttcccga ccagcatgga agtggactac 840

gtgcgcacct gggtgaaggt gggcaacaac aacagcgacc cgggcgaagg ccagagctgc 900

ccgaacacct tcgtggccgt gaacagcgtg cagctgagcg ccgccaagca gaccctgcgc 960

aagggccaga gcaccaccct gaacaccaac gtgctgccgg cctgcgccac caacaagaac 1020

gtggtgtaca gcaccagcaa caagaacgtg gccaccgtga ccaacgaagg cgtggtgaag 1080

gccaagaaca agggcagcgc caccatcacc gtgaagacca agaacaaggg caagaccgac 1140

accgtgatga tcaccgtgaa ctaa 1164

<210>3

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

catgccatgg atgctgggca ccccgagcc 29

<210>4

<211>26

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ccgctcgagg ttcacggtga tcatca 26

Claims

1. A novel kappa-carrageenase has an amino acid sequence shown in SEQ ID NO. 1.

2. The nucleotide sequence corresponding to the kappa-carrageenase according to claim 1, wherein the nucleotide sequence is shown as SEQ ID No. 2.

3. The kappa-carrageenase preparation and purification method according to claim 1, characterized by the following steps:

transferring Escherichia coli BL21(DE3)/pET22b-cgkA into an LB liquid culture medium, containing 50 mug/mL ampicillin, shaking-culturing in a shaker at 37 ℃ at 180rpm until OD600 is 0.6, adding an inducer isopropyl- β -D-thiogalactoside with the final concentration of 0.1mM, inducing at 20 ℃ for 24 hours, after fermentation is stopped, centrifuging at 12000rpm for 10 minutes, discarding thalli, collecting supernatant, loading onto a nickel ion affinity chromatography column at the loading flow rate of 5mL/min, eluting with 10mM imidazole, removing impure protein, eluting with 150mM imidazole, collecting elution components, dialyzing active components, and removing imidazole to obtain the product;

the preparation method of the Escherichia coli BL21(DE3)/pET22b-cgkA is as follows:

taking a kappa-carrageenase CgkA gene sequence and restriction enzymes Nco I and Xho I as enzyme cutting sites, designing a recombinant primer as follows:

a forward primer: SEQ ID NO. 3: PcgkAF:

5’-CATGCCATGGATGCTGGGCACCCCGAGCC-3’ (Nco I)

reverse primer: SEQ ID NO. 4: PcgkAR:

5’-CCGCTCGAGGTTCACGGTGATCATCA-3’ (Xho I)

PCR amplification conditions are, pre-denaturation at 94 ℃ for 3 minutes, denaturation at 94 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, extension at 72 ℃ for 1 minute for 30 cycles, extension at 72 ℃ for 5 minutes, stabilization at 4 ℃ for 15 minutes, PCR reaction using Primerstar HS, restriction enzymes Nco I and Xho I, recovery of the PCR product by agarose gel electrophoresis, pET22b (+) plasmid DNA, Invitrogen, double digestion using restriction enzymes Nco I and Xho I, agarose gel electrophoresis and recovery of the product fragments after digestion, enzyme and substrate reaction systems for digestion are referred to the product description provided by the Dactyla, PCR product treated by double digestion and pET-22b (+) vector reference DNA ligase, commercially available from Dactyla, named ligation reaction, the ligation product is transferred to strain 39DH 56, purchased from 389, cultured on a solid medium containing ampicillin-gel at 35 mL/32 ℃ for 50 mL, cultured on a single colony-medium containing plasmid DNA (LB-22 g) containing ampicillin, plasmid DNA, plasmid;

the enzyme production gene cgkA of the kappa-carrageenase CgkA is derived from marine bacteria Vibrio sp.SY01, the strain is preserved in China center for type culture Collection, and the preservation number is CCTCC No: m2018769.

4. Use of the kappa-carrageenase according to claim 1 for degrading carrageenans.

5. Use of the kappa-carrageenase according to claim 1 for the preparation of carrageenan oligosaccharides.

6. A method for hydrolyzing carrageenan is characterized by comprising the following steps: adding the kappa-carrageenase according to claim 1 after the carrageenase substrate is incubated for 10min at 0-70 ℃, wherein the kappa-carrageenase is dissolved in phosphate buffer solution with pH 7.3.

7. The method of claim 5, wherein the steps of: adding the kappa-carrageenase according to claim 1 after the carrageenase substrate is incubated for 10min at 0-70 ℃, wherein the kappa-carrageenase is dissolved in phosphate buffer solution with pH 7.3.