CN112680427B - Dehalogenase HldD1 and coding gene and application thereof - Google Patents

Abstract

The invention discloses a dehalogenase HldD1 and a coding gene and application thereof. The invention provides a protein which is shown as a sequence 2 in a sequence table. Experiments prove that the dehalogenase HldD1 obtained by prokaryotic expression of escherichia coli by adopting the gene sequence (sequence 1) has high activity and stronger organic solvent stability under the treatment conditions of not more than 20% of ethanol, 20% of acetonitrile and 40% of DMSO respectively.

Description

Dehalogenase HldD1 and coding gene and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a dehalogenase HldD1, and a coding gene and application thereof.

Background

Halogenated organics have wide applications in many fields. The large amount of the pollution-free environment-friendly organic fertilizer is used in industrial enterprises and daily necessities, so that the pollution-free environment-friendly organic fertilizer becomes an important environmental pollutant. These halogenated organics have been widely responsible for environmental problems in the biosphere for many years due to their chemical stability. Halogenated organics are the most used and studied class of organics, primarily due to their relatively simple synthetic route. However, the biodegradability of halogenated organics has been poor for years, due to their generally high stability and their toxicity even to the microorganisms that are likely to degrade them. Excessive contact with these halogenated contaminants can lead to serious environmental and health consequences. In nature, the biodegradability for decomposing these pollutants is limited, so that for many years, mankind still invests a great deal of manpower and financial resources in the remediation and treatment of polluted environments. The microbial remediation technology is a main means for treating environmental pollution caused by halogenated organic matters. In recent years, the development of the technology is receiving more and more attention from researchers.

Microbial dehalogenation is mainly achieved by strain-induced production and release of dehalogenase. Different dehalogenases have different specific substrates, including chloro, bromo, iodo organics, and different chain lengths, where the preference of the substrate depends on the respective catalytic mechanisms of the different dehalogenases. The main catalytic mechanism of dehalogenation is nucleophilic substitution, and according to the classification of catalytic substrate types, dehalogenases can be classified into Haloacid dehalogenases (EC3.8.1.2, haloacid dehalogenases, HAD), haloalkane dehalogenases (EC3.8.1.5, haloalkane dehalogenases, HLDs), 4-chlorobenzoyl-CoA dehalogenases, haloacrylic acid dehalogenases, etc. The two most common types of dehalogenases are the haloacid dehalogenase and the haloalkane dehalogenase, which are both hydrolytic dehalogenases.

The dehalogenase not only plays a key role in degrading pollutants such as pesticides, chemical warfare agents, PCDD/Fs and the like, but also is widely applied to a plurality of fields such as industry, animal husbandry and the like. Therefore, the development of novel dehalogenases with excellent properties has important application value and social significance.

Disclosure of Invention

In order to develop dehalogenase with excellent properties, the invention provides the following technical scheme:

an object of the present invention is to provide a dehalogenase HldD1 and a gene encoding the same.

The invention provides a protein, which is a dehalogenase HldD1 or a recombinant dehalogenase HldD1 thereof, and specifically comprises any one of the following (a 1) to (a 5):

(a1) Protein shown in a sequence 2 in a sequence table;

(a2) Protein shown in 1 st-308 th site of a sequence 2 in a sequence table;

(a3) A fusion protein obtained by connecting a label to the N-terminal or/and the C-terminal of the protein in (a 2);

(a4) A protein having dehalogenase activity obtained by substituting and/or deleting and/or adding one or more amino acid residues to any one of (a 1) to (a 3);

(a5) A protein having 98% or more identity to any one of (a 1) to (a 3) and having dehalogenase activity.

The labels are specifically shown in table 1.

TABLE 1 sequences of tags

Label (R)	Residue(s) of	Sequence of
			Poly-Arg	5-6 (generally 5)	RRRRR
Poly-His	2-10 (generally 6)	HHHHHH
			FLAG
	8	DYKDDDDK
			Strep-tag II	8	WSHPQFEK
c-myc	10	EQKLISEEDL
			HA	9	YPYDVPDYA

Nucleic acid molecules encoding the above proteins are also within the scope of the present invention.

The nucleic acid molecule is a DNA molecule represented by any one of the following (b 1) to (b 4):

(b1) A DNA molecule shown as a sequence 1 in a sequence table;

(b2) DNA molecules shown in 1 st-924 th site of a sequence 1 in a sequence table;

(b3) A DNA molecule having 95% or more identity to the nucleotide sequence defined in (b 1) or (b 2) and encoding the protein;

(b4) A DNA molecule which hybridizes with the nucleotide sequence defined in (b 1) or (b 2) under stringent conditions and encodes the protein.

The stringent conditions may be conditions in which hybridization is carried out at 65 ℃ using a solution obtained by 0.5% SDS in 6 XSSC, and then membrane washing is carried out once using 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS, respectively.

Expression cassettes, recombinant vectors or recombinant microorganisms containing the above-described nucleic acid molecules are within the scope of the present invention.

The expression cassette may be composed of a promoter capable of promoting expression of the DNA molecule, the nucleic acid molecule, and a transcription termination sequence, and in one embodiment of the present invention, the promoter of the nucleic acid molecule is a T7 promoter and the terminator is a T7 terminator.

The recombinant vector can be a recombinant expression vector and can also be a recombinant cloning vector.

The recombinant expression vector can be constructed using existing expression vectors. The expression vector may also comprise the 3' untranslated region of the foreign gene, i.e., a region comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The poly A signal can direct the addition of poly A to the 3' end of the mRNA precursor. When the gene is used for constructing a recombinant expression vector, any one of enhanced, constitutive, tissue-specific or inducible promoters can be added before the transcription initiation nucleotide, and can be used alone or combined with other promoters; in addition, when a recombinant expression vector is constructed using the gene of the present invention, an enhancer, including a translation enhancer or a transcription enhancer, may also be used. In order to facilitate the identification and screening of the transgenic cells, the expression vector used may be processed, for example, a gene to which a luminescent compound is added (GFP gene, luciferase gene, etc.), an antibiotic marker having resistance (gentamicin marker, kanamycin marker, etc.), or the like.

In One embodiment of the present invention, the recombinant vector is pET-D1, which is a recombinant vector obtained by replacing a DNA molecule containing the HldD1 gene shown in sequence 1 with a DNA molecule containing multiple Cloning sites Nde I (CATATG) to Hind III (AAGCTT) in pET-21a (+) vector, and maintaining the other sequences of pET-21a (+) vector unchanged (the replacement method is described in Clon Multi One Step Cloning Kit (ed.C.) of Von. Nuo), the vector contains a DNA molecule shown in sequence 1, and the T7 promoter of the vector is used to promote the DNA molecule shown in sequence 1 to express the recombinant protein HldD1 shown in sequence 2.

The recombinant bacterium is obtained by introducing the DNA molecule or the expression cassette or the recombinant vector into a host bacterium, and in one embodiment of the invention, the host bacterium is Escherichia coli.

It is another object of the invention to provide the following applications.

The invention provides the use of said protein of the first object as a dehalogenase;

or the invention provides the use of said nucleic acid molecule of the first object, or said expression cassette, recombinant vector or recombinant microorganism, for the preparation of a dehalogenase.

The above dehalogenase is specifically a haloalkane dehalogenase.

The invention also provides a method for preparing dehalogenase, which comprises the following steps: inducing and culturing said recombinant microorganism of the first object to obtain a dehalogenase.

In an embodiment of the invention, the induction culture is:

(a2) IPTG was added to the recombinant microorganism culture system to a final concentration of 0.5mM (OD of the culture system when IPTG was added) ₆₀₀ The value reaches about 0.6-0.8), culturing for 18 hours at the temperature of 16 ℃;

(a2) And (b) disrupting the cells obtained in step (a 1) by sonication (e.g., sonication for 5s, power at intervals of 5s,40w, 50 cycles) and centrifuging (e.g., 6,500rpm for 20 min), and obtaining the dehalogenase from the supernatant obtained by the centrifugation.

In step (a 2), a step of purifying the supernatant (e.g., performing nickel column affinity chromatography purification and desalting purification) is further included after the centrifugation.

In one embodiment of the present invention, the supernatant is purified by a method comprising the following steps:

the first step is as follows: nickel column affinity chromatography purification (e.g.using a 1ml loading of HiTrap chromatography HP column in the AKTA FPLC System from Amersham) was carried out, comprising the following steps: performing equilibrium purification on the column by using a non-denatured nickel column combined with a buffer solution I and loading (wherein, the loading amount of the protein can be 10ml, and the flow rate can be set as 1 ml/min); washing with a non-denatured nickel column binding buffer solution I to remove non-specifically bound hybrid protein; eluting with non-denaturing nickel column eluting buffer solution in linear gradient of 0-100%, and collecting the eluate containing eluting peak.

Wherein, the composition of the non-denatured nickel column binding buffer solution I is as follows: 20mM Tris-HCl,500mM NaCl,20mM imidazole, pH 7.5.

The composition of the non-denatured nickel column elution buffer II is as follows: 20mM Tris-HCl,500mM NaCl,500mM imidazole, pH 7.5.

The second step is that: the eluate obtained in the first step was purified by a desalting column Hitrap Q (Pharmacia) (5 mL) with a desalting buffer: 50mM Gly-NaOH, pH 8.2.

The use of said protein or said nucleic acid molecule or said expression cassette, recombinant vector or recombinant microorganism of the first object for the removal of halogen groups from halogenated organic substances is also within the scope of the present invention.

Alternatively, the use of said protein or said nucleic acid molecule or said expression cassette, recombinant vector or recombinant microorganism of the first object in the treatment of halogenated organic pollutants is also within the scope of the present invention.

It is yet another object of the present invention to provide a method for removing halogen radicals from halogenated organics.

The method provided by the invention comprises the following steps: and catalyzing halogenated organic matters by using the protein in the first purpose to remove halogen groups on the halogenated organic matters.

In the method, the temperature of the catalysis is 15-40 ℃, wherein the optimal temperature of the catalysis is specifically 40 ℃;

the pH value of the catalysis is 7.0-9.0, wherein the optimum pH value of the catalysis is 8.2.

The halogenated organic matter can be 1,3-dibromopropane, 1,3-dichloropropane, 1,2-dibromoethane, 1-bromo-2-methylpropane, 1-chloropentane, 1-bromohexane or bromocyclohexane, and the most suitable halogenated organic matter in the embodiment of the invention is 1,3-dibromopropane.

Experiments prove that the dehalogenase HldD1 obtained by prokaryotic expression of escherichia coli by adopting the gene sequence (sequence 1) has the characteristics of high activity, strong stability and the like.

Drawings

FIG. 1 is an electrophoresis diagram of the expression of the HldD1 protein; m, protein molecular weight markers (Fermentas, SM 0431); 1. the hldD1 gene recombination expression strain pET-D1[ BL21 (lambda DE 3) ] is a whole bacteria liquid of 16 ℃ induction expression; 2. the hldD1 gene recombination expression strain pET-D1[ BL21 (lambda DE 3) ]16 ℃ induces the expressed supernatant; 12.5% SDS-PAGE detection.

FIG. 2 shows relative enzyme activities of the HldD1 protein on different substrates.

FIG. 3 shows the determination of the optimum temperature of the HldD1 protein.

FIG. 4 shows the measurement of the heat stability of the HldD1 protein.

FIG. 5 shows the measurement of the stability of the HldD1 protein in organic solvents.

FIG. 6 shows the measurement of pH stability of the HldD1 protein.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 expression and Activity measurement of the HldD1 protein

1. Acquisition of a Gene encoding the HldD1 protein

Using the genome DNA of the new strain D1 separated from the Indian ocean deep sea sediment sample as a template, carrying out PCR amplification by using D1F and D1R primers:

D1F：5’-AAGAAGGAGATATACATATGGCCATCGACGCCCTGCGCACC-3’

D1R：5’-TCGAGTGCGGCCGCAAGCTTGCCGAGCCCGAACTTCTCCAG-3’

recovering PCR amplification product, cloning to pET21a (+) vector (Novagen) to obtain recombinant vector pET-D1, transforming the recombinant vector into Escherichia coli BL21 (DE 3), and then, delivering for sequencing.

The sequencing result shows that: the vector contains the nucleotide shown in a sequence 1, a gene in the sequence 1 is named as HldD1, the coding region of the gene is 1 st to 924 th positions of the sequence 1, the protein coded by the gene is named as HldD1, and the amino acid sequence of the HldD1 is shown as 1 st to 308 th positions of a sequence 2.

In the DNA molecule shown in the sequence 1, the 1-924 th site is the coding region of the HldD1 gene, the 925-966 th site is the plasmid vector pET21a (+) (Novagen) stop codon and the coding sequence which is before the stop codon and contains 6 his tag sequences, and the AAGCTTGCGGCCGCACTCGAG sequence (comprising 42 nucleotides in total of three restriction enzyme recognition sites (Hind III (AAGCTT), not I (GCGGCCGC), xho I (CTCGAG)).

The protein shown in the sequence 2 is a recombinant protein HldD1, wherein the 1 st to 308 th positions are the amino acid sequence of the HldD1 protein, and the 309 th to 321 th positions are amino acid residues which are expressed in the 925 th to 966 th positions of the sequence 1 and contain 6 His tags; 316-321 are 6 His tags.

The sequence 1 can be artificially synthesized.

2. Obtaining dehalogenase HldD1

1. Construction of recombinant vectors

PCR amplification was performed with pET21aF and pET21aR primers using pET21a (+) vector as template:

pET21aF：5’-AAGCTTGCGGCCGCACTC-3’

pET21aR：5’-CATATGTATATCTCCTTC-3’

the 5385bpPCR amplification product was recovered and ligated to the synthetic sequence 1 by homologous recombination according to the Clon express MultiS One Step Cloning Kit of Novonoprazan. The recombinant vector pET-D1 is obtained and sent for sequencing.

The sequencing result shows that: pET-D1 is a recombinant vector obtained by replacing a DNA molecule containing the HldD1 gene shown in the sequence 1 with a DNA between Nde I (CATATG) and Hid III (AAGCTT) containing multiple cloning sites in a pET-21a (+) vector, and maintaining the other sequences of the pET-21a (+) vector unchanged, wherein the vector contains the DNA molecule shown in the sequence 1, and the T7 promoter of the vector is utilized to start the DNA molecule shown in the sequence 1 to express a recombinant protein HldD1 shown in the sequence 2.

2. Obtaining of recombinant bacteria

Transforming the recombinant vector pET-D1 obtained in the step 1 into escherichia coli BL21 (DE 3) by using a calcium chloride chemical transformation method to obtain recombinant bacteria, screening and culturing the recombinant bacteria by using an LB culture medium containing ampicillin (100 mu g/ml), selecting a single colony, extracting plasmids, verifying the plasmids (amplifying by using primers D1F and D1R to obtain 961bp which is positive), and naming the finally obtained positive recombinant bacteria as pET-D1[ BL21 (DE 3) ].

3. Obtaining dehalogenase HldD1

Picking pET-D1[ BL21 (DE 3)]The single colony of (2) was inoculated into LB medium containing ampicillin (100. Mu.g/ml) and cultured overnight at 37 ℃. The overnight culture was inoculated into 100mL of LB medium containing ampicillin (100. Mu.g/mL), and cultured with shaking (200 rpm) at 37 ℃ to OD of the fermentation broth ₆₀₀ The value reaches about 0.6-0.8, IPTG (final concentration of 0.5 mM) is added into the fermentation system, and the culture is carried out for 18 hours under the condition of 16 ℃. After fermentation, centrifuging at 5000rpm for 15 minutes, removing supernatant, and collecting thalli; the cells were resuspended in undenatured nickel column in buffer I, sonicated (5 s sonication, 5s pause, 40w power, 50 cycles) and centrifuged at 12,000rpm for 15min. The supernatant was collected as a crude enzyme solution containing the recombinant protein HldD1, and the band size of the target recombinant protein HldD1 was 40kD (this protein is the recombinant protein HldD1 shown in SEQ ID NO: 2) (FIG. 1).

4. Purification of dehalogenase HldD1

The composition of the non-denaturing nickel column binding buffer I was as follows: 20mM Tris-HCl,500mM NaCl,20mM imidazole, water as solvent, pH 7.5.

The composition of the non-denaturing nickel column elution buffer II was as follows: 20mM Tris-HCl,500mM NaCl,500mM imidazole, solvent water, pH 7.5.

The composition of the desalting buffer was as follows: 50mM Gly-NaOH, pH 8.2.

The supernatant was purified by nickel column affinity chromatography using 1ml of HiTrap chromatography HP column in an AKTA FPLC system from Amersham. Performing equilibrium purification on the column body by using a non-denatured nickel column combined with a buffer solution I, and loading the column body with the protein loading amount of 10ml and the flow rate of 1ml/min; washing with a non-denatured nickel column binding buffer solution I to remove non-specifically bound hybrid protein; eluting with non-denaturing nickel column eluting buffer solution in linear gradient of 0-100%, and collecting the eluate containing eluting peak. The eluate was purified by a desalting column Hitrap Q (5 mL) to give a purified recombinant protein HldD1 concentration of 2.477mg/mL.

3. Method for measuring dehalogenase activity

1. Method for measuring enzyme activity

Haloalkane dehalogenases catalyze the dehalogenation of haloalkanes to produce halohydrins, halide ions and protons. The principle of the colorimetric method is to measure the hydrogen ion content in the reaction system by using a phenol red indicator, and the principle of the ionic electrode method is to measure the halogen ion content in the reaction system by measuring the conductivity.

R-CH ₂ Cl+H ₂ O→R-CH ₂ OH+HCl

The dehalogenase activity unit is defined as: under optimal conditions, the amount of enzyme required to catalyze the dehalogenation reaction of 1. Mu. Mol of substrate per minute.

(1) A colorimetric method:

experimental groups: the purified recombinant protein HldD1 obtained in the above two steps was diluted to 200. Mu.g/mL with a desalting buffer (50 mM Gly-NaOH, pH 8.2). And (3) adding 20 mu L of diluted enzyme into 180 mu L of colorimetric assay active buffer solution, fully and uniformly mixing, immediately reacting for 10min at the optimal temperature, immediately placing the reaction system on ice to terminate the reaction, and measuring the value of absorbance at 540nm by using an enzyme-labeling instrument. The difference between the experimental group and the control group of substrate self-hydrolysis is compared with a standard curve (y = -0.4211x +0.846, x is the hydrogen ion concentration, y is the light absorption value of 540nm, and the standard is concentrated hydrochloric acid HCl, diluted to different concentrations) to obtain the determination result. The experiment was repeated 3 times.

Colorimetric assay of live buffer: 1mM HEPES,1mM EDTA,20mM Na2SO4, 10mM reaction substrate, 20. Mu.g/mL phenol red, pH 8.2.

Control group of autohydrolysis of the above substrates: the difference from the experimental group is that no enzyme was added.

(2) Ion electrode method:

the purified recombinant protein HldD1 obtained in the second step was diluted to 200. Mu.g/mL with a desalting buffer. Adding 200 mu L of diluted enzyme into 1.8mL of ion electrode method activity detection buffer solution, uniformly mixing, reacting for 10min at the optimum temperature, stopping the reaction on ice, measuring the halogen ion concentration difference before and after the reaction in the experimental group and the control group of substrate self-hydrolysis by using an ion analyzer, and calculating to obtain the measurement result. The experiment was repeated 3 times.

Ionic electrode assay live buffer: 100mM HEPES,10mM reaction substrate, pH 8.2.

Control group of autohydrolysis of the above substrates: the difference from the experimental group is that no enzyme was added.

2. Substrate specificity of dehalogenase HldD1

1,3-dibromopropane, 1,3-dichloropropane, 1,2-dibromoethane, 1-bromo-2-methylpropane, 1-chloropentane, 1-bromohexane and bromocyclohexane are respectively selected as reaction substrates and are measured by a colorimetric method, and the reaction temperature is 40 ℃; and the enzyme activity when catalyzing the optimal substrate is defined as 100%, and the relative activity for catalyzing other substrates is calculated. Three replicates were designed for each experimental group.

The results are shown in figure 2 of the drawings,

the optimal substrate for HldD1 was 1,3-dibromopropane, with a specific activity of 1612.44U/mg, defining its relative activity as 100%. HldD1 shows higher specificity for carbon chain length. Except for an optimal substrate 1,3-dibromopropane, the catalyst has relatively high catalytic activity (38.9%) on 1,2-dibromoethane with short carbon chains and similar length; the relative activity of halogenated alkane 1-bromohexane with relatively long carbon chain and bromocyclohexane with a cyclic structure is very low, and the activity is only 10.5 percent and 21.6 percent of the optimal substrates of 1,3-dibromopropane respectively. In addition, hdlD1 showed very high specificity for the type of halogen substrate. It has no obvious catalytic activity on 1,3-dichloropropane (0.6%) and 1-chloropentane (2,9%). Meanwhile, 1-bromo-2-methylpropane containing branches is obviously different from 1,3-dibromopropane in spatial structure, and the relative activity (10.5%) is remarkably lower than the optimal substrate although the main chain length is consistent.

3. Optimum temperature measuring method for dehalogenase HldD1

Performing experiments by using a colorimetric method at reaction temperatures of 4 ℃, 15 ℃,20 ℃, 30 ℃,40 ℃,50 ℃, 60 ℃, 70 ℃ and 80 ℃ respectively; the substrate was 1,3-dibromopropane. The enzyme activity at the optimum temperature determined was defined as 100%, and the relative activities at other reaction temperatures were calculated. Three replicates were designed for each experimental group.

As shown in FIG. 3, the optimal temperature of the purified recombinant protein HldD1 was 40 ℃ and the specific activity was 1612.44U/mg, defining the relative activity as 100%. Under the condition of lower temperature, the HldD1 hardly shows catalytic activity, and the relative activity is lower than 5%. In the range of 15-40 deg.c, the relative activity is obviously raised with the temperature raised in the set reaction condition. Whereas at temperatures above 40 ℃, the relative activity decreases rapidly with further increase in temperature in the reaction conditions. The specific activity of HldD1 was only 31.2% at 50 ℃ as compared with that at 40 ℃. After the reaction temperature is higher than 50 ℃, the relative activity is gradually reduced until the catalyst is not active.

4. Determination method for thermal stability of dehalogenase

Selecting the treatment temperature of 40 ℃,50 ℃, 60 ℃ and 70 ℃; different groups are set, and the purified recombinant protein HldD1 is subjected to heat treatment at different temperatures for 30min, 60min and 90min respectively. The activity of the treated enzyme is measured by a colorimetric method, and the substrate is 1,3-dibromopropane. The enzyme activity of the control group without heat treatment was defined as 100%, the specific activity was 1612.44U/mg, and the relative activity of the different experimental groups was calculated. Three replicates were designed for each experimental group.

As shown in FIG. 4, the relative activity of the enzyme was not significantly reduced (96.0%) by heat treatment at 40 ℃ for 90 min; the relative activity of the enzyme can not be reduced within 60min after heat treatment at 50 ℃, and the specific activity of the enzyme is still more than 80% of that of a control group after the heat treatment time is prolonged to 90 min; under the condition of 60 ℃, the relative activity of the material is gradually reduced to 36.5 percent along with the continuous increase of the heat treatment time; at the heat treatment temperature of 70 ℃, the specific activity of the enzyme rapidly decreases to less than 30% of the specific activity before the treatment within 30min, and the HldD1 gradually loses activity with further extension of the treatment time.

5. Method for measuring stability of dehalogenase organic solvent

Different groups are set, the purified recombinant protein HldD1 is respectively placed in 10%, 20%, 30%, 40%, 50%, 60% and 70% methanol aqueous solution, ethanol aqueous solution, DMSO aqueous solution and acetonitrile aqueous solution by volume percentage, after the treatment for 1h at room temperature, the activity of the recombinant protein is measured by a colorimetric method, the substrate is 1,3-dibromopropane, and the reaction temperature is 40 ℃. The relative activity of the control group without organic solvent treatment was defined as 100% and the specific activity was 1612.44U/mg, and the relative activity of the experimental group was calculated. Three replicates were designed for each experimental group.

The results are shown in fig. 5, where it can be seen that HldD1 is least tolerant to methanol, with a rapid decrease in relative viability to 22.6% under low concentration (10% -20%) treatment conditions; under the low-concentration treatment condition of ethanol and acetonitrile, the relative activity of the enzyme is hardly influenced, and the specific activity of the enzyme is rapidly reduced along with the further increase of the concentration of the organic solvent, until the catalytic activity of the HldD1 is basically lost (the relative activity is lower than 10%) after the ethanol concentration is higher than 40% and the acetonitrile concentration is higher than 50%. Under the condition of DMSO treatment, when the concentration of the enzyme is lower than 40%, the activity of the enzyme is relatively higher and still can be kept above 75% of the specific activity of a control group, and the relative activity gradually decreases to 26.8% with further increase of the DMSO concentration.

6. Determination method for pH stability of dehalogenase

Preparing citric acid-sodium citrate buffer solutions at pH 5.0 and 6.0, tris-H at pH 7.0 and 9.0 ₂ SO ₄ Buffer and pH 10.0 and 11.0 sodium carbonate-sodium bicarbonate buffer; and respectively placing the dehalogenases in the buffer solution, treating for 5 hours at room temperature, and then performing activity determination according to an ion electrode method, wherein a substrate is 1,3-dibromopropane, and the reaction temperature is 40 ℃. The enzyme activities of the groups which were not treated, i.e., left at room temperature for 5 hours at pH8.2, were defined as 100%, and the specific activities were 1612.44U/mg, and the relative activities of the enzymes treated under other pH conditions were calculated. Three replicates were designed for each experimental group.

Citric acid-sodium citrate buffer: the final concentration of 100mM sodium citrate was diluted in distilled water and adjusted to the pH required for the experiment.

Tris-H ₂ SO ₄ Buffer solution: the final concentration of 100mM Tris was diluted in distilled water and adjusted to the desired pH for the experiment.

Sodium carbonate-sodium bicarbonate buffer: sodium bicarbonate was dissolved in distilled water to a final concentration of 100mM and adjusted to the desired pH for the experiment.

The results are shown in fig. 6, the high catalytic activity can be still maintained after the treatment under the condition of pH 7.0 to pH 9.0, and the relative activity is more than 80%; whereas the tolerance of the HldD1 decreased significantly after pH below 7.0 or above 9.0, where the pH decreased to 5.0 with a relative activity of 13.2% and the pH increased to 11.0 with a relative activity of 36%; the optimum pH value is 8.2, and the relative activity is 100%.

7. Enzymatic reaction kinetic parameter determination method of dehalogenase

Preparing optimal substrate 1,3-dibromopropane by colorimetric assay activity buffer solution, wherein the optimal substrate concentration is respectively 0.1mM, 0.15mM, 0.2mM, 0.3mM, 0.5mM, 1mM, 2mM, 3mM and 5mM; taking different optimal substrate concentrations as an experimental group, carrying out a colorimetric method experiment, wherein the reaction temperature is 40 ℃, and the concentration of each substrate is measured in parallel for three times; in the reciprocal 1/[ S ] of the substrate concentration]Plotted on the abscissa and the reciprocal 1/v of the reaction rate on the ordinate, the slope of the resulting line being K _m /V _max The intercept of the resulting line is 1/V _max Then calculating the kinetic parameter V of the enzymatic reaction according to the concentration and the molecular weight of the dehalogenase _max 、K _m 、k _cat And k _cat /K _m 。

As a result: the maximum reaction speed of the enzyme is V measured by using 1,3-dibromopropane as a substrate _max =0.54mM/min, mie's constant K _m =0.95mM, turnover number k _cat ＝17.90s ^-1 ，k _cat /K _m Is 18.95mM ^-1 ·s ^-1 。

SEQUENCE LISTING

<110> institute of research and development of mineral resources of the Chinese Atlantic institute of microbiology, china academy of sciences (China Atlantic affairs administration)

<120> dehalogenase HldD1 and coding gene and application thereof

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 966

<212> DNA

<213> Artificial sequence

<400> 1

atggccatcg acgccctgcg cacccccgac gaacgatttc agaacctttc cggctgggat 60

tacgccccgc gctatattga cgacctgccg ggttatgagg ggctccgcat gcattatgtc 120

gacaaagggc cgaaggatgg cgtgacgttc ctgtgcattc atggtgagcc ctcatggtct 180

tatctcttcc gcaagatggc gccggtgttc ctggacgccg gtcaccgctt tgtggcggtc 240

gacatgttcg gcttcgggcg ctccgacaag ccggtggacg atgatgtcta cacctatcat 300

tttcaccgca atgccctcct cgcttttgtc gagcgcatgg acctgaacaa tgtctgtctc 360

gtcgtgcagg actggggcgg gctgctcggc ctcacgctgc cgctggaagc gccggcgcgg 420

tatacgcgcc ttatcgtcat gaataccggg cttcccgcgg gcgagaacgc gggcgaaggc 480

ttcgccgcct ggcgcgcgtt ctgtaaagcc aatcccgatc tcgatgttgg tgcgctgatg 540

aaacgcgcaa cgcccatcct taccgatgat gaagtcgccg cctatgccgc gcccttcccg 600

gatgtgaaat acaaagccgg cgtaagacgc tttccggaac tcgtcatgct caccggcggg 660

aaagatgagc cgttgacccc gtccgccagc gaaggcgttg aaacctcatt gaaagcgcac 720

aaattctggt cagaagactg gaccggcgac agcttcatgg ccatcggcat gcaggatcct 780

gttttgggtc cgcccgccat gcatatgctc cgcaaggtga ttaaaaactg ccccgagccg 840

atggaagtcg cggacggcgg ccacttcgtc caggaatggg gcgaaccgat tgcgaaagcg 900

gcgctggaga agttcgggct cggcaagctt gcggccgcac tcgagcacca ccaccaccac 960

cactga 966

<210> 2

<211> 321

<212> PRT

<213> Artificial sequence

<400> 2

Met Ala Ile Asp Ala Leu Arg Thr Pro Asp Glu Arg Phe Gln Asn Leu

1 5 10 15

Ser Gly Trp Asp Tyr Ala Pro Arg Tyr Ile Asp Asp Leu Pro Gly Tyr

20 25 30

Glu Gly Leu Arg Met His Tyr Val Asp Lys Gly Pro Lys Asp Gly Val

35 40 45

Thr Phe Leu Cys Ile His Gly Glu Pro Ser Trp Ser Tyr Leu Phe Arg

50 55 60

Lys Met Ala Pro Val Phe Leu Asp Ala Gly His Arg Phe Val Ala Val

65 70 75 80

Asp Met Phe Gly Phe Gly Arg Ser Asp Lys Pro Val Asp Asp Asp Val

85 90 95

Tyr Thr Tyr His Phe His Arg Asn Ala Leu Leu Ala Phe Val Glu Arg

100 105 110

Met Asp Leu Asn Asn Val Cys Leu Val Val Gln Asp Trp Gly Gly Leu

115 120 125

Leu Gly Leu Thr Leu Pro Leu Glu Ala Pro Ala Arg Tyr Thr Arg Leu

130 135 140

Ile Val Met Asn Thr Gly Leu Pro Ala Gly Glu Asn Ala Gly Glu Gly

145 150 155 160

Phe Ala Ala Trp Arg Ala Phe Cys Lys Ala Asn Pro Asp Leu Asp Val

165 170 175

Gly Ala Leu Met Lys Arg Ala Thr Pro Ile Leu Thr Asp Asp Glu Val

180 185 190

Ala Ala Tyr Ala Ala Pro Phe Pro Asp Val Lys Tyr Lys Ala Gly Val

195 200 205

Arg Arg Phe Pro Glu Leu Val Met Leu Thr Gly Gly Lys Asp Glu Pro

210 215 220

Leu Thr Pro Ser Ala Ser Glu Gly Val Glu Thr Ser Leu Lys Ala His

225 230 235 240

Lys Phe Trp Ser Glu Asp Trp Thr Gly Asp Ser Phe Met Ala Ile Gly

245 250 255

Met Gln Asp Pro Val Leu Gly Pro Pro Ala Met His Met Leu Arg Lys

260 265 270

Val Ile Lys Asn Cys Pro Glu Pro Met Glu Val Ala Asp Gly Gly His

275 280 285

Phe Val Gln Glu Trp Gly Glu Pro Ile Ala Lys Ala Ala Leu Glu Lys

290 295 300

Phe Gly Leu Gly Lys Leu Ala Ala Ala Leu Glu His His His His His

305 310 315 320

His

Claims (10)

1. A protein which is any one of the following (a 1) to (a 3):

(a1) Protein shown in a sequence 2 in a sequence table;

(a2) Protein shown in 1 st-308 th site of a sequence 2 in a sequence table;

(a3) And (b) a fusion protein obtained by connecting a tag to the N-terminal or/and the C-terminal of the protein of (a 2).

2. A nucleic acid molecule encoding the protein of claim 1.

3. The nucleic acid molecule of claim 2, wherein: the nucleic acid molecule is a DNA molecule shown in any one of the following (b 1) to (b 2):

(b1) DNA molecule shown in sequence 1 in the sequence table;

(b2) DNA molecules shown in 1 st-924 th site of a sequence 1 in a sequence table.

4. An expression cassette, recombinant vector or recombinant microorganism comprising the nucleic acid molecule of claim 2 or 3.

5. Use of the protein of claim 1 as a dehalogenase;

or the nucleic acid molecule of claim 2 or 3, or the expression cassette, recombinant vector or recombinant microorganism of claim 4, for use in the preparation of a dehalogenase.

6. A method of preparing a dehalogenase comprising the steps of: inducing and culturing the recombinant microorganism according to claim 5 to obtain a dehalogenase.

7. Use of the protein of claim 1 or the nucleic acid molecule of claim 2 or 3 or the expression cassette, recombinant vector or recombinant microorganism of claim 4 for removing halogen groups from halogenated organics;

or, the use of the protein of claim 1 or the nucleic acid molecule of claim 2 or 3 or the expression cassette, recombinant vector or recombinant microorganism of claim 4 for the treatment of pollution by halogenated organic substances;

the halogenated organic matter is 1,3-dibromopropane, 1,2-dibromoethane, 1-bromo-2-methylpropane, 1-bromohexane or bromocyclohexane.

8. A method for removing halogen groups on halogenated organics comprises the following steps: catalyzing a halogenated organic with the protein of claim 1 to effect removal of halogen groups on the halogenated organic;

the halogenated organic matter is 1,3-dibromopropane, 1,2-dibromoethane, 1-bromo-2-methylpropane, 1-bromohexane or bromocyclohexane.

9. The method of claim 8, wherein:

the temperature of the catalysis is 15-40 ℃;

the pH of the catalysis is 7.0 to 9.0.

10. The method of claim 9, wherein:

the temperature of the catalysis is 40 ℃;

the pH of the catalysis was 8.2.

Images